DNA barcoding. Identificatie van plant en dier

Maat: px
Weergave met pagina beginnen:

Download "DNA barcoding. Identificatie van plant en dier"

Transcriptie

1 DNA barcoding Identificatie van plant en dier

2 DNA barcoding Identificatie van plant en dier Berry B. van der Hoorn, Kevin K. Beentjes, Maartje Kijne-van der Sluis Naturalis Biodiversity Center, DNA Barcoding Facility Sylviusweg 72, 2333 BE, Leiden

3 Overzicht Naturalis DNA barcoding Verrijkingsstof Toepassingen

4 Naturalis

5 Naturalis Historie 1820 's Rijks Museum van Natuurlijke Historie 1998 Naturalis 2010 Naturalis Biodiversity Center Organisatie Publiek Collectie Onderzoek

6 Naturalis: Publiek Tentoonstellingen Educatieve dienst Internet Uitgeverij Televisie

7 Naturalis: Collectie Insecten Ongewervelden Gewervelden Hogere planten Fossielen 18,1 miljoen 5,8 miljoen 1,9 miljoen 4,6 miljoen 3,2 miljoen 37 miljoen

8 Naturalis: Onderzoek

9 Naturalis: Onderzoek Leven Domein Rijk Stam Orde Familie Geslacht Soort Taxonomie Fylogenie

10 Naturalis: Onderzoek

11 Naturalis: Onderzoek

12 Naturalis: Identificatie

13 Naturalis: lesmodules

14 Naturalis: Identificatie Environmental-DNA

15 DNA Barcoding Wat & Hoe?

16 Wat is DNA barcoding? DNA barcoding is based on a simple, but powerful premise. It argues that sequence diversity in short, standardized gene regions can provide a sophisticated tool for both the identification of known species and the discovery of new ones. -- Canadian Centre for DNA Barcoding

17 Wat is DNA barcoding?

18 Wat is DNA barcoding? Namen zijn de sleutel tot ontsluiting van kennis Betrouwbare identificaties zijn essentieel Taxonomische expertise noodzakelijk en schaars

19 Wat is DNA barcoding? Geschiedenis 2003: Biological identifications through DNA barcodes. Hebert et al., Proc. R. Soc. Lond. B : Workshops, conferentie 2007: United Nations of Barcoding, Guelph 2009: administratie, plannen ibol 2010: formele start ibol 2010: Naturalis barcoding facility

20 Wat is DNA barcoding? Principe Kort fragment DNA ( bp) In een standaard gebied ( marker ) Inter-species varitatie > Intra-species variatie

21 Wat is DNA barcoding?

22 Wat is DNA barcoding? CTAGTCTTCGGTGCATGGGCCGGCATAGTAGGCACAGCCCTCAGCCTCCTAATTCGGGCAGAACTAGGACAACCA GGAACCCTTCTAGGGGACGACCAGATTTACAACGTAATTGTCACTGCCCACGCCTTTGTAATAATTTTCTTCATG GTAATACCCATCATGATTGGCGGATTTGGAAACTGACTAGTCCCCCTCATAATCGGAGCCCCGGACATAGCATTT CCCCGCATAAATAACATAAGCTTCTGACTACTTCCCCCCTCCTTCCTATTACTGCTAGCATCTTCCACAGTTGAA GCTGGAGCAGGCACAGGATGGACTGTCTACCCACCACTGGCCAGCAACATAGCCCACGCCGGGGCCTCAGTTGAT CTGGCCATTTTTTCGCTCCACTTAGCAGGTATCTCATCAATCCTCGGGGCAATCAACTTCATTACAACCGCCATC AACATAAAACCCCCGGCCCTGTCACAATACCAAACACCCCTATTTGTATGATCAGTCTTCATCACCGCAATCCTA CTTCTGCTATCCCTCCCAGTACTAGCCGCTGGCATTACCATGCTCCTAACTGACCGAAACCTAAACACCACATTC TTTGATCCTGCCGGAGGGGGCGACCCTGTCCTGTACCAGCACCTTTTC

23 Wat is DNA barcoding?

24 Wat is DNA barcoding? Doel Identificatie van bekende soorten Ontdekken van nieuwe soorten Niet fylogenetisch werk

25 Wat is DNA barcoding? DNA barcoding vs. DNA fingerprinting e e

26 Wat is DNA barcoding? DNA barcoding vs. DNA fingerprinting Soorten Dieren en planten Individuen Vnl. Mensen 1 fragment Sequentie-variatie Maternaal (COI) 16 fragmenten Lengte-variatie Combinatie vader/moeder

27 Toepassingen R Welke vogels? Schadelijke soorten? Beschermde soorten?

28 Hoe kom je tot een DNA barcode? Subsampling Specimen Metadata Foto s Lysis DNA Extractie DNA Extracten DNA Bank -80 opslag BOLD Analyse PCR voorbereiding Publicaties DNA Barcodes PCR PCR controle PCR clean-up & Sequencing Sequentie controle

29 Hoe kom je tot een DNA barcode? Verzamelen Veldwerk Collectie 3 tot 5 exx. per soort Data Identificatie / taxonomie Verzamel gegevens Voucher gegevens

30 Naturalis DNA barcoding Doel Fonds Economische Structuurversterking (FES) 33,000 barcodes CBS-KNAW (schimmels) 27,000 barcodes Naturalis Biodiversity Center Naturalis: Focus op Nederlandse flora and fauna Uitdaging Collectie materiaal (<10 jaar oud)

31 Naturalis DNA barcoding Samenwerking met diverse VOFF organisaties Aanlevering vers materiaal

32 Naturalis DNA barcoding Amateur specialisten Verzamelen Identificatie PGO s Coordinatie Sampling Data 95x

33 Naturalis DNA barcoding Een greep uit de barcoding projecten Vlinder collecties (incl. NL): >5.500 exx. Libellen van de wereld: >4.100 exx. Nederlandse vliegen: >2.500 exx. Nederlandse kevers: >2.100 exx. Nederlandse vaatplanten: >1.700 exx. Kinabalu expeditie: >2.000 exx

34 Hoe kom je tot een DNA barcode? Extractie Op subsample (bijv. insectenpootje) Filter / magnetic bead

35 Hoe kom je tot een DNA barcode? Extractie Lysaat met DNA Binding DNA aan bead (of filter) Was stappen Loslaten DNA van bead (of filter)

36 Hoe kom je tot een DNA barcode? PCR Relatief makkelijk door abundantie CO1 = mitochondriaal matk/rbcl = chloroplast ITS = nulceair, maar tandem repeats

37 Hoe kom je tot een DNA barcode? PCR

38 Hoe kom je tot een DNA barcode? Sequencen

39 Hoe kom je tot een DNA barcode? Controle Alignment en NJ boom

40 Hoe kom je tot een DNA barcode? BOLD Opslag gegevens + sequentie + foto Analyse d.m.v. verschillende tools Zoekmachine / referentie

41 Hoe kom je tot een DNA barcode?

42 Hoe kom je tot een DNA barcode?

43 Hoe kom je tot een DNA barcode?

44 Hoe kom je tot een DNA barcode?

45 Hoe kom je tot een DNA barcode?

46 Hoe kom je tot een DNA barcode? CTAGTCTTCGGTGCATGGGCCGGCATAGTAGGCACAGCCCTCAGCCTCCTAATTCGGGCAGAACTAGGACAACCA GGAACCCTTCTAGGGGACGACCAGATTTACAACGTAATTGTCACTGCCCACGCCTTTGTAATAATTTTCTTCATG GTAATACCCATCATGATTGGCGGATTTGGAAACTGACTAGTCCCCCTCATAATCGGAGCCCCGGACATAGCATTT CCCCGCATAAATAACATAAGCTTCTGACTACTTCCCCCCTCCTTCCTATTACTGCTAGCATCTTCCACAGTTGAA GCTGGAGCAGGCACAGGATGGACTGTCTACCCACCACTGGCCAGCAACATAGCCCACGCCGGGGCCTCAGTTGAT CTGGCCATTTTTTCGCTCCACTTAGCAGGTATCTCATCAATCCTCGGGGCAATCAACTTCATTACAACCGCCATC AACATAAAACCCCCGGCCCTGTCACAATACCAAACACCCCTATTTGTATGATCAGTCTTCATCACCGCAATCCTA CTTCTGCTATCCCTCCCAGTACTAGCCGCTGGCATTACCATGCTCCTAACTGACCGAAACCTAAACACCACATTC TTTGATCCTGCCGGAGGGGGCGACCCTGTCCTGTACCAGCACCTTTTC

47

48 Toepassingen R Welke vogels? Schadelijke soorten? Beschermde soorten?

49 Toepassingen R

50 DNA Barcoding Verrijkingsstof

51 MEGA

52 MEGA

53 MEGA

54 MEGA

55 MEGA

56 MEGA

57 Discussie

58 Discussie Denken jullie de les te gaan gebruiken? Voor welke doelgroep (klas) is het een geschikt onderwerp? Wel of niet MEGA gebruiken? Andere suggesties / aanmerkingen?

59 DNA Barcoding Toepassingen

60 Toepassingen Birdstrike Inzicht in schade door vogels Soorten / plaats / seizoen / hoogte Informatie terreinbeheer / planning Probleem: onherkenbare resten Oplossing: DNA barcodes Koninklijke Luchtmacht

61 Toepassingen

62 Toepassingen

63 Toepassingen Environmental-DNA

64 Toepassingen Kinabalu Hoogland endemen: oude of nieuwe soorten? Fylogeografische analyse Meer individuen van een selecte groep soorten

65 Toepassingen Alpine scrub (>3000 m) Moss forest ( m) Lower montane forest ( m) Lowland forest ( m)

66 Toepassingen Cryptische soorten Perichares sp. 8 exemplaren Hoeveel soorten?

67 Toepassingen Burns, et al

68 Toepassingen Next-Gen Sequencing

69 Toepassingen Next-Gen Sequencing

70 Toepassingen Next-Gen Sequencing Resultaten Sorteren Vergelijken met referentie barcodes

71 Toepassingen Next-Gen Sequencing Soorten in water / bodem / ecosysteem Beschermde planten in traditionele medicijnen Voeding van dieren m.b.v. maaginhoud

72 Links / Contact science.naturalis.nl/research/dna-barcoding /

73

. naturalis. nederlands centrum voor biodiversiteit. leiden. plantpathogenen, onderdeel van biodiversiteit? kennis en innovatie in breed perspectief

. naturalis. nederlands centrum voor biodiversiteit. leiden. plantpathogenen, onderdeel van biodiversiteit? kennis en innovatie in breed perspectief . naturalis nederlands centrum voor biodiversiteit. leiden plantpathogenen, onderdeel van biodiversiteit? kennis en innovatie in breed perspectief . naturalis nederlands centrum voor biodiversiteit. leiden

Nadere informatie

Monitoring aquatische biodiversiteit met DNA barcoding veelbelovend

Monitoring aquatische biodiversiteit met DNA barcoding veelbelovend Monitoring aquatische biodiversiteit met DNA barcoding veelbelovend Waterkwaliteit op de kaart II Berry van der Hoorn, Naturalis Michiel Hootsmans, KRW Watercycle centre Roel Knoben, RHDHV 8 oktober 2015

Nadere informatie

Verzamelprotocol DNA barcoding

Verzamelprotocol DNA barcoding Verzamelprotocol DNA barcoding Vaatplanten Doel Het verzamelde organisme wordt gebruikt om DNA uit te isoleren, aan de hand waarvan een DNA barcode bepaald kan worden. DNA extract en organisme (voucher)

Nadere informatie

Verzamelprotocol DNA barcoding

Verzamelprotocol DNA barcoding Verzamelprotocol DNA barcoding Entomologie Doel Het verzamelde organisme wordt gebruikt om DNA uit te isoleren, aan de hand waarvan een DNA barcode bepaald kan worden. Daarnaast wordt het materiaal ook

Nadere informatie

Docentenhandleiding Vogelen met DNA

Docentenhandleiding Vogelen met DNA Docentenhandleiding Vogelen met DNA Doelgroep: 4-5 Havo, 4-6 VWO Leerstofgebied: biologie, erfelijkheid, evolutie Werkvorm: digitaal, alleen of groepswerk (max. 3 leerlingen per groep) Duur: 1 á 2 lesuren

Nadere informatie

Over streepjescodes en boswitjes (DNA-barcoding bij Leptidea) : Hoe, Wat, Waarom? Een inleiding

Over streepjescodes en boswitjes (DNA-barcoding bij Leptidea) : Hoe, Wat, Waarom? Een inleiding Over streepjescodes en boswitjes (DNA-barcoding bij Leptidea) : Hoe, Wat, Waarom? Een inleiding Kurt Jonckheere VVE Werkgroep Dagvlinders 12 maart 2016 Agenda : Wat is een soort? DNA? Hoe ontstaan (nieuwe)

Nadere informatie

waterkwaliteitsonderzoek veranderen?

waterkwaliteitsonderzoek veranderen? Gaat edna het huidige waterkwaliteitsonderzoek veranderen? Barbara Gravendeel @ ILOW symposium Monitoring en Innovatie in Hydrobiologie en Ecologie 15 februari 2017 Utrecht Lectoraat Biodiversiteit doel:

Nadere informatie

Het mossel mysterie: identiteit, vorm en vestiging

Het mossel mysterie: identiteit, vorm en vestiging Het mossel mysterie: identiteit, vorm en vestiging Prof. Dr. Edmund Gittenberger & Dr. Arjan Gittenberger GiMaRIS Naturalis Biodiversity Center, Leiden Instituut Biologie, Universiteit Leiden Paard en

Nadere informatie

Hoe kijken we naar het DNA van een patiënt?

Hoe kijken we naar het DNA van een patiënt? Hoe kijken we naar het DNA van een patiënt? Ies Nijman UMC Utrecht Dept of Genetics, Centre for Molecular Medicine Center for Personalized Cancer Treatment (CPCT), Hartwig Medical Foundation 1994 DNA sequenties,

Nadere informatie

N e d e r l a n d s c e n t r u m v o o r. Naturalis, Zoölogisch Museum Amsterdam en Nationaal Herbarium Nederland bundelen hun krachten

N e d e r l a n d s c e n t r u m v o o r. Naturalis, Zoölogisch Museum Amsterdam en Nationaal Herbarium Nederland bundelen hun krachten N e d e r l a n d s c e n t r u m v o o r biodiversiteitonderzoek NCB Naturalis, Zoölogisch Museum Amsterdam en Nationaal Herbarium Nederland bundelen hun krachten Nederlands Centrum voor Biodiversiteitonderzoek

Nadere informatie

Out of Africa: mtdna en Y chromosoom. Jean-Jacques Cassiman KuLeuven

Out of Africa: mtdna en Y chromosoom. Jean-Jacques Cassiman KuLeuven Out of Africa: mtdna en Y chromosoom Jean-Jacques Cassiman KuLeuven 12.05.2007 Kern DNA CME 06 CME 06 CME 06 Start in 2007: twee zonen per generatie (25j) In 2258 (10 generaties of 250 jaar) zullen er

Nadere informatie

Life at the edge: benthic invertebrates in high altitude Andean streams. Dhr. R.A. Loayza-Muro

Life at the edge: benthic invertebrates in high altitude Andean streams. Dhr. R.A. Loayza-Muro Life at the edge: benthic invertebrates in high altitude Andean streams. Dhr. R.A. Loayza-Muro Samenvatting Gebergtes bedekken ongeveer 27% van het aardoppervlak en bevatten gletsjers en zoetwatervoorraden

Nadere informatie

Een moderne dienstverlening voor musea en erfgoedinstellingen

Een moderne dienstverlening voor musea en erfgoedinstellingen Een moderne dienstverlening voor musea en erfgoedinstellingen Wat is Heron? Heron of Heritage Online staat voor: Een moderne softwaretoepassing voor het beheren, duurzaam bewaren en ontsluiten van al uw

Nadere informatie

Nederlands Soortenregister en Nationale Databank Flora en Fauna (wordt synchroon gehouden)

Nederlands Soortenregister en Nationale Databank Flora en Fauna (wordt synchroon gehouden) Beheer van soortenlijsten Nederlands Soortenregister en Nationale Databank Flora en Fauna (wordt synchroon gehouden) Stand van zaken Mutaties zijn nieuwe adventieven + vroeger gebruikte synoniemen (Gerard

Nadere informatie

2 e SMT Workshop Moleculaire Typeringen spa typering en MLST

2 e SMT Workshop Moleculaire Typeringen spa typering en MLST 2 e SMT Workshop Moleculaire Typeringen spa typering en MLST 28 30 Januari, 2013 UMC Utrecht en RIVM Leo M Schouls Laboratorium voor Infectieziekten en Screening (LIS) Centrum voor Infectieziektebestrijding

Nadere informatie

High through put automatisering in de Genetica. Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 19 11 2014

High through put automatisering in de Genetica. Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 19 11 2014 High through put automatisering in de Genetica Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 19 11 2014 Inleiding Wie? Wat? Hoe? Automatisering / Robotisering Toekomst plannen Medewerkers Afdeling Genetica

Nadere informatie

Handleiding. Geschikte tijd uitvoering jan feb mrt apr mei jun jul aug sep okt nov dec

Handleiding. Geschikte tijd uitvoering jan feb mrt apr mei jun jul aug sep okt nov dec Handleiding Naam opdracht De omgeving met andere ogen bekeken Geschikte tijd uitvoering jan feb mrt apr mei jun jul aug sep okt nov dec zeer geschikt ongeschikt Benodigde materialen opdrachtenbladen pen

Nadere informatie

Moleculaire biologische kwaliteits rondzendingen: Harmonisatie via netwerken. 14 juni 2011 Dr. R. Maatman

Moleculaire biologische kwaliteits rondzendingen: Harmonisatie via netwerken. 14 juni 2011 Dr. R. Maatman Moleculaire biologische kwaliteits rondzendingen: Harmonisatie via netwerken 14 juni 2011 Dr. R. Maatman Overzicht Nationale QCs Europese projecten EQUAL Spidia Biobanken Kwaliteit in harmonisatie 2 SKML

Nadere informatie

Staatsbosbeheer Divisie Ontwikkeling en Beheer S. Thijsen Smallepad MG AMERSFOORT

Staatsbosbeheer Divisie Ontwikkeling en Beheer S. Thijsen Smallepad MG AMERSFOORT > Retouradres Postbus 19530, 2500 CM Den Haag Staatsbosbeheer Divisie Ontwikkeling en Beheer S. Thijsen Smallepad 5 3811 MG AMERSFOORT Postbus 19530, 2500 CM Den Haag mijn.rvo.nl T 088 042 42 42 F 070

Nadere informatie

Al het natuur- en milieuaanbod in Holland Rijnland onder één dak. Samen Duurzaam wordt mogelijk gemaakt door de gemeenten in Holland Rijnland.

Al het natuur- en milieuaanbod in Holland Rijnland onder één dak. Samen Duurzaam wordt mogelijk gemaakt door de gemeenten in Holland Rijnland. 13 mei 2015 nummer 2/2015 Al het natuur- en milieuaanbod in Holland Rijnland onder één dak. Samen Duurzaam wordt mogelijk gemaakt door de gemeenten in Holland Rijnland. Bijen special Dit keer staat de

Nadere informatie

Pedagogische gids (voor leerkrachten)

Pedagogische gids (voor leerkrachten) Pedagogische fiche / Het water van de kanalen Pedagogische gids (voor leerkrachten) Doelstellingen van de les: Weten hoe een kanaal wordt bevoorraad met water en hoe dat water er circuleert. Introductie

Nadere informatie

Wat is biodiversiteit? Hoeveel biodiversiteit is er (wereldwijd en

Wat is biodiversiteit? Hoeveel biodiversiteit is er (wereldwijd en Biodiversiteit Cursus Natuur-in-zicht 1 Inhoud Wat is biodiversiteit? Hoeveel biodiversiteit is er (wereldwijd en bij ons)? Waar komt die biodiversiteit vandaan? Waarom is biodiversiteit belangrijk? Hoe

Nadere informatie

Exoten in het soortenregister. Berry van der Hoorn Vincent Kalkman

Exoten in het soortenregister. Berry van der Hoorn Vincent Kalkman Exoten in het soortenregister Berry van der Hoorn Vincent Kalkman Taxonomie Kenmerken Beschrijvingen Verspreiding Ecologie Beleid & wetgeving Literatuur Sleutels 1. Eerste versie thema exoten (2009)

Nadere informatie

Netwerk Digitaal Erfgoed / Werkgroep Monitoring Vragenlijst aan NDE-projecten 2013/2014

Netwerk Digitaal Erfgoed / Werkgroep Monitoring Vragenlijst aan NDE-projecten 2013/2014 Netwerk Digitaal Erfgoed / Werkgroep Monitoring Vragenlijst aan NDE-projecten 2013/2014 Deze vragenlijst dient om een totaalbeeld te krijgen van de resultaten van de projecten die in 2013/2014 gefinancierd

Nadere informatie

Nieuwsbrief Glashelder! Welkom Wat meer informatie over. ... springstaarten

Nieuwsbrief Glashelder! Welkom Wat meer informatie over. ... springstaarten Welkom Wat meer informatie over... springstaarten Brachystomella parvula, Listrophoroides (Listrophoroides) pahangi, Ballistura schoetti, de meeste deelnemers aan kijken niet meer op van dit soort termen.

Nadere informatie

Maak van je tuin, een levende tuin!

Maak van je tuin, een levende tuin! Maak van je tuin, een levende tuin! Ontdek hoe je van jouw tuin een duurzame tuin kan maken. 2 Samen bouwen aan meer leven in de tuin. Gewoonweg door een paar stenen in jouw tuin te vervangen door groen.

Nadere informatie

BIOLABO. Voorbereiding in de klas

BIOLABO. Voorbereiding in de klas BIOLABO Voorbereiding in de klas INHOUD 1. Inleiding 2. Biodiversiteit in de schoolomgeving 2.1 materiaal 2.2 verloop 3. Biodiversiteit op aarde 3.1 materiaal 3.2 verloop 3.3 afsluiter 1. Inleiding Biolabo

Nadere informatie

Stichting RAVON R. van Westrienen Postbus 1413 6501 BK NIJMEGEN. Datum 17 november 2014 Betreft Beslissing aanvraag Art. 75 Flora- en faunawet

Stichting RAVON R. van Westrienen Postbus 1413 6501 BK NIJMEGEN. Datum 17 november 2014 Betreft Beslissing aanvraag Art. 75 Flora- en faunawet > Retouradres Postbus 19530 2500 CM Den Haag Stichting RAVON R. van Westrienen Postbus 1413 6501 BK NIJMEGEN Postbus 19530 2500 CM Den Haag mijn.rvo.nl T 088 042 42 42 F 070 378 61 39 ffwet@rvo.nl Betreft

Nadere informatie

Museums en CITES in Nederland

Museums en CITES in Nederland www.cites.org 1 Museums en CITES in Nederland Convention on International Trade in Endangered Species of Wild Fauna and Flora Copyright NL CITES SA CC08/218 Overeenkomst inzake de Internationale Handel

Nadere informatie

Fossiele knaagdieren uit Zuidoost Europa Servië en Bosnië & Herzegovina

Fossiele knaagdieren uit Zuidoost Europa Servië en Bosnië & Herzegovina NGV 20-09-2014 Nederlandse Geologische Vereniging (NGV) Thema: fossiele vertebraten Fossiele knaagdieren uit Zuidoost Europa Servië en Bosnië & Herzegovina Wilma Wessels Departement Aardwetenschappen Universiteit

Nadere informatie

Activiteiten o.l.v. Gidsen van Gidsenbureau vanuit het vakantiehuis A l'abri in Brisy

Activiteiten o.l.v. Gidsen van Gidsenbureau vanuit het vakantiehuis A l'abri in Brisy Activiteiten o.l.v. Gidsen van Gidsenbureau vanuit het vakantiehuis A l'abri in Brisy 1 Inhoudstafel I. Fauna II. Habitats III. Wildcraft & Oriëntatie IV. Kunstenaarshoek V. Outdoor Bijlage I: Activiteiten

Nadere informatie

KATIE SCOTT JENNY BROOM. Het dierenboek. Een fascinerende reis door het dierenrijk

KATIE SCOTT JENNY BROOM. Het dierenboek. Een fascinerende reis door het dierenrijk KATIE SCOTT en JENNY BROOM Het dierenboek Een fascinerende reis door het dierenrijk HET DIERENBOEK Voorwoord De aarde is de enige planeet waarvan we zeker weten dat er leven op bestaat. De levende wezens

Nadere informatie

Molecular Pathology for Pathologists. Pr P. Pauwels

Molecular Pathology for Pathologists. Pr P. Pauwels Molecular Pathology for Pathologists Pr P. Pauwels NGS moleculair pathologie rapport ontcijferen Nomenclatuur waarin gerapporteerd wordt: EGFR c.2573t>g, p.(leu858arg) Coderende sequentie Eiwit/proteïne

Nadere informatie

Ebola een harde wake-up call

Ebola een harde wake-up call VHF national reference laboratory VHF WHO collaborating centre Ebola een harde wake-up call Paraatheid van internationale laboratoria Chantal Reusken Viroscience ErasmusMC Paraatheid van internationale

Nadere informatie

edna DR. AURORA GEERTS CHRISTINE VAN DER HEYDEN PIETER BOETS PETER GOETHALS

edna DR. AURORA GEERTS CHRISTINE VAN DER HEYDEN PIETER BOETS PETER GOETHALS edna BIODIVERSITEIT MONITORING NU EN IN DE TOEKOMST DR. AURORA GEERTS CHRISTINE VAN DER HEYDEN PIETER BOETS PETER GOETHALS edna = DNA in omgeving edna = DNA in omgeving Biotisch Abiotisch ph Zuurstofverbruik

Nadere informatie

Meerjarenplan stichting EIS Nederland 2011 2016

Meerjarenplan stichting EIS Nederland 2011 2016 Meerjarenplan stichting EIS Nederland 2011 2016 Samenvatting Uitbreiding aantal actieve werkgroepen tot 60. Verdere professionalisering van het bureau. Betere profilering van de organisatie. Verdere groei

Nadere informatie

ZA4735. Flash Eurobarometer 219 (Biodiversity) Country Specific Questionnaire Belgium (Flemish)

ZA4735. Flash Eurobarometer 219 (Biodiversity) Country Specific Questionnaire Belgium (Flemish) ZA4735 Flash Eurobarometer 219 (Biodiversity) Country Specific Questionnaire Belgium (Flemish) Flash Eurobarometer on biodiversity Flash 219 questionnaire Q1. Kent u de term biodiversiteit? [SLECHTS ÉÉN

Nadere informatie

Branching out: The Role of Host Plants in the Diversification of Leaf-Mining Moths C. Doorenweerd

Branching out: The Role of Host Plants in the Diversification of Leaf-Mining Moths C. Doorenweerd Branching out: The Role of Host Plants in the Diversification of Leaf-Mining Moths C. Doorenweerd Chapter 8 Samenvatting In dit proefschrift heb ik de rol van waardplanten bij de diversificatie van twee

Nadere informatie

PVH Symposium 2011. Dieren houden en behouden. Samenwerken aan behoud, het moet! van Agenderen naar Doen!! Ferdinand van Merriënboer

PVH Symposium 2011. Dieren houden en behouden. Samenwerken aan behoud, het moet! van Agenderen naar Doen!! Ferdinand van Merriënboer PVH Symposium 2011 Dieren houden en behouden. Samenwerken aan behoud, het moet! van Agenderen naar Doen!! Ferdinand van Merriënboer Inleiding Dieren houden en behouden Samenwerken aan behoud, het moet!

Nadere informatie

Rol van automatisering bij DNA-onderzoek ter identificatie van slachtoffers van de MH17 ramp. Sander Kneppers Hoofd DNA Profileringslaboratorium

Rol van automatisering bij DNA-onderzoek ter identificatie van slachtoffers van de MH17 ramp. Sander Kneppers Hoofd DNA Profileringslaboratorium Rol van automatisering bij DNA-onderzoek ter identificatie van slachtoffers van de MH17 ramp Sander Kneppers Hoofd DNA Profileringslaboratorium 20 31 februari maart 2015 2014 MH17 Nationaliteit slachtoffers

Nadere informatie

Honden en Katten als Stille Getuigen. Daniëlle Hoogmoed, MSc.

Honden en Katten als Stille Getuigen. Daniëlle Hoogmoed, MSc. Honden en Katten als Stille Getuigen Daniëlle Hoogmoed, MSc. State of Washington versus Kenneth Leuluaialii and George Tuilefano, 1996 Een echtpaar en hun hond dood aangetroffen in de woning. De politie

Nadere informatie

Algemene voorwaarden voor de levering van reproducties van collectie-items van het KMMA Tervuren

Algemene voorwaarden voor de levering van reproducties van collectie-items van het KMMA Tervuren Algemene voorwaarden voor de levering van reproducties van collectie-items van het KMMA Tervuren Koninklijk Museum voor Midden-Afrika Departement Culturele Antropologie en Geschiedenis Afdeling Collectie-

Nadere informatie

Bijlage 3: Natuurtoets Westhavendijk (KuiperCompagnons)

Bijlage 3: Natuurtoets Westhavendijk (KuiperCompagnons) Bijlage 3: Natuurtoets Westhavendijk 14-16 (KuiperCompagnons) NATUUR Kader De Flora- en faunawet (hierna: Ffw) beschermt alle in het wild levende zoogdieren, vogels, reptielen en amfibieën. Van deze soortgroepen

Nadere informatie

Soortenbescherming. Buitenevenementen

Soortenbescherming. Buitenevenementen Soortenbescherming en Buitenevenementen Bron www.drloket.nl Flora en faunawet en buitenevenementen Bron www.drloket.nl Pagina 1 Buitenevenementen Wilt u een evenement in de buitenlucht organiseren? Dan

Nadere informatie

Hieronder vindt u een link naar het filmpje over de WMS van Bol.com. https://www.youtube.com/watch?v=mdpt9ws6hhc

Hieronder vindt u een link naar het filmpje over de WMS van Bol.com. https://www.youtube.com/watch?v=mdpt9ws6hhc Hieronder vindt u een link naar het filmpje over de WMS van Bol.com https://www.youtube.com/watch?v=mdpt9ws6hhc je kan het met bol.com De selectie, ontwikkeling en implementatie van een nieuw WMS Harm

Nadere informatie

3 hectare groot veenweide gebied, Amsterdam Westerpark st. Hart voor de Natuur

3 hectare groot veenweide gebied, Amsterdam Westerpark st. Hart voor de Natuur 3 hectare groot veenweide gebied, Amsterdam Westerpark st. Hart voor de Natuur Activiteiten en bereik 2011: Vrije bezoekers: 23.119 NME activiteiten: 1046 Avonturenclubs: 1474 Speciale doelgroepen 20 Openbare

Nadere informatie

Een midden- en bovenbouwproject van het IVN Veldhoven Eindhoven Vessem najaar 2015

Een midden- en bovenbouwproject van het IVN Veldhoven Eindhoven Vessem najaar 2015 Een midden- en bovenbouwproject van het IVN Veldhoven Eindhoven Vessem najaar 2015 Doelgroep: Midden- en bovenbouw basisonderwijs: groep 5-8 Jaargetijde: Herfst, winter, lente en een stukje zomer. Plaats:

Nadere informatie

Een vegetatieopname maken 6 Een flora-inventarisatie uitvoeren 9 Een natuurtoets uitvoeren 11

Een vegetatieopname maken 6 Een flora-inventarisatie uitvoeren 9 Een natuurtoets uitvoeren 11 Inhoudsopgave 2inhoudsopgave A B C G Oriëntatie s Oriënteren op het onderzoeken van flora en fauna 4 Werkwijzer Een vegetatieopname maken 6 Een flora-inventarisatie uitvoeren 9 Een natuurtoets uitvoeren

Nadere informatie

Quickscan FF-wet voor ontwikkelingen aan Wedderstraat 18 te Vlagtwedde.

Quickscan FF-wet voor ontwikkelingen aan Wedderstraat 18 te Vlagtwedde. Quickscan FF-wet voor ontwikkelingen aan Wedderstraat 18 te Vlagtwedde. Quickscan FF-wet voor ontwikkelingen aan Wedderstraat 18 te Vlagtwedde. Status Definitief Datum 7 april 2015 Handtekening Matthijs

Nadere informatie

Masters Onderwerpen 2013. Mark W. DAVEY mark.davey@biw.kuleuven.be Wannes KEULEMANS Wannes.Keulemans@biw.kuleuven.be

Masters Onderwerpen 2013. Mark W. DAVEY mark.davey@biw.kuleuven.be Wannes KEULEMANS Wannes.Keulemans@biw.kuleuven.be Masters Onderwerpen 2013 Mark W. DAVEY mark.davey@biw.kuleuven.be Wannes KEULEMANS Wannes.Keulemans@biw.kuleuven.be website http://www.biw.kuleuven.be/biosyst/plantenbiotechniek/fruitgenetics/lfbb/education

Nadere informatie

INFORMATIEBIJEENKOMST ESFRI ROADMAP 2016 HANS CHANG (KNAW) EN LEO LE DUC (OCW)

INFORMATIEBIJEENKOMST ESFRI ROADMAP 2016 HANS CHANG (KNAW) EN LEO LE DUC (OCW) INFORMATIEBIJEENKOMST ESFRI ROADMAP 2016 HANS CHANG (KNAW) EN LEO LE DUC (OCW) 14 november 2014 2 PROGRAMMA ESFRI Roadmap, wat is het en waar doen we het voor? Roadmap 2016 Verschillen met vorige Schets

Nadere informatie

Activiteiten o.l.v. Gidsen van Gidsenbureau

Activiteiten o.l.v. Gidsen van Gidsenbureau Activiteiten o.l.v. Gidsen van Gidsenbureau vanuit de Jeugherberg van Malmedy 1 Inhoudstafel I. Fauna II. Habitats III. Wildcraft & Oriëntatie IV. Kunstenaarshoek V. Outdoor Bijlage I: Activiteiten / Seizoenen

Nadere informatie

Activiteiten o.l.v. Gidsen van Gidsenbureau

Activiteiten o.l.v. Gidsen van Gidsenbureau Activiteiten o.l.v. Gidsen van Gidsenbureau vanuit MASSEMBRE 1 Inhoudstafel I. Fauna II. Habitats III. Wildcraft & Oriëntatie IV. Kunstenaarshoek V. Outdoor Bijlage I: Activiteiten / Seizoenen Bijlage

Nadere informatie

De accreditatie werd uitgereikt aan/ L'accréditation est délivrée à/ The accreditation is granted to/ Die akkreditierung wurde erteilt für:

De accreditatie werd uitgereikt aan/ L'accréditation est délivrée à/ The accreditation is granted to/ Die akkreditierung wurde erteilt für: Bijlage bij accreditatie-certificaat Annexe au certificat d'accréditation Annex to the accreditation certificate Beilage zur Akkreditatierungszertifikat 482-TEST NBN EN ISO/IEC 17025:2005 Versie/Version/Fassung

Nadere informatie

OBSERVATIES INVENTARISATIE IN BEELD. ATELIER VELDWERK Rudy J. Luijters / Onno Dirker

OBSERVATIES INVENTARISATIE IN BEELD. ATELIER VELDWERK Rudy J. Luijters / Onno Dirker Volume 2 OBSERVATIES INVENTARISATIE IN BEELD ATELIER VELDWERK Rudy J. Luijters / Onno Dirker Januari 2005 VOORWOORD Alle foto s in dit deel zijn in de loop van 2004 gemaakt door Atelier Veldwerk. Het betreft

Nadere informatie

Nationale Plantentuin van België presenteert INQUIRE

Nationale Plantentuin van België presenteert INQUIRE Nationale Plantentuin van België presenteert INQUIRE Wie zijn we? Er groeit iets in Meise Planten centraal, al 200 jaar Kerntaken vandaag Planten Onderzoeken Bewaren 92 ha! Leren kennen Onderzoek Algen,

Nadere informatie

Leydse Weelde. Afsluiting

Leydse Weelde. Afsluiting Leydse Weelde Afsluiting Een tijdje geleden heb je een bezoek gebracht aan Museum Boerhaave. Je hebt kennis gemaakt met Jan (de ontdekkingsreiziger), Carolus (de geleerde) en Marie (de prinses). Wat weet

Nadere informatie

Aantal bezoekers voor de wetenschappelijke collecties in 2004

Aantal bezoekers voor de wetenschappelijke collecties in 2004 4.4 Zoölogisch Museum Amsterdam Missie Zoölogisch Museum Amsterdam De missie van het Zoölogisch Museum (ZMA) is het beschikbaar stellen van wetenschappelijke informatie gebaseerd op de collectie aan gebruikers

Nadere informatie

Als er niets op het preparaat staat merkt u het preparaat aan als onbruikbaar.

Als er niets op het preparaat staat merkt u het preparaat aan als onbruikbaar. FAQ Wat doe ik als er helemaal niets op het preparaat staat? Als er niets op het preparaat staat merkt u het preparaat aan als onbruikbaar. Wat doe ik met informatie waarvoor het formulier geen veld heeft?

Nadere informatie

Digitale opslag Door Jeffrey van der Hoeven

Digitale opslag Door Jeffrey van der Hoeven Digitale opslag Door Jeffrey van der Hoeven Cumulatieve prognoses van Beeld&Geluid, KB, Nationaal Archief en KNAW tezamen. Wat is 1 Petabyte aan data? 1800m 1,5 miljoen CD-ROM s 828m 443m 324m Eiffeltoren

Nadere informatie

De Openbare Bibliotheek en de catalogus

De Openbare Bibliotheek en de catalogus De Openbare Bibliotheek en de catalogus Daniel van Spanje Senior productmanager Metadata Services OCLC Leiden 2 oktober 2012 Bij een open opstelling heb je geen catalogus nodig De boekwinkel Selexyz Dekker

Nadere informatie

Werken met de NDFF. 4 januari Renée Bekker

Werken met de NDFF. 4 januari Renée Bekker Werken met de NDFF 4 januari 2016 Renée Bekker Nationale Databank Flora en Fauna - NDFF centraal beschikbaar maken gegevens over voorkomen soorten in Nederland bundeling gegevensbronnen uniforme validatie

Nadere informatie

30 jaar CITES Sonja Van Tichelen European Regional Director. 3 maart 2014

30 jaar CITES Sonja Van Tichelen European Regional Director. 3 maart 2014 30 jaar CITES Sonja Van Tichelen European Regional Director 3 maart 2014 1. Een woordje over IFAW 2. Belang van CITES voor de bescherming van soorten 3. Laten CITES en de EU de ijsberen in de kou staan?

Nadere informatie

De antwoorden op vragen 1 en 2, 3 en 4, en 5 t/m 8 graag op verschillende vellen schrijven. Vergeet ook niet op de 3 vellen je naam en studentnr.

De antwoorden op vragen 1 en 2, 3 en 4, en 5 t/m 8 graag op verschillende vellen schrijven. Vergeet ook niet op de 3 vellen je naam en studentnr. Tentamen Genoombiologie, 28 Oktober 2009, 9.00-11.45 h De antwoorden op vragen 1 en 2, 3 en 4, en 5 t/m 8 graag op verschillende vellen schrijven. Vergeet ook niet op de 3 vellen je naam en studentnr.

Nadere informatie

Een basisschool project van het IVN Veldhoven / Vessem voorjaar 2012

Een basisschool project van het IVN Veldhoven / Vessem voorjaar 2012 Een basisschool project van het IVN Veldhoven / Vessem voorjaar 2012 Doelgroep: Midden- en Bovenbouw Basisonderwijs: groep 5-8 jaargetijde: Voorjaar, zomer, herfst plaats: Bij school, in een park, in een

Nadere informatie

Hemels of hels? Opendeurdag

Hemels of hels? Opendeurdag Hemels of hels? Opendeurdag Koninklijke Bibliotheek van België Programma Beste bezoeker Van harte welkom op de opendeurdag van de Koninklijke Bibliotheek. Dit jaar staat onze opendeurdag in het teken van

Nadere informatie

NORMEN VOOR EDEPOTS DUURZAME BEWARING IS VOOR EDEPOTS GROEIMODEL NAAR EEN OAIS BLUE BOOK. Archiverings- en raadplegingsformaten

NORMEN VOOR EDEPOTS DUURZAME BEWARING IS VOOR EDEPOTS GROEIMODEL NAAR EEN OAIS BLUE BOOK. Archiverings- en raadplegingsformaten DUURZAME BEWARING IS Organisatiestructuur Resources Opslagsystemen Standaarden Archiverings- en raadplegingsformaten Karakteriseren en valideren Checksums Migreren en normaliseren Preservation metadata

Nadere informatie

Blijde Wei. Lesaanbod

Blijde Wei. Lesaanbod Lesaanbod 2017-2018 Blijde Wei Les groep aug sept okt nov dec jan feb mrt apr mei juni juli Alles voor een pannenkoek 1/2 X X Wauw, het leeft 1/2 X X Beschuit met muisjes 3/4 X X Melk 3/4 X X X Knaagdieren

Nadere informatie

DE HERFST: KLEURRIJK SEIZOEN

DE HERFST: KLEURRIJK SEIZOEN DE HERFST DE HERFST: KLEURRIJK SEIZOEN vanaf 2de graad lager onderwijs. x vak: muzische vorming x duur: halve dag GRIEZELBOS HET KLEINE VIEZE BEESTJES- ONDERZOEK! verloop: x verdeel de klas in verschillende

Nadere informatie

Glashelder nieuwsbrief 4 mei 2014. De afronding van Glashelder! Resultaten. Beste Glashelder!-deelnemers,

Glashelder nieuwsbrief 4 mei 2014. De afronding van Glashelder! Resultaten. Beste Glashelder!-deelnemers, De afronding van Glashelder! Resultaten Beste Glashelder!-deelnemers, Het is alweer enkele maanden geleden dat de honderdduizendste scan van Glashelder! werd ingevoerd en gecontroleerd. De meeste van jullie

Nadere informatie

Inhoud 4 e druk Natuuronderwijs inzichtelijk

Inhoud 4 e druk Natuuronderwijs inzichtelijk Inhoud 4 e druk Natuuronderwijs inzichtelijk Inleiding 1 PLANTEN 1.1 Indeling van het plantenrijk 1.1.1 De groene wereld van de planten 1.1.2 Wieren (algen) 1.1.3 Mossen 1.1.4 Paardenstaarten 1.1.5 Varens

Nadere informatie

memo INLEIDING GEBIEDSBESCHERMING ZAND/ZON/ c.c.: datum: 22 augustus 2013 Achterweg 48, Lisse

memo INLEIDING GEBIEDSBESCHERMING ZAND/ZON/ c.c.: datum: 22 augustus 2013 Achterweg 48, Lisse memo aan: van: OG ZAND/ZON/130372 c.c.: datum: 22 augustus 2013 betreft: Achterweg 48, Lisse INLEIDING Bij alle ruimtelijke ingrepen moet rekening gehouden worden met de aanwezige natuurwaarden in en om

Nadere informatie

Mogelijk voor alle groepen

Mogelijk voor alle groepen IVN VERENIGING VOOR NATUUR EN MILIEUEDUCATIE AFDELING ASTEN/SOMEREN Schoolprojecten Asten Someren Project omschrijving doelgroep Tijd/seizoen Beestjesproject: Beestjes vangen op allerlei manieren (witte

Nadere informatie

De Levende tuin, met een levende omheining. De Levende tuin laat uw tuin leven. Wilt u van uw tuin een groene oase maken?

De Levende tuin, met een levende omheining. De Levende tuin laat uw tuin leven. Wilt u van uw tuin een groene oase maken? FOTO S: TUINEN VAN APPELTERN met een levende omheining De omheining van een levende tuin leeft mee. Deze biedt beschutting, maar is ook toegankelijk voor kleine dieren. Van oude stenen bijvoorbeeld, zijn

Nadere informatie

De SEC eerste ervaringen

De SEC eerste ervaringen De SEC eerste ervaringen Wim Hoekstra Projectleider IT Petra van Krimpen VP / QP / QPPV 7 november 2016 1 Inhoud De SEC op het etiket De SEC in barcode De SEC voor afnemers (tool) Codering door processors

Nadere informatie

Evolutie van het Melkviooltje en verwanten door hybridisatie en polyploïdie

Evolutie van het Melkviooltje en verwanten door hybridisatie en polyploïdie Evolutie van het Melkviooltje en verwanten door hybridisatie en polyploïdie De systematiek is de wetenschap binnen de biologie die zich bezighoudt met inventariseren, identificeren van de verwantschapsrelaties

Nadere informatie

18/09/2013. LIBIS aan zee. Update LIBIS. Informatie aan zee 12 & 13 September 2013

18/09/2013. LIBIS aan zee. Update LIBIS. Informatie aan zee 12 & 13 September 2013 18/09/2013 LIBIS aan zee Update LIBIS Informatie aan zee 12 & 13 September 2013 1 Voor bibliotheken Unified Resource Discovery & Delivery Unified Resource Management Schaalvergroting = kostenverlaging

Nadere informatie

Leren van meetnetten in stedelijke natuur

Leren van meetnetten in stedelijke natuur Symposium Ecologie en de praktijk 2014 ecologica Leren van meetnetten in stedelijke natuur Niels de Zwarte @stadsnatuur 1 Bureau Stadsnatuur? Sinds 1997 Onderdeel Natuurhistorisch Museum Rotterdam Kenniscentrum

Nadere informatie

Proces Mediaverwerking

Proces Mediaverwerking Proces Mediaverwerking Anne Werst, manager Catalogiseren awerst@beeldengeluid.nl Nederlands Instituut voor Beeld en Geluid Cijfers Ruim 750.000 uur radio, televisie, film 1.500.000 catalogusbeschrijvingen

Nadere informatie

Het metagenoom van cariës

Het metagenoom van cariës Het metagenoom van cariës Bij de tandarts wordt vaak tandplak verwijderd. Dat is belangrijk, omdat je anders last kunt krijgen van cariës, oftewel tandbederf. Hierbij wordt het glazuur van je tanden aangetast

Nadere informatie

Biologie in het lab van de toekomst

Biologie in het lab van de toekomst Biologie in het lab van de toekomst Frank Schuren TNO Microbiologie Conventionele microbiologie met state of the art genomics technologie en viability assays Conventional Microbiology Genomics technologies

Nadere informatie

Management Informatie op Maat. als startpunt voor procesverbetering. NVLO Jaarcongres

Management Informatie op Maat. als startpunt voor procesverbetering. NVLO Jaarcongres als startpunt voor procesverbetering. NVLO Jaarcongres - Even voorstellen: Jean Paul van Dorst RC Persoonlijke titel Vragen? Stel ze! De startsituatie 15% meer aanvragen en 12% minder productie dan urenafspraak;

Nadere informatie

Richtlijnen Dierplaagbeheersing laatst bijgewerkt: 14-4-2009

Richtlijnen Dierplaagbeheersing laatst bijgewerkt: 14-4-2009 Kip (Gallus gallus domesticus) Ontwikkelingssnelheid Afhankelijk van menselijk voeren Afhankelijk van zwerfvuil Risico om ziek te worden Schadelijk gedrag Samenvattend werkprotocol voor beheerder Bij Kippenoverlast

Nadere informatie

DinoLab LIVE Lesbrief websessie

DinoLab LIVE Lesbrief websessie DinoLab LIVE Lesbrief websessie Een kijkje achter de schermen van museum Naturalis voor groep 6, 7 en 8 1 DinoLab LIVE lesbrief DinoLab LIVE 1 Introductieles 2 Beschrijving websessie 3 Afsluiting 4 Bijlage:

Nadere informatie

Notitie quickscan flora en fauna Wilgenweg 10, Groot- Ammers

Notitie quickscan flora en fauna Wilgenweg 10, Groot- Ammers Notitie quickscan flora en fauna Wilgenweg 10, Groot- Ammers Aan: S. Baardwijk (Sjaak Baardwijk Hoveniersbedrijf ) Van: Kopie: L. Boon (Ecoresult) B. Verhoeven (Ecoresult) Datum: 15 oktober 2014 Versie:

Nadere informatie

QUICK SCAN FLORA EN FAUNA. Heilleweg 21 te Sluis

QUICK SCAN FLORA EN FAUNA. Heilleweg 21 te Sluis QUICK SCAN FLORA EN FAUNA Heilleweg 21 te Sluis 1 QUICK SCAN FLORA EN FAUNA Heilleweg 21 te Sluis Opdrachtgever: A.C. Dingemans Heilleweg 21 4524 KL Sluis Opgesteld door: ZLTO Advies Cereshof 4 4463 XH

Nadere informatie

OPEN CULTUUR DATA Een bottom-up initiatief vanuit de erfgoedsector"

OPEN CULTUUR DATA Een bottom-up initiatief vanuit de erfgoedsector OPEN CULTUUR DATA Een bottom-up initiatief vanuit de erfgoedsector" Lotte Belice Baltussen, Nederlands Instituut voor Beeld en Geluid @lottebelice Lottebelice Wikimedia Conferentie Nederland Utrecht, 12

Nadere informatie

(Zorg)logistiek in het DZ

(Zorg)logistiek in het DZ (Zorg)logistiek in het DZ Intro Presentatie -> het waarom. Rondleiding -> het hoe. NB: Het gebruik van barcodes ed is altijd een middel en nooit een doel op zich. Even voorstellen Bart Gietema Hoofdchirurgie

Nadere informatie

Groene apps en natuurbeleving. Tablets en smartphones, een meerwaarde in de natuur?

Groene apps en natuurbeleving. Tablets en smartphones, een meerwaarde in de natuur? Groene apps en natuurbeleving Tablets en smartphones, een meerwaarde in de natuur? Programma In mensentaal Basishandelingen Demo apps Social media QR vs layar Andere toepassingen Alle begin is moeilijk

Nadere informatie

Diversiteit en eigenschappen van Legionella-bacteriën

Diversiteit en eigenschappen van Legionella-bacteriën Diversiteit en eigenschappen van Legionella-bacteriën Dick van der Kooij ISSO Congres, Nijkerk, 27 november 2014 Inhoud Inleiding Ontdekking van Legionella Incidentie van Legionnaires Disease (LD)/veteranenziekte

Nadere informatie

Next Generation Sequencing: meer met minder

Next Generation Sequencing: meer met minder Next Generation Sequencing: meer met minder Robert van der Geize Klinisch Moleculair Bioloog in de Pathologie (KMBP) Xs2HiTek-workshop 'Diagnostiek in de Pathologie' 2015 www.labpon.nl Boerhaavelaan 59

Nadere informatie

Biodiversiteit in Vlaanderen: de cijfers

Biodiversiteit in Vlaanderen: de cijfers Biodiversiteit in Vlaanderen: de cijfers Myriam Dumortier Natuurrapport www.natuurindicatoren.be www.nara.be www.inbo.be Haalt Vlaanderen de 2010-doelstelling? Biodiversiteit Verstoringen/bedreigingen

Nadere informatie

Dossier T. rex voor Naturalis. Darwinweg 2 Postbus 9517 2300 RA Leiden. T 071 751 96 00 F 071 751 96 66 www.naturalis.nl

Dossier T. rex voor Naturalis. Darwinweg 2 Postbus 9517 2300 RA Leiden. T 071 751 96 00 F 071 751 96 66 www.naturalis.nl Dossier T. rex voor Naturalis Darwinweg 2 Postbus 9517 2300 RA Leiden T 071 751 96 00 F 071 751 96 66 www.naturalis.nl Inhoud 1. De opgraving 5 2. Facts & figures 7 Het skelet 7 Tientje voor T. rex 7

Nadere informatie

voor audiovisueel erfgoed

voor audiovisueel erfgoed Onderzoeksrapport Beeld en Geluid: Mobiel platform voor audiovisueel erfgoed Uitgave: 14-10-2012, versie 1.1 Door JBLT ; Jonathan Marchal, Bas van Agten, Laurens Carbo, Thijs Blaas Voorwoord Om een goed

Nadere informatie

Workshop Low Cost High Value Service Delivery Models

Workshop Low Cost High Value Service Delivery Models Workshop Low Cost High Value Service Delivery Models 9 februari 2012 2011 - All rights reserved Noventum Service Management Consultants Ltd. 1 Low Cost High Value Service Delivery Models Low cost delivery

Nadere informatie

Beest binnenste buiten

Beest binnenste buiten Beest binnenste buiten Lesbrief websessie Een kijkje achter de schermen van museum Naturalis voor klas 1 en 2 (VMBO/H/V) lesbrief Beest binnenste buiten 1 Introductieles 2 Beschrijving websessie 3 Afsluiting

Nadere informatie

Van Boktor naar barcode:

Van Boktor naar barcode: Van Boktor naar barcode: hoe een combinatie van morfologische en moleculaire kenmerken onze kennis van plagen kan versterken Antoon Loomans en Roel Potting Divisie Plant, nieuwe Voedsel en Waren Autoriteit,

Nadere informatie

Bureaustudie natuurwaarden Nijverheidstraat te Nederhemert

Bureaustudie natuurwaarden Nijverheidstraat te Nederhemert Bureaustudie natuurwaarden Nijverheidstraat te Nederhemert Datum : 30 oktober 2014 Opdrachtgever : Pouderoyen BV Opgesteld door : ir. N. Arts Projectnummer : P14-0202 Inleiding Initiatiefnemer is voornemens

Nadere informatie

Standaarden in het (digitaal) beschrijven van vormgevingsarchieven Bernadine Ypma, zelfstandig onderzoeker

Standaarden in het (digitaal) beschrijven van vormgevingsarchieven Bernadine Ypma, zelfstandig onderzoeker Standaarden in het (digitaal) beschrijven van vormgevingsarchieven Bernadine Ypma, zelfstandig onderzoeker Deze samenvatting geeft de resultaten van een onderzoek naar ontsluitingsmethoden van vormgevingsarchieven

Nadere informatie

Bloemen en hun bezoekers geneeskrachtige planten en smaakmakers

Bloemen en hun bezoekers geneeskrachtige planten en smaakmakers Bloemen en hun bezoekers geneeskrachtige planten en smaakmakers veldwerk - bovenbouw Inhoudsopgave Korte omschrijving... 1 Organisatie... 3 Het leerlingenwerkboekje... 3 Lessuggesties ter voorbereiding

Nadere informatie