2 e SMT Workshop Moleculaire Typeringen spa typering en MLST

Save this PDF as:

Maat: px
Weergave met pagina beginnen:

Download "2 e SMT Workshop Moleculaire Typeringen spa typering en MLST"


1 2 e SMT Workshop Moleculaire Typeringen spa typering en MLST Januari, 2013 UMC Utrecht en RIVM Leo M Schouls Laboratorium voor Infectieziekten en Screening (LIS) Centrum voor Infectieziektebestrijding (CIb) Rijksinstituut voor Volksgezondheid en Milieu (RIVM) Moleculaire typeringen Eerste generatie methoden: Analyse van op gels gescheiden DNA fragmenten Belangrijkste nadelen: Methoden hebben weinig portabiliteit Kleine variaties hebben vaak grote gevolgen Data niet eenvoudig uitwisselbaar Uitwisseling en normalisatie van grafische files (gel images) Sequentie gebaseerde methode veel beter 2 1

2 Sequentie gebaseerde moleculaire typeringen Single locus sequence typing Bacterieel gen bijv. spa typering Viraal gen bijv. hepatitis B virus ( Multi locus sequence typing Meerdere virale genen bijv. MLST Meerdere virale genen bijv. van hepatitis C virus Meestal betreft dit het sequencen van delen van de genen Veel beter zou zijn gebruik van complete genoomsequentie 3 Spa Typering, karakterisering Staphylococcus aureus S. aureus was één van de eerste bacterie species waarin resistentie tegen penicilline gevonden werd Reeds in 1947, 4 jaar na de start van penicilline productie Daarna werd meticilline gebruikt, een sythetische variant van penicilline Reeds in 1961, 2 jaar na de introductie van meticilline, werden de eerste Methicillin Resistant Staphylococcus aureus = MRSA gevonden (UK) 4 2

3 MRSA bestrijding in Nederland: Search & Destroy Search Bij ziekenhuisopname, navraag of patiënt in risicocategorie valt Zo ja, dan MRSA kweek van patiënt en contacten Destroy Isolatie van patiënt Bij kolonisatie behandeling met neuszalf en chloorhexidine zeep Bij infectie antibioticum behandeling (vancomycine) 5 Waarom typering van MRSA Vragen zijn: Vindt er MRSA transmissie tussen patiënten of tussen patiënten en personeel plaats in een zorginstelling? Is er sprake van overdracht tussen zorginstellingen? Wat zijn de trends in verspreiding en is er sprake van import van bepaalde MRSA stammen vanuit andere landen? Om deze vragen te beantwoorden typeren we de MRSA stammen 6 3

4 Hoe typeer je S. aureus (en MRSA)? Vroeger : Faagtypering (1952) Serologische typering (1962) Nu: moleculaire typering Pulsed field gel electroforese (PFGE) Multi locus sequence typing (MLST) Spa sequence typing Multiple locus variable number of tandem repeat analysis (MLVA) 7 Proteine A Het eiwit proteine A (SpaA) is een 56 kda groot microbial surface components recognizing adhesive matrix molecule (MSCRAMM) in S. aureus Proteine A wordt gezien als een belangrijke virulentiefactor Stammen zonder proteine A zijn minder virulent Proteine A zit vast aan het oppervlak van de S. aureus en bindt immuunglobulines Binding is in verkeerde orientatie waardoor opsonisatie en fagocytose gestoord worden 8 4

5 Het spa gen Proteine A wordt gecodeerd door het spa gen the spa gene S E D A B C CWAS repeats S = signaalsequentie Repeats E t/m C = coderen voor Ig bindende domeinen (160 bp) Regio met 24 bp lange repeats CWAS = Cell wall associated sequence 9 Spa typering Het aantal repeats in het spa gen is variabel S E D A B C CWAS S E D A B C CWAS S E D A B C CWAS Eigenschap wordt benut voor stamtypering 10 5

6 Variatie in repeat regio van het spa gen PCR met flankerende primers S E D A B C CWAS spa gen PCR product Interne marker (16S rrna PCR) 11 Mechanismen die variatie in het aantal repeats veroorzaken: Normale replicatie Actie van DNA polymerase tijdens replicatie Perfecte kopie van template 12 6

7 Mechanismen die variatie in het aantal repeats veroorzaken: Backward replication slippage Incorrecte replicatie, aantal kopieën neemt toe 13 Mechanismen die variatie in het aantal repeats veroorzaken: Forward replication slippage Incorrecte replicatie, aantal kopieën neemt af 14 7

8 Spa typering Number of repeats based on PCR product size Typing based sequence of PCR product Development of currently used Spa Typing technique Ridom 15 Repeatvariatie in spa gen: aantal en sequentie cattacagaggaagacaacaacaagcctagcgaggaagacaacaacaagcctagcgaggaagacaacaacaagcctagcttattgct cattacagaggaagacaacaacaagcctagcgaggaagacaacaacaagcctagc ttattgct cattacagaggaagacaacaacaagcctagcaaagaagacaacaaaaagcctggcgaggaagacaataacaaacctggtttattgct cattacagaggaagacaacaacaagcctagc Spa Profielen: GAGGAAGACAATAACAAACCTGGTttattgct Elk Spa Profiel vertgenwoordigt een Spa Type t001: t026:

9 Nomenclatuur standaardiseren Ridom Repeatsequenties Spa Typen met bijbehorende Spa Profielen 17 Spa typering is gebaseerd op samenstelling van de repeat regio S E D A B C CWAS Spa typering methode: Voer PCR uit Sequence het PCR product Identificeer de repeats Vergelijk de repeatsequenties met tabel en geef bijbehorende repeat ID Vergelijk het onstane profiel van repeat ID s met tabel en geef typenummer 18 9

10 Spa typering Voordelen Techniek eenvoudig en betaalbaar: PCR en sequencing Resultaten robuust en eenduidig Grote internet toegankelijke database met standaard nomenclatuur Wereldwijd gebruikt Nadelen Slechts 1 locus: wat betekent één enkele mutatie? Clustering is lastig verwantschapsbomen moeilijk te maken 19 Deel II: MLST Multi Locus Sequence Typing = MLST Karakterisering door sequencing van meerdere gen segmenten 20 10

11 MLST is ontstaan uit de MLEE Multilocus enzyme electrophoresis (MLEE): variatie in enzymen Multi Locus Sequence Typing (MLST): variatie in de genen die coderen voor de enzymen 21 Multilocus enzyme electrophoresis (MLEE) Relative electrophoretische mobiliteit van cellulaire enzymen Mannitol 1 phosphate dehydrogenase in E. coli Glucose 6 phosphate dehydrogenase in N. meningitidis Malate dehydrogenase in E. coli 22 11

12 MLEE bepaalt Zymovars MLEE wordt nog steeds gebruikt 23 MLST het principe Kies een aantal genen (meestal 7) van het bacterie species die altijd aanwezig zijn relatief weinig variëren huishoud genen Voer PCR uit op deze genen (ca. 500 bp) Sequence deze PCR producten Vergelijk de gensequenties met die in tabellen (allelen) Geef allelnummer als de sequentie gelijk is aan die in de tabel Als de sequentie niet gelijk is aan die in de tabel niet geef de variant dan een nieuw allelnummer (volgnummer) 24 12

13 MLST het principe Resultaat is een soort telefoonnummer van allelen Genen: arcc aroe glpf gmk pta tpi yqil Allelnummers: Verkorte schrijfwijze van allelprofiel is het Sequence Type: ST5 Let op! Een enkele mutatie geeft al een ander allel Het allelnummer zegt niets over de verwantschap Allel 1 verschilt mogelijk 50 bp van allel 2 en 1 bp van allel Verwerking van MLST data MLST data kunnen op 2 manieren gebruikt worden voor clustering Op basis van de MLST profielen Op basis van de aan elkaar geknoopte sequenties (concateneren) Hierover meer in de presentatie van Bruno Pot 26 13

14 MLST, een veelgebruikte techniek Er is een grote verzameling van MLST databases beschikbaar via internet: en 27 MLST voor en nadelen Voordelen Zeer robuust en betrouwbaar Data zijn makkelijk uitwisselbaar en geschikt voor internettoegankelijke databases Vooral geschikt voor analyses op populatieniveau Nadelen Arbeidsintensief Duur Er zijn per stam 7 PCR s nodig en 14 sequence reacties Vooral geschikt voor analyses op populatieniveau 28 14

15 Spa typering tijdens cursus Vandaag: PCR uitvoeren 3 MRSA isolaten per groepje Morgen: Sequencing door BaseClear Overmorgen verwerking data in BioNumerics Resultaten sequencing importeren en editten Spa Profielen en Spa Typen bepalen in Bionumerics Vergelijk met andere profielen in de database 29 Practicals Inzetten van de PCR 30 15

16 MLST tijdens cursus Geen praktische uitvoering 31 16

Stamtyperingen Dr. Thierry De Baere

Stamtyperingen Dr. Thierry De Baere H.-Hartziekenhuis Roeselare - Menen vzw Wilgenstraat 2-8800 Roeselare Stamtyperingen Dr. Thierry De Baere Bacteriële stam-typering : wat? = opsporen van verschillen op stam-niveau tussen verschillende

Nadere informatie

Chapter 9. Nederlandse samenvatting

Chapter 9. Nederlandse samenvatting Chapter 9 Nederlandse samenvatting Nederlandse samenvatting Nederlandse samenvatting Geschat wordt dat ongeveer 20-30% van de bevolking drager is van Staphylococcus aureus (S. aureus), een Gram-positief

Nadere informatie

MRSA staat voor Methicilline (M) resistente (R) Staphylococcus (S) aureus (A).

MRSA staat voor Methicilline (M) resistente (R) Staphylococcus (S) aureus (A). MRSA MRSA staat voor Methicilline (M) resistente (R) Staphylococcus (S) aureus (A). Stafylokokken zijn bacteriën die ongemerkt leven bij vele mensen, bij voorkeur in de neus of op de huid. Deze bacteriën

Nadere informatie

PATIËNTEN INFORMATIE MRSA. Meticilline Resistente Staphylococcus aureus. Informatie voor dragers MRSA

PATIËNTEN INFORMATIE MRSA. Meticilline Resistente Staphylococcus aureus. Informatie voor dragers MRSA PATIËNTEN INFORMATIE MRSA Meticilline Resistente Staphylococcus aureus Informatie voor dragers MRSA 2 PATIËNTENINFORMATIE U bent, of uw naaste is, drager van een voor antibiotica ongevoelige bacterie,

Nadere informatie

MRSA. Rini Eringfeld Specialist ouderengeneeskunde De Zorgboog

MRSA. Rini Eringfeld Specialist ouderengeneeskunde De Zorgboog MRSA Rini Eringfeld Specialist ouderengeneeskunde De Zorgboog MRSA in het verpleeghuis Op 1-8-2008 wordt bij een medewerker werkzaam op de dubbelzorgafdeling de Wich op St. Jozefsheil te Bakel een MRSA

Nadere informatie

1 (~20 minuten; 20 punten)

1 (~20 minuten; 20 punten) TENTAMEN Moleculaire Cel Biologie (8A840) Prof. Dr. Ir. L. Brunsveld & Dr. M. Merkx 27-01-2012 14:00 17:00 (totaal 100 punten) 6 opgaven in totaal + 1 bonusvraag! (aangegeven tijd is indicatie) Gebruik

Nadere informatie

9 e Post-O.N.S. Meeting

9 e Post-O.N.S. Meeting 9 e Post-O.N.S. Meeting Neutropenie & Antibiotica resistentie Heleen Klein Wolterink Research verpleegkundige Medische Oncologie UMC Utrecht Schiphol introductie Neutropenie: Definitie Symptomen MASSC

Nadere informatie

Informatiefolder BRMO voor patiënt en familie

Informatiefolder BRMO voor patiënt en familie Informatiefolder BRMO voor patiënt en familie BIJZONDER RESISTENTE MICRO-ORGANISMEN, WAT ZIJN DIT? Bij u is aangetoond dat u een Bijzonder Resistent Micro-organisme heeft. In deze folder leest u algemene

Nadere informatie

Eindresultaten project Genotypering van salmonellastammen bij pluimvee met MLVA en PFGE

Eindresultaten project Genotypering van salmonellastammen bij pluimvee met MLVA en PFGE Eindresultaten project Genotypering van salmonellastammen bij pluimvee met MLVA en PFGE Auteur: dierenarts Eva Pierré, DGZ Vlaanderen, met dank aan Dr. Ir. Cécile Boland, CODA. Inhoud 1. Inleiding... 2

Nadere informatie

adviezen na een MRSA informatiefolder voor hernia-operatie patiënt en bezoeker van ZorgSaam Ziekenhuis ZorgSaam

adviezen na een MRSA informatiefolder voor hernia-operatie patiënt en bezoeker van ZorgSaam Ziekenhuis ZorgSaam MRSA adviezen na een informatiefolder voor hernia-operatie patiënt en bezoeker van ZorgSaam Ziekenhuis ZorgSaam 1 Wat is MRSA en wat zijn de gevolgen voor u, uw familie, voor medewerkers en andere patiënten?

Nadere informatie

Antibiotica resistentie en ons water

Antibiotica resistentie en ons water en ons water Sanne van den Hengel 4 december 204 combining scientific excellence with commercial relevance Tot 65% van de bacteriën in Nederlandse rivieren zijn multiresistent. en ons water en ons water

Nadere informatie

Bijlage 1. Bron- en contactonderzoek bij clusters van MRSA-infectie

Bijlage 1. Bron- en contactonderzoek bij clusters van MRSA-infectie Staphylococcus aureus-infecties, inclusief MRSA A41 Bijlage 1. Bron- en contactonderzoek bij clusters van MRSA-infectie Achtergronden Het in Nederland gevoerde strikte screenings- en isolatiebeleid ( search-and-destroy

Nadere informatie

Klassificatie. Identificatie. Typering

Klassificatie. Identificatie. Typering Introductie van typeringsmethoden Klassificatie Identificatie Typering cursus Breda 2008 1 3 Domeinen cursus Breda 2008 2 Taxonomie Domein, Familie, Genus, Species, Subspecies, Stam Klassificatie identificatie

Nadere informatie

Detectie en gevoeligheidsbepalingen van MRSA CC398

Detectie en gevoeligheidsbepalingen van MRSA CC398 Samenvatting en discussie Sinds enkele decennia wordt methicilline-resistentie bij S. aureus gezien als een menselijk probleem. Vroeger was het beperkt tot de zorgsector, maar later werd het ook een probleem

Nadere informatie

Staphylococcus aureus (MRSA)

Staphylococcus aureus (MRSA) Het referentielaboratorium voor stafylokokken - MRSA (Erasmus Ziekenhuis Brussel) verleent de volgende diensten : - Identificatie en antibiogram van atypische stafylokokkenstammen met behulp van de volgende

Nadere informatie

De strijd tegen nosocomiale infecties, een multidisciplinaire aanpak

De strijd tegen nosocomiale infecties, een multidisciplinaire aanpak De strijd tegen nosocomiale infecties, een multidisciplinaire aanpak Els Van Mechelen 19 december 2013 Micro organismen Overzicht Inleiding Biomoleculen Virussen : Bouw en vermenigvuldiging Bacteriën :

Nadere informatie

Epidemiologie van Clostridium difficile infecties in België. Rapport 2016 Samenvatting

Epidemiologie van Clostridium difficile infecties in België. Rapport 2016 Samenvatting Epidemiologie van Clostridium difficile infecties in België Rapport 2016 Samenvatting AUTEURS C. VALENCIA, M.-L. LAMBERT Voor het Nationale Referentielaboratorium: M. DELMÉE, J. VAN BROECK Epidemiologie

Nadere informatie

Afdeling hygiëne en infectiepreventie MRSA-bacterie? Voorkomen is beter

Afdeling hygiëne en infectiepreventie MRSA-bacterie? Voorkomen is beter Afdeling hygiëne en infectiepreventie MRSA-bacterie? Voorkomen is beter Bent u de afgelopen 2 maanden in een buitenlands ziekenhuis opgenomen of behandeld geweest? Hebt u beroepsmatig contact met varkens

Nadere informatie

Controle op Bijzonder Resistente Micro- Organismen

Controle op Bijzonder Resistente Micro- Organismen Controle op Bijzonder Resistente Micro- Organismen BRMO In deze folder staat algemene informatie over bijzonder resistente micro-organismen (bacteriën). En waarom en hoe u hierop wordt gecontroleerd. Deze

Nadere informatie

HLA typeren en HLA antistoffen t.b.v. trombocytentransfusies

HLA typeren en HLA antistoffen t.b.v. trombocytentransfusies HLA typeren en HLA antistoffen t.b.v. trombocytentransfusies Christien Voorter Transplantatie-Immunologie, Laboratorium Weefseltypering c,.voorter@mumc.nl 2 HLA Humaan Leucocyt Antigeen Eiwitten op oppervlakte

Nadere informatie

Implementatie LIMS binnen afdeling Genetica van het Radboudumc. Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 27 03 2014

Implementatie LIMS binnen afdeling Genetica van het Radboudumc. Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 27 03 2014 Implementatie LIMS binnen afdeling Genetica van het Radboudumc Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 27 03 2014 Inleiding Wie? Wat? Hoe? Historie LIMS Implementatie Labvantage Toekomst plannen

Nadere informatie

MRSA positief: wat betekent dat?

MRSA positief: wat betekent dat? Wilhelmina Kinderziekenhuis MRSA positief: wat betekent dat? Wat staat er in deze folder Inleiding voor ouders 2 MRSA positief 3 Wil je meer weten? 12 Onder ouders verstaan wij ook verzorgers en pleegouders.

Nadere informatie


ANTWOORDEN HOOFDSTUK 6 VAN GEN TOT EIWIT ANTWOORDEN HOOFDSTUK 6 VAN GEN TOT EIWIT ANTWOORDEN 6.5 /TM 6.8 Codering 1.een juiste aanvulling van het schema : nucleotiden in mrna juist nucleotiden in DNA juist 3 kant en 5 kant bij mrna en DNA juist

Nadere informatie

Casus: Patient met Bacteriëmie

Casus: Patient met Bacteriëmie Casus: Patient met Bacteriëmie Judith Lie, hemovigilantiefunctionaris Kennisplatform transfusiegeneeskunde ZO, 26-11-2015, Veldhoven Kennisplatform ZO, 26-11-2015 2 Patiënt Bloed Bacterie - Bron Kennisplatform

Nadere informatie

HERKANSINGSTENTAMEN Moleculaire Biologie deel 2, 5 Jan 2007

HERKANSINGSTENTAMEN Moleculaire Biologie deel 2, 5 Jan 2007 HERKANSINGSTENTAMEN Moleculaire Biologie deel 2, 5 Jan 2007 NAAM: STUDENTNUMMER: CONTROLEER OF DIT TENTAMEN 14 PAGINA S BEVAT. Veel succes! o Je mag de achterkant van het papier ook zo nodig gebruiken,

Nadere informatie

Moleculaire diagnostiek

Moleculaire diagnostiek Moleculaire diagnostiek van infectieziekten Arjan de Jong 8 december 2015 Moleculaire diagnostiek Diagnostiek op basis van moleculair biologische (DNA/RNA) technieken Moleculaire diagnostiek van infecties

Nadere informatie

Staphyloccus aureus: een echte pathogeen. Verschil tussen Gram+ en Gram. Stafylokokken. Stafylokokken een belangrijke commensaal van de huid

Staphyloccus aureus: een echte pathogeen. Verschil tussen Gram+ en Gram. Stafylokokken. Stafylokokken een belangrijke commensaal van de huid Staphylococcus aureus. De gouden stafylokok Goudgele kolonies op een bloedagarplaat Staphyloccus aureus: een echte pathogeen Regionaal Transfusie Platform 2015 Dr. J.H. Marcelis, arts-microbioloog Gram

Nadere informatie

MRSA-bacterie. 'ziekenhuisbacterie' Afdeling Medische Microbiologie en Infectiepreventie

MRSA-bacterie. 'ziekenhuisbacterie' Afdeling Medische Microbiologie en Infectiepreventie 00 MRSA-bacterie 'ziekenhuisbacterie' Afdeling Medische Microbiologie en Infectiepreventie 1 Inleiding MRSA staat voor Meticilline-resistente Staphylococcus aureus. De Staphylococcus aureus is een bacterie

Nadere informatie

Cover Page. The handle holds various files of this Leiden University dissertation.

Cover Page. The handle  holds various files of this Leiden University dissertation. Cover Page The handle http://hdl.handle.net/1887/29641 holds various files of this Leiden University dissertation. Author: Bakker, Dennis Title: Molecular characterization of pathogenic Clostridium difficile

Nadere informatie

1. Welk van de onderstaande DNA sequenties zijn mogelijke herkenning-sites voor restrictie-enzymen? c 5' GAATTC 3' c 5' GGGGCCCC 3' c 5' CTGCAG 3' 5'

1. Welk van de onderstaande DNA sequenties zijn mogelijke herkenning-sites voor restrictie-enzymen? c 5' GAATTC 3' c 5' GGGGCCCC 3' c 5' CTGCAG 3' 5' proefexamen 1. Welk van de onderstaande DNA sequenties zijn mogelijke herkenning-sites voor restrictie-enzymen? c 5' GAATTC 3' c 5' GGGGCCCC 3' c 5' CTGCAG 3' 5' CTAAATC 3' 5' GGAACC 3' Restriction Endonucleases

Nadere informatie

MRSA positief: wat betekent dat?

MRSA positief: wat betekent dat? MRSA positief: wat betekent dat? Onder ouders verstaan wij ook verzorger(s), pleeg- of adoptieouder(s) U kunt wijzigingen of aanvullingen op deze informatie door geven per e-mail: patienteninformatiewkz@umcutrecht.nl

Nadere informatie

Molecular Pathology for Pathologists. Pr P. Pauwels

Molecular Pathology for Pathologists. Pr P. Pauwels Molecular Pathology for Pathologists Pr P. Pauwels NGS moleculair pathologie rapport ontcijferen Nomenclatuur waarin gerapporteerd wordt: EGFR c.2573t>g, p.(leu858arg) Coderende sequentie Eiwit/proteïne

Nadere informatie

Screening BRMO na opname in een buitenlands ziekenhuis

Screening BRMO na opname in een buitenlands ziekenhuis Infectiepreventie Screening BRMO na opname in een buitenlands ziekenhuis www.catharinaziekenhuis.nl Patiëntenvoorlichting: patienten.voorlichting@catharinaziekenhuis.nl INF006 / Screening BRMO na opname

Nadere informatie

MRSA. Wat is MRSA, wat zijn de gevolgen voor u, uw familie, voor medewerkers en andere patiënten?

MRSA. Wat is MRSA, wat zijn de gevolgen voor u, uw familie, voor medewerkers en andere patiënten? MRSA Wat is MRSA, wat zijn de gevolgen voor u, uw familie, voor medewerkers en andere patiënten? 2 Wat is MRSA? MRSA staat voor Methicilline Resistente Staphylococcus Aureus. Stafylokokken zijn bacteriën

Nadere informatie

Resultaten en nieuwe inzichten van bronopsporing:

Resultaten en nieuwe inzichten van bronopsporing: Resultaten en nieuwe inzichten van bronopsporing: Bronopsporings Eenheid Legionella-pneumonie (BEL) 12 mei 2014 Sjoerd M. Euser, PhD Stichting Streeklaboratorium voor de Volksgezondheid Kennemerland Haarlem

Nadere informatie

PATIËNTEN INFORMATIE MRSA. Meticilline Resistente Staphylococcus aureus. Informatie voor dragers MRSA

PATIËNTEN INFORMATIE MRSA. Meticilline Resistente Staphylococcus aureus. Informatie voor dragers MRSA PATIËNTEN INFORMATIE MRSA Meticilline Resistente Staphylococcus aureus Informatie voor dragers MRSA U bent, of uw naaste is, drager van een voor antibiotica ongevoelige bacterie, namelijk Methicilline

Nadere informatie

Identificatie van MRSA met behulp van de Real-time PCR en de klassieke PCR methode

Identificatie van MRSA met behulp van de Real-time PCR en de klassieke PCR methode T Identificatie van MRSA met behulp van de Real-time PCR en de klassieke PCR methode Linsey Boutmans, Kevin Degenaers, Melissa Matthys, Yao Wu MRSA/Methicilline Resistente Staphylococcus aureus: ziekenhuisbacterie

Nadere informatie

DNA practicum De modellenwereld van DNA

DNA practicum De modellenwereld van DNA DNA practicum De modellenwereld van DNA Inleiding Alle eigenschappen van een plant, zoals de grootte, de vorm van het blad, en de enzymen die nodig zijn voor de fotosynthese, liggen opgeslagen in het DNA.

Nadere informatie

Genomics: een doorbraak in de strijd tegen de aardappelziekte?!

Genomics: een doorbraak in de strijd tegen de aardappelziekte?! Genomics: een doorbraak in de strijd tegen de aardappelziekte?! De aardappelziekte De aardappelziekte Wel of geen infectie? Veroorzaakt door Phytophthora infestans Verantwoordelijk voor hongersnood 19e

Nadere informatie

Medische Publiekacademie Medisch Centrum Leeuwarden Leeuwarder Courant. Medische Publieksacademie. 2 oktober 2017 Welkom!

Medische Publiekacademie Medisch Centrum Leeuwarden Leeuwarder Courant. Medische Publieksacademie. 2 oktober 2017 Welkom! Medische Publiekacademie Medisch Centrum Leeuwarden Leeuwarder Courant Medische Publieksacademie 2 oktober 2017 Welkom! 1 MRSA Dr. Jan van Zeijl, arts-microbioloog Sonja Nicolai, kinderverpleegkundige

Nadere informatie

a. Geef de 1-lettercode van de aminozuren in het peptide in de corresponderende volgorde. (4P)

a. Geef de 1-lettercode van de aminozuren in het peptide in de corresponderende volgorde. (4P) HERTENTAMEN Eindtoets BIOCHEMIE (8RA00) Prof. Dr. Ir. L. Brunsveld 16-08-2013 09:00 12:00 (totaal 100 punten) 6 opgaven in totaal! (aangegeven tijd is indicatie) Gebruik geen rode pen! 1 Peptiden en eiwitten

Nadere informatie

DNA & eiwitsynthese Oefen- en zelftoetsmodule behorende bij hoofdstuk 16 en 17 van Campbell, 7 e druk December 2008

DNA & eiwitsynthese Oefen- en zelftoetsmodule behorende bij hoofdstuk 16 en 17 van Campbell, 7 e druk December 2008 DNA & eiwitsynthese Oefen- en zelftoetsmodule behorende bij hoofdstuk 16 en 17 van Campbell, 7 e druk December 2008 DNA 1. Hieronder zie je de schematische weergave van een dubbelstrengs DNA-keten. Een

Nadere informatie

De zin of onzin van MRSA-contactonderzoek bij medewerkers na beschermd contact

De zin of onzin van MRSA-contactonderzoek bij medewerkers na beschermd contact De zin of onzin van MRSA-contactonderzoek bij medewerkers na beschermd contact Willemien Maathuis-de Haan 1, Ellen van Luijtelaar-Boot 1, Annet Troelstra 1, 2. 1 Afdeling Medische Microbiologie en Infectiepreventie,

Nadere informatie

Dragerschap en behandeling van MRSA

Dragerschap en behandeling van MRSA Er is bij u besmetting met de bacterie MRSA (Methicilline resistente Staphylococcus aureus) ontdekt. S. aureus is een bacterie die tot de normale huidbewoners van de mens behoort. Daarnaast staat hij bekend

Nadere informatie

Bijzonder Resistent Micro-Organisme

Bijzonder Resistent Micro-Organisme Bijzonder Resistent Micro-Organisme (BRMO en MRSA) In deze folder krijgt u uitleg over een Bijzonder Resistent Micro-Organisme (BRMO) en wat gevolgen hiervan zijn. Ook leest u algemene informatie over

Nadere informatie

Evolution of Races within Fusarium oxysporum f.sp. Lycopersici B.V. Chellappan

Evolution of Races within Fusarium oxysporum f.sp. Lycopersici B.V. Chellappan Evolution of Races within Fusarium oxysporum f.sp. Lycopersici B.V. Chellappan University of Amsterdam Evolution of races within Fusarium oxysporum f.sp. lycopersici Biju Vadakkemukadiyil Chellappan Samenvatting

Nadere informatie

Cover Page. The handle http://hdl.handle.net/1887/18950 holds various files of this Leiden University dissertation.

Cover Page. The handle http://hdl.handle.net/1887/18950 holds various files of this Leiden University dissertation. Cover Page The handle http://hdl.handle.net/1887/18950 holds various files of this Leiden University dissertation. Author: Velthuis, Arend Jan Wouter te Title: A biochemical portrait of the nidovirus RNA

Nadere informatie

Nederlandse samenvatting

Nederlandse samenvatting Dikkedarmkanker is na longkanker de meest voorkomende doodsoorzaak ten gevolge van kanker in de westerse wereld. Dikkedarmkanker manifesteert zich na een accumulatie van verscheidene genetische veranderingen.

Nadere informatie

Disclosure slide. (potentiële) belangenverstrengeling. Geen

Disclosure slide. (potentiële) belangenverstrengeling. Geen BRMO Disclosure slide (potentiële) belangenverstrengeling Voor bijeenkomst mogelijk relevante relaties met bedrijven Sponsoring of onderzoeksgeld Honorarium of andere (financiële) vergoeding Aandeelhouder

Nadere informatie

De antwoorden op vragen 1 en 2, 3 en 4, en 5 t/m 8 graag op verschillende vellen schrijven. Vergeet ook niet op de 3 vellen je naam en studentnr.

De antwoorden op vragen 1 en 2, 3 en 4, en 5 t/m 8 graag op verschillende vellen schrijven. Vergeet ook niet op de 3 vellen je naam en studentnr. Tentamen Genoombiologie, 28 Oktober 2009, 9.00-11.45 h De antwoorden op vragen 1 en 2, 3 en 4, en 5 t/m 8 graag op verschillende vellen schrijven. Vergeet ook niet op de 3 vellen je naam en studentnr.

Nadere informatie

Samenvatting. Detectie en typeringsmethoden

Samenvatting. Detectie en typeringsmethoden amenvatting 176 amenvatting amenvatting Resistentie veroorzaakt door EBL producerende Enterobacteriaceae neemt, over de gehele wereld, snel toe. De oorzaken van deze toename zijn nog niet geheel opgehelderd.

Nadere informatie

het antibiotica-spel Wat zijn de gevolgen van verkeerd of overmatig antibioticagebruik?

het antibiotica-spel Wat zijn de gevolgen van verkeerd of overmatig antibioticagebruik? het antibiotica-spel Wat zijn de gevolgen van verkeerd of overmatig antibioticagebruik? Blaasontsteking? Even langs de dokter voor een antibioticakuurtje. Ook bij longontsteking, bloedvergiftiging of een

Nadere informatie

Cover Page. The handle http://hdl.handle.net/1887/26922 holds various files of this Leiden University dissertation

Cover Page. The handle http://hdl.handle.net/1887/26922 holds various files of this Leiden University dissertation Cover Page The handle http://hdl.handle.net/1887/26922 holds various files of this Leiden University dissertation Author: Shah, Dipen M. Title: NMR structural studies of protein-small molecule interactions

Nadere informatie

De meest gestelde vragen over MRSA

De meest gestelde vragen over MRSA De meest gestelde vragen over MRSA Inleiding In deze brochure treft u de meest gestelde vragen aan over MRSA en de antwoorden daarop. De brochure is een aanvulling op de ziekenhuisfolder waarin algemene

Nadere informatie

Welke van de bovenstaande celorganellen of levensprocessen kunnen zowel in prokaryote, als in eukaryote cellen voorkomen?

Welke van de bovenstaande celorganellen of levensprocessen kunnen zowel in prokaryote, als in eukaryote cellen voorkomen? Biologie Vraag 1 Celorganellen en levensprocessen bij levende cellen zijn: 1. Ribosomen 2. ATP synthese 5. DNA polymerase 3. Celmembranen 6. Fotosynthese 4. Kernmembraan 7. Mitochondria Welke van de bovenstaande

Nadere informatie

TENTAMEN BIOCHEMIE (8S135) Prof. Dr. Ir. L. Brunsveld :00 17:00 (totaal 100 punten) 6 opgaven in totaal (aangegeven tijd is indicatie)

TENTAMEN BIOCHEMIE (8S135) Prof. Dr. Ir. L. Brunsveld :00 17:00 (totaal 100 punten) 6 opgaven in totaal (aangegeven tijd is indicatie) TENTAMEN BIOCHEMIE (8S135) Prof. Dr. Ir. L. Brunsveld 25-01-2010 14:00 17:00 (totaal 100 punten) 6 opgaven in totaal (aangegeven tijd is indicatie) 1 (~30 minuten; 20 punten) Onderstaand is een stukje

Nadere informatie

De superbacterie verlaat het ziekenhuis en komt naar u toe Wat gaat u doen? Wat kunt u doen?

De superbacterie verlaat het ziekenhuis en komt naar u toe Wat gaat u doen? Wat kunt u doen? De superbacterie verlaat het ziekenhuis en komt naar u toe Wat gaat u doen? Wat kunt u doen? Arend-Jan Meinders, internist-intensivist Resistente ziekenhuisbacteriën MRSA = Resistente S. aureus 30-40%

Nadere informatie

Het menselijk genoom. Inleiding Medisch Technische Wetenschappen. Bioinformatica Deel 2. Gevouwen chromosoom. X chromosoom DNA.

Het menselijk genoom. Inleiding Medisch Technische Wetenschappen. Bioinformatica Deel 2. Gevouwen chromosoom. X chromosoom DNA. Het menselijk genoom Het menselijk genoom (DN) bestaat uit: Mega Basenparen (MB),,, C,. Inleiding Medisch echnische Wetenschappen Bioinformatica Deel Michael Egmont-Petersen Het menselijk DN is ingedeeld

Nadere informatie

Maatregelen voor drager van MRSA-bacterie

Maatregelen voor drager van MRSA-bacterie MRSA positief Maatregelen voor drager van MRSA-bacterie Inleiding Bij u is vastgesteld dat u drager bent van de MRSA-bacterie. MRSA staat voor Meticilline-Resistente Staphylococcus Aureus. Dit is een bacterie

Nadere informatie

Whole genome sequencing op direct materiaal voor virus detectie en typering. Janette Rahamat-Langendoen, arts-microbioloog

Whole genome sequencing op direct materiaal voor virus detectie en typering. Janette Rahamat-Langendoen, arts-microbioloog Whole genome sequencing op direct materiaal voor virus detectie en typering Janette Rahamat-Langendoen, arts-microbioloog Acute luchtweginfecties Belangrijke oorzaak van ziekenhuis opnames bij kinderen

Nadere informatie

Bijzonder Resistent Micro-Organismen (BRMO)

Bijzonder Resistent Micro-Organismen (BRMO) Bijzonder Resistent Micro-Organismen (BRMO) 2 Bij u is vastgesteld dat u een verhoogde kans heeft om drager te zijn van een Bijzonder Resistent Micro-Organisme (BRMO) of er is bij u vastgesteld dat u drager

Nadere informatie

Maatregelen voor drager van MRSA-bacterie

Maatregelen voor drager van MRSA-bacterie MRSA positief Maatregelen voor drager van MRSA-bacterie Bij u is vastgesteld dat u drager bent van de MRSA-bacterie. MRSA staat voor Meticilline-Resistente Staphylococcus Aureus. Dit is een bacterie die

Nadere informatie

Introductie. Doel van dit proefschrift

Introductie. Doel van dit proefschrift Samenvatting 222 Introductie Staphylococcus aureus (S. aureus) is een bacterie die op de huid en slijmvliezen (onder andere keel en neus) van mensen leeft. Ongeveer 1 op de 3 mensen draagt deze bacterie

Nadere informatie

BRMO. Bijzonder Resistent Micro-Organisme. dr. M.C.A. Wegdam-Blans, arts-microbioloog, Stichting PAMM. Bedside teaching 18 NOV 2014

BRMO. Bijzonder Resistent Micro-Organisme. dr. M.C.A. Wegdam-Blans, arts-microbioloog, Stichting PAMM. Bedside teaching 18 NOV 2014 BMO Bijzonder esistent Micro-Organisme dr. M.C.A. Wegdam-Blans, arts-microbioloog, Stichting PAMM Bedside teaching 18 NOV 2014 Hoezo BMO? Bedside teaching 18 NOV 2014 bacteriële resistentie zieken huis

Nadere informatie


SAMENVATTING EN ALGEMENE DISCUSSIE SAMENVATTING EN ALGEMENE DISCUSSIE In dit proefschrift is de activiteit van het Escherichia coli UvrA eiwit bestudeerd met zgn. single-molecule microscopie technieken, waarmee individuele eiwit-complexen

Nadere informatie

Out of Africa: mtdna en Y chromosoom. Jean-Jacques Cassiman KuLeuven

Out of Africa: mtdna en Y chromosoom. Jean-Jacques Cassiman KuLeuven Out of Africa: mtdna en Y chromosoom Jean-Jacques Cassiman KuLeuven 12.05.2007 Kern DNA CME 06 CME 06 CME 06 Start in 2007: twee zonen per generatie (25j) In 2258 (10 generaties of 250 jaar) zullen er

Nadere informatie

MRSA. informatie voor patiënten

MRSA. informatie voor patiënten MRSA informatie voor patiënten Wat is MRSA en wat zijn de gevolgen voor u, uw familie, artsen, verpleegkundigen, kinesisten en andere patiënten? Deze folder informeert u over het begrip MRSA en is een

Nadere informatie

MRSA-bacterie. 'ziekenhuisbacterie' Afdeling Medische Microbiologie en Ziekenhuishygiëne

MRSA-bacterie. 'ziekenhuisbacterie' Afdeling Medische Microbiologie en Ziekenhuishygiëne 00 MRSA-bacterie 'ziekenhuisbacterie' Afdeling Medische Microbiologie en Ziekenhuishygiëne 1 Inleiding MRSA staat voor Meticilline-resistente Staphylococcus aureus. De Staphylococcus aureus is een bacterie

Nadere informatie

DNA barcoding. Identificatie van plant en dier

DNA barcoding. Identificatie van plant en dier DNA barcoding Identificatie van plant en dier DNA barcoding Identificatie van plant en dier Berry B. van der Hoorn, Kevin K. Beentjes, Maartje Kijne-van der Sluis Naturalis Biodiversity Center, DNA Barcoding

Nadere informatie

MRSA Maatregelen tegen verspreiding

MRSA Maatregelen tegen verspreiding MRSA Maatregelen tegen verspreiding U heeft van uw arts gehoord dat u mogelijk besmet bent met de MRSA-bacterie. MRSA staat voor Meticilline-Resistente Staphylococcus Aureus; dit is de naam van de bacterie.

Nadere informatie

Bijzonder Resistente Micro Organismen (BRMO) Wat is het probleem

Bijzonder Resistente Micro Organismen (BRMO) Wat is het probleem Bijzonder Resistente Micro Organismen (BRMO) Wat is het probleem Regionale nascholing Samen krachtig tegen BRMO! Hoe pakken we dat aan? 29 januari 2015 dr F. Vlaspolder, arts microbioloog Maasstad ziekenhuis

Nadere informatie

Streptococcus pyogenes

Streptococcus pyogenes Het referentielaboratorium voor S. pyogenes bevindt zich in het U.Z.A. - U.I.A. - Antwerpen. Materialen & Methoden Stammen In totaal stuurden 3 Belgische diagnostische laboratoria vermoedelijke gevallen

Nadere informatie

DNA & eiwitsynthese (Junior College Utrecht) Vragen bij COO-programma

DNA & eiwitsynthese (Junior College Utrecht) Vragen bij COO-programma DNA & eiwitsynthese (Junior College Utrecht) Vragen bij COO-programma De vragen die voorkomen in het COO-programma DNA & eiwitsynthese zijn op dit formulier weergegeven. Het is de bedoeling dat je, als

Nadere informatie

DNA & eiwitsynthese Vragen bij COO-programma bij hoofdstuk 11 en 12 Life

DNA & eiwitsynthese Vragen bij COO-programma bij hoofdstuk 11 en 12 Life DNA & eiwitsynthese Vragen bij COO-programma bij hoofdstuk 11 en 12 Life De vragen die voorkomen in het COO-programma DNA & eiwitsynthese zijn op dit formulier weergegeven. Het is de bedoeling dat je,

Nadere informatie

Grensoverschrijdende Infectiepreventie

Grensoverschrijdende Infectiepreventie Grensoverschrijdende Infectiepreventie Claudia van Schriek Deskundige Infectiepreventie Symposium HKM, Eindhoven 30-06-2016 Zwitserland I Oppervlakte 41,284 km² (4% water) 8,1 miljoen inwoners 380 inwoners

Nadere informatie

Cover Page. The handle holds various files of this Leiden University dissertation.

Cover Page. The handle  holds various files of this Leiden University dissertation. Cover Page The handle http://hdl.handle.net/1887/18671 holds various files of this Leiden University dissertation. Author: Albers, Harald Title: Development of ATX and DUSP inhibitors : inhibiting phosphate

Nadere informatie

De extractie van bacterieel en fungaal DNA uit verschillende lichaamsvloeistoffen

De extractie van bacterieel en fungaal DNA uit verschillende lichaamsvloeistoffen Een grote verscheidenheid aan bacteriën, virussen, schimmels en parasieten is verantwoordelijk voor de naar schatting 15 miljoen sterfgevallen per jaar als gevolg van infectieziekten. Infectieziekten gaan

Nadere informatie

Beleidswijziging LA-MRSA

Beleidswijziging LA-MRSA Beleidswijziging LA-MRSA Een project over veegerelateerde MRSA in het Jeroen Bosch Ziekenhuis en ziekenhuis Bernhoven Jamie Meekelenkamp, deskundige infectiepreventie Wat is MRSA? Staphylococcus aureus

Nadere informatie

Hoe kijken we naar het DNA van een patiënt?

Hoe kijken we naar het DNA van een patiënt? Hoe kijken we naar het DNA van een patiënt? Ies Nijman UMC Utrecht Dept of Genetics, Centre for Molecular Medicine Center for Personalized Cancer Treatment (CPCT), Hartwig Medical Foundation 1994 DNA sequenties,

Nadere informatie

Nederlandse samenvatting en discussie

Nederlandse samenvatting en discussie 9 Nederlandse samenvatting en discussie 158 Chapter 9 Variaties in het humane genoom: geschikte markers voor weefsel identificatie en het testen van allelische instabiliteit 9.1 Samenvatting en algemene

Nadere informatie

20 e Grande Conférence Istanbul 2014

20 e Grande Conférence Istanbul 2014 Hoezo BMO? dr. N.L.A.. (Niek) Arents, arts-microbioloog, Stichting PAMM 20 e Grande Conférence Istanbul 2014 BMO Bijzonder esistent Micro-Organisme 20 e Grande Conférence Istanbul 2014 bacteriële resistentie

Nadere informatie

Moleculaire microbiologie 1: Schimmels

Moleculaire microbiologie 1: Schimmels Moleculaire microbiologie 1: Schimmels Hand-out behorende bij de COO 17 maart 2009 Introductie tot de schimmels Waarom is het eenvoudiger antibiotica te ontwikkelen voor bacteriën dan voor schimmels? Noem

Nadere informatie

Deze folder geeft antwoord op enkele van de meest gestelde vragen over MRSA. MRSA is een afkorting voor Methicilline Resistente Staphylococcus Aureus.

Deze folder geeft antwoord op enkele van de meest gestelde vragen over MRSA. MRSA is een afkorting voor Methicilline Resistente Staphylococcus Aureus. MRSA Deze folder geeft antwoord op enkele van de meest gestelde vragen over MRSA. MRSA is een afkorting voor Methicilline Resistente Staphylococcus Aureus. 1. Wat is MRSA? Staphylococcus aureus, is een

Nadere informatie


DIAGNOSTIEK TARIEVEN EERSTE LIJN 2014 DIAGNOSTIEK TARIEVEN EERSTE LIJN 2014 De onderstaande tarievenlijst geeft een zo goed mogelijk beeld van de kosten van de meest aangevraagde onderzoeken. Afwijkingen kunnen voorkomen. Het kan zijn dat

Nadere informatie

HLA typeringen: nieuwe DNA technieken. Wendy T.N. Swelsen Afdeling Immunogenetica, HLA diagnostiek

HLA typeringen: nieuwe DNA technieken. Wendy T.N. Swelsen Afdeling Immunogenetica, HLA diagnostiek HLA typeringen: nieuwe DNA technieken Wendy T.N. Swelsen Afdeling Immunogenetica, HLA diagnostiek 1 Structuur presentatie DNA typeerstraat Nieuwe techniek: Next Generation Sequencing (NGS) 2 Afdeling Immunogenetica,

Nadere informatie

Ontwikkelingen binnen de moleculaire pathologie. Bastiaan Tops Klinisch moleculair bioloog i.o. UMC St Radboud

Ontwikkelingen binnen de moleculaire pathologie. Bastiaan Tops Klinisch moleculair bioloog i.o. UMC St Radboud Ontwikkelingen binnen de moleculaire pathologie Bastiaan Tops Klinisch moleculair bioloog i.o. UMC St Radboud Binnen het UMC St Radboud: - Stroomlijnen van de diagnostiek (automatiseren) - Zoveel mogelijk

Nadere informatie

Antibiotica Gebruik ze goed en alleen. als t moet!

Antibiotica Gebruik ze goed en alleen. als t moet! Antibiotica Gebruik ze goed en alleen Algemene informatie als t moet! Antibiotica blijven effectief als we ze verstandig gebruiken: niet te vaak en op de goede manier. Uw arts weet wanneer u antibiotica

Nadere informatie

UvA-DARE (Digital Academic Repository) Molecular epidemiology of Chlamydia trachomatis Bom, R.J.M. Link to publication

UvA-DARE (Digital Academic Repository) Molecular epidemiology of Chlamydia trachomatis Bom, R.J.M. Link to publication UvA-DARE (Digital Academic Repository) Molecular epidemiology of Chlamydia trachomatis Bom, R.J.M. Link to publication Citation for published version (APA): Bom, R. J. M. (2014). Molecular epidemiology

Nadere informatie

Samenvatting. Samenvatting

Samenvatting. Samenvatting Samenvatting Staphylococcus epidermidis is een ziekenhuisgerelateerde pathogeen die geassocieerd wordt met infecties van inwendige medische implantaten. De mogelijkheid van S. epidermidis om te hechten

Nadere informatie

DAR Approximate string matching Casus: biological sequence alignment

DAR Approximate string matching Casus: biological sequence alignment DAR Approximate string matching Casus: biological sequence alignment 1 Text search Approx string matching dynamic programming, edit distance example application: Google search Text indexing inverted list

Nadere informatie


ONDERZOEK NAAR BRMO EN MRSA INFORMATIE VOOR PATIËNTEN ONDERZOEK NAAR BRMO EN MRSA INFORMATIE VOOR PATIËNTEN Inleiding In deze folder leest u informatie over Bijzonder Resistente Micro-Organismen (BRMO) en MRSA (Methicilline Resistente Staphylococcus aureus)

Nadere informatie

Tentamen Genetica 22-10-2004 Studentnr:

Tentamen Genetica 22-10-2004 Studentnr: CONTROLEER OF DIT TENTAMEN 11 PAGINA S BEVAT. Veel succes! Je mag de achterkant van het papier ook zo nodig gebruiken, maar beantwoord vragen 1-6 niet op blaadjes van vraag 7 en de daarop volgende. 1.

Nadere informatie

Beheersen van BRMO in de regio

Beheersen van BRMO in de regio Beheersen van BMO in de regio Miriam Beerens specialist ouderengeneeskunde Laura van Dommelen arts-microbioloog Danielle van Oudheusden arts infectieziektebestrijding Marjolijn Wegdam- Blans arts-microbioloog

Nadere informatie

MRSA/ Methicilline Resistente Staphylococcus Aureus

MRSA/ Methicilline Resistente Staphylococcus Aureus Patiënteninformatie MRSA/ Methicilline Resistente Staphylococcus Aureus Informatie voor patiënten en bezoekers over MRSA 1234567890-terTER_ MRSA/ Methicilline Resistente Staphylococcus Aureus Informatie

Nadere informatie

Infectiepreventie MRSA.

Infectiepreventie MRSA. Infectiepreventie MRSA www.catharinaziekenhuis.nl Inhoud Wat is een MRSA-bacterie?... 4 Gevolgen van een MRSA-infectie... 4 Wie kan een MRSA bij zich dragen?... 4 Onderzoek naar de MRSA-bacterie... 5 Hoe

Nadere informatie

Biotechnologie deel I

Biotechnologie deel I Biotechnologie deel I Hand-out bij de eerste oefen- en zelftoetsmodule van Biotechnologie & maatschappij behorende bij hoofdstuk 2,3, 4 en 5 van Introduction to Biotechnology, Thieman & Palladino, 3 e

Nadere informatie

HLA & HLA geassocieerde aandoeningen. 25/10/ Rode Kruis Vlaanderen L. Daniëls

HLA & HLA geassocieerde aandoeningen. 25/10/ Rode Kruis Vlaanderen L. Daniëls HLA & HLA geassocieerde aandoeningen 25/10/2016 - Rode Kruis Vlaanderen L. Daniëls HILA Histocompatibiliteiten ImmunogeneticaLaboratorium van de Dienst voor het Bloed van Rode Kruis-Vlaanderen. HLA typeringstechnologieën

Nadere informatie

Opname: na een verblijf in een buitenlands ziekenhuis nadat u in contact bent geweest met varkens of vleeskalveren.

Opname: na een verblijf in een buitenlands ziekenhuis nadat u in contact bent geweest met varkens of vleeskalveren. Opname: na een verblijf in een buitenlands ziekenhuis nadat u in contact bent geweest met varkens of vleeskalveren (MRSA-bacterie) Als u in het buitenland in het ziekenhuis bent behandeld, bestaat de

Nadere informatie

MRSA Ongevoelige of resistente bacterie

MRSA Ongevoelige of resistente bacterie MRSA Ongevoelige of resistente bacterie Via deze folder proberen wij u antwoord te geven op enkele van de meest gestelde vragen over MRSA. Wat is MRSA? Staphylococcus aureus, is een bacterie die in veel

Nadere informatie

Bijlage 1: Nederlandse samenvatting Projectbeschrijving

Bijlage 1: Nederlandse samenvatting Projectbeschrijving Bijlage 1: Nederlandse samenvatting Projectbeschrijving Algemene gegevens: Projectcoördinator Münsterland: Dr. med. A.W. Friedrich mede-projectcoördinator: Dr. med. A.K. Sonntag Tel: +49-251-83 55366 Projectcoördinator

Nadere informatie