De rol van de pathologie en genetica bij de herkenning van Lynch syndroom

Save this PDF as:
 WORD  PNG  TXT  JPG

Maat: px
Weergave met pagina beginnen:

Download "De rol van de pathologie en genetica bij de herkenning van Lynch syndroom"

Transcriptie

1 De rol van de pathologie en genetica bij de herkenning van Lynch syndroom Marjolijn Ligtenberg Laboratorium specialist klinische genetica Klinisch moleculair bioloog in de Pathologie VAP dag

2 Disclosure belangen spreker (potentiële) belangenverstrengeling Voor bijeenkomst mogelijk relevante relaties met bedrijven Geen / Zie hieronder Bedrijfsnamen Sponsoring of onderzoeksgeld Honorarium of andere (financiële) vergoeding AstraZeneca AMGEN Thermo Fisher / Life Technologies

3 Lynch syndroom Autosomaal dominante genetische aandoening Risico: colorectaal kanker 25-70% C43 endometrium kanker 13-54% Ovarium, nierbekken, maag 1-15% Relatief jonge diagnose leeftijd Relatief vaak meerdere primaire tumoren C55 40 E48 Weinig adenomen (Hereditary NonPolyposis Colorectal Cancer) Vaak meerdere aangedane familieleden

4 Onderliggende oorzaak Lynch syndroom Inactiverende mutaties in DNA mismatch repair (MMR) genen MLH1, PMS2, MSH2 en MSH6 Nonsense Splice site Frameshift Soms missense Eon deletie/duplicatie MSH2 inactivatie door 3 EPCAM deletie Mutatie is specifiek voor de familie

5 Knudson s two-hit model in niet aangedane personen Replicatie cycli Replicatie cycli Geen tumor

6 Knudson s two-hit model in sporadische tumoren tumor vorming Replicatie cycli Replicatie cycli Twee somatische mutaties

7 Knudson s two-hit model in familiaire/erfelijke kanker tumor tumor Replicatie cycli tumor Eén erfelijke en één somatische mutatie

8 Inactivatie van MMR genen Lynch syndroom patiënt Mutatie 1 allel Inactivatie van beide allelen

9 Cumulatief risico op colorectaal kanker Kempers et al, Lancet Oncology (2011)

10 Surveillance in Lynch syndroom Colonoscopie year vanaf 25-rige leeftijd >> CRC gerelateerde mortaliteitsreductie van 65% in 15 years. Järvinen et al. Gastroenterology 2000:118:

11 Mismatch repair deficiëntie Probleem met het herstel van fouten die ontstaan tijdens de DNA replicatie Inactivatie van één van de DNA mismatch repair genen Komt mn voor bij colorectaal en endometrium tumoren (~15%)

12 Microsatelliet instabiliteit (MSI) normaal weefsel ctggtcttgaaaaaaaaaaaattgcatgca tumor weefsel ctggtcttgaaaaaaaattgcatgca ctggtcttgaaaaaaaaaattgcatgca ctggtcttgaaaaaaaaaaaaattgcatgca ctggtcttgaaaaaaaaaaaaaaattgcatgca Test: standaard set van 5 mononucleotide repeats BAT25 BAT26 MSI-high: mismatch repair (MMR) defect

13 Immunohistochemie voorspelt ook aangedane gen MLH1 PMS2 MSH2 MSH6 MLH1 - PMS2 - MSH2 - MSH6 -

14 Immunohistochemische kleuring MMR eiwit positief negatief

15 Wanneer is vastgesteld dat iemand Lynch syndroom heeft 1. Als de familie anamnese voldoet aan specifieke criteria 2. Als er een kiembaanmutatie van een mismatch repair gen is aangetoond 3. Als in de tumor microsatelliet instabiliteit is aangetoond 4. Als in de tumor microsatelliet instabiliteit of afwezigheid van een MMR eiwit is aangetoond

16 Onderliggende oorzaak MMRdeficiënte tumoren (n=230; diagnoseleeftijd gemiddeld 48 ar) MLH1 PMS2 MSH2 Kiembaanmutaties in MMR genen MSH6

17 Inactivatie van MMR genen Lynch syndroom patiënt Kernkleuring Sporadische patiënt Kernkleuring Inactivatie van beide allelen Afwezigheid van MLH1 en PMS2 of PMS2 of MSH2 en MSH6 of MSH6 Meestal: Inactivatie van MLH1 promoter via hypermethylering Afwezigheid van MLH1 en PMS2

18 Hypermethylering Herman J.G. N Engl J Med 349, 2003 C m alleen in CpG dinucleotiden

19 Hypermethylering MLH1 promoter Verlies van MLH1 en PMS2 eiwit Gaat vaak samen met BRAF c.1799t>a (p.(val600glu) in 70% van tumoren met hypermethylering MLH1 Niet in tumoren van Lynch patiënten Zeer zeldzaam: Hypermethylering als 2 e hit naast kiembaanmutatie erfelijke hypermethylering MLH1 (mechanisme onduidelijk) Hypermethylering MLH1 maakt Lynch syndroom onwaarschijnlijk Richtlijn erfelijke darmkanker,

20 Onderliggende oorzaak MMRdeficiënte tumoren (n=230; diagnoseleeftijd gemiddeld 48 ar) methylering MLH1 MLH1 PMS2 MSH2 Kiembaanmutaties in MMR genen MSH6

21 Prevalentie Lynch syndroom bij CRC <70 ar LIMO studie Van Lier et al, J pathol 2012

22 Niet erfelijke oorzaken mismatch repair deficiëntie Hypermethylering MLH1 promoter >> inactivering MLH1; verlies MLH1 en PMS2 LIMO studie Van Lier et al, J pathol 2012

23 oorzaken mismatch repair deficiëntie Hypermethylering MLH1 promoter >> inactivering MLH1; verlies MLH1 en PMS2 LIMO studie Van Lier et al, J pathol 2012 Belangrijkste oorzaak voor mismatch repair deficiëntie >55 ar

24 Niet-erfelijke oorzaken mismatch repair deficiëntie Hypermethylering MLH1 promoter >> inactivering MLH1; verlies MLH1 en PMS2 Somatische mutaties in mismatch repairgen: 2 intragene mutaties 1 intragene mutatie in combinatie met verlies van het wild type allel Mensenkamp et al Gastroenterology 2014 Geurts-Gielis et al J Pathol 2014 Haraldsdottir et al Gastroenterology 2014 Net generation sequencing van MMR genen in tumor DNA

25 MMR deficiëntie op jonge leeftijd Lynch syndroom n=230; gemiddelde diagnoseleeftijd 48 ar Mensenkamp et al Gastroenterology 2014

26 Speelt de patholoog een rol bij het stellen van de diagnose erfelijke darmkanker? 1. Nee, dit is een erfelijke aandoening waarvoor de diagnostiek is voorbehouden aan klinisch genetici. 2. Ja, maar alleen als de klinisch geneticus een aanvraag voor het testen op mismatch repair deficiëntie doet. 3. Ja, de patholoog kan een signalerende rol spelen door te testen op mismatch repair deficiëntie en hypermethylering van de MLH1 promoter. 4. Zowel antwoord 2 als 3 zijn correct.

27 MIPA in richtlijn erfelijke darmkanker MIPA criteria: CRC <70 ar Endometriumkanker <70 ar Immunohistochemie MMR eiwitten op biopt Indien onduidelijk MSI-analyse ter bevestiging Indien MLH1-negatief: test hypermethylering MLH1 promoter Rapportage voor 1 e MDO na resectie mbv standaardteksten Verwijzing naar klinisch geneticus Alle CRC < 40 ar CRC ar met afwijkende IHC MMR eiwitten zonder hypermethylering Op basis van familie-anamnese of polyposis

28 Workflow Lynch diagnostiek IHC MMR afwijkend / MSI-high Diagnose <70 ar nee nee sporadisch, tenzij sporadisch MSH2 &MSH6; MSH6; PMS2 afwijkend MLH1 & PMS2 afwijkend zonder hypermethylering MLH1 nee sporadisch, tenzij Pathogene kiembaanmutatie MMR gen nee 2 somatische hits MMR gen sporadisch, tenzij nee Lynch syndroom Vermoedelijk Lynch syndroom

29 Workflow Lynch diagnostiek IHC MMR afwijkend / MSI-high Diagnose <70 ar nee nee sporadisch, tenzij sporadisch MSH2 &MSH6; MSH6; PMS2 afwijkend MLH1 & PMS2 afwijkend zonder hypermethylering MLH1 nee sporadisch, tenzij Pathogene kiembaanmutatie MMR gen nee 2 somatische hits MMR gen sporadisch, tenzij nee Lynch syndroom Vermoedelijk Lynch syndroom

30 Workflow Lynch diagnostiek IHC MMR afwijkend / MSI-high Diagnose <70 ar nee nee sporadisch, tenzij sporadisch MSH2 &MSH6; MSH6; PMS2 afwijkend MLH1 & PMS2 afwijkend zonder hypermethylering MLH1 nee sporadisch, tenzij Pathogene kiembaanmutatie MMR gen nee na genetische counseling 2 somatische hits MMR gen nee sporadisch, tenzij Lynch syndroom Vermoedelijk Lynch syndroom

31 Optimale diagnostiek van Lynch syndroom Pathologen: Actieve rol bij selectie casussen met MMR-deficiëntie zonder MLH1 methylering Actieve rol in signaleren mogelijke erfelijkheid in patientenbesprekingen (leeftijd / polyposis) Behandelend artsen: Verwijzing naar klinisch genetica indien <40 ar; MMR-deficiënt zonder methylering; verdachte familie-anamnese; polyposis Klinisch genetici: Genetische counseling Selectie patiënten voor analyse genetische achtergrond: kiembaanmutaties / somatische mutaties

32 Belang van klinisch genetische counseling Bespreken van: Risico s en evt. preventieve maatregelen Timing van de genetische test i.v.m. klinische en maatschappelijke consequenties Bespreekbaar maken van genetisch risico binnen de familie Beschikbaar maken van gerichte DNA-analyses voor familieleden

33 Met dank aan Collega s afdeling Genetica Collega s afdeling Pathologie Leden van de richtlijn commissie erfelijke darmkanker

34 6 e Up-to-date in erfelijke kanker: 25 ar Lynch Syndroom 7 december 2017, multidisciplinaire nascholing, Nijmegen Programma 10.00u u: Herkennen en diagnostisch traject Preventie en behandeling van kanker Historisch overzicht en een blik in de toekomst Safe the date ERN GENTURIS

20-1-2015. Disclosure conflicts of interest speaker. De betekenis van mismatch repair deficiëntie voor Lynch syndroom en therapiekeuze

20-1-2015. Disclosure conflicts of interest speaker. De betekenis van mismatch repair deficiëntie voor Lynch syndroom en therapiekeuze De betekenis van mismatch repair deficiëntie voor en therapiekeuze Marjolijn Ligtenberg Laboratorium specialist klinische genetica Klinisch moleculair bioloog in de Pathologie Moleculaire dag WMDP 16-1-2015

Nadere informatie

5.2Diagnostiek Laboratoriumonderzoek Diagnostische tests Diagnostische tests (tekst 2008, update in 2014)

5.2Diagnostiek Laboratoriumonderzoek Diagnostische tests Diagnostische tests (tekst 2008, update in 2014) 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259

Nadere informatie

Resultaten Moleculaire Pathologie ronde Additionele moleculaire testen bij MLH1-negatieve tumoren met Lynch syndroom vraagstelling

Resultaten Moleculaire Pathologie ronde Additionele moleculaire testen bij MLH1-negatieve tumoren met Lynch syndroom vraagstelling Resultaten Moleculaire Pathologie ronde 2016.1 Additionele moleculaire testen bij MLH1-negatieve tumoren met Lynch syndroom vraagstelling Albertina Dirkx-van der Velden & Ina Geurts-Giele, KMBP afdeling

Nadere informatie

Erfelijkheid van Darmkanker Nieuwe Richtlijn (selectie)

Erfelijkheid van Darmkanker Nieuwe Richtlijn (selectie) 4e verpleegkundig congres GE-Oncologie 2015 Erfelijkheid van Darmkanker Nieuwe Richtlijn (selectie) Rolf Sijmons, klinisch gene2cus Afdeling Gene2ca, UMCG Evidence- based Richtlijn Ontwikkeling (mul2-

Nadere informatie

5.2.1.3 Restrisico na laboratoriumtesten (tekst 2008, update in 2014)

5.2.1.3 Restrisico na laboratoriumtesten (tekst 2008, update in 2014) 53 54 55 56 57 58 59 530 53 53 533 534 535 536 537 538 539 540 54 54 543 544 545 546 547 548 549 550 55 55 553 554 555 556 557 558 559 560 56 56 563 564 565 566 567 568 569 570 57 57 573 574 575 5...3

Nadere informatie

Samenvatting van de richtlijn erfelijke darmkanker, revisie

Samenvatting van de richtlijn erfelijke darmkanker, revisie Samenvatting van de richtlijn erfelijke darmkanker, revisie WKO 3 sept Uitgangspunt richtlijn Welke aanbevelingen over genetische counseling en diagnostiek, preventie, surveillance, behandeling voor mensen

Nadere informatie

Promotor: Prof. dr. E.J. Kuipers Prof. dr. E.W. Steyerberg. Co-promotors: Dr. W.N.M. Dinjes Dr. M.E. van Leerdam Dr. A. Wagner

Promotor: Prof. dr. E.J. Kuipers Prof. dr. E.W. Steyerberg. Co-promotors: Dr. W.N.M. Dinjes Dr. M.E. van Leerdam Dr. A. Wagner Samenvatting van het proefschrift Celine H.M. Leenen Diagnostic strategies for early Lynch syndrome detection Promotiedatum: 28 januari 2015 Universiteit: Erasmus Universiteit Rotterdam Promotor: Prof.

Nadere informatie

M.J.A. Alleman, MDL arts 22 december 2009

M.J.A. Alleman, MDL arts 22 december 2009 M.J.A. Alleman, MDL arts 22 december 2009 1 3 1 4 5 2 Risico ColoRectaalCarcinoom 6 7 3 Terminologie Syndroom van Lynch (HNPCC) Vermoedelijk syndroom van Lynch Familiaire darmkanker Sporadische darmkanker

Nadere informatie

Robert Hofstra Afdeling Genetica, UMCG. Erfelijkheidsonderzoek bij Lynch syndroom: wat zijn de klinische consequenties?

Robert Hofstra Afdeling Genetica, UMCG. Erfelijkheidsonderzoek bij Lynch syndroom: wat zijn de klinische consequenties? Robert Hofstra Afdeling Genetica, UMCG Erfelijkheidsonderzoek bij Lynch syndroom: wat zijn de klinische consequenties? Lynch syndroom of Hereditair Non-Polyposis Colorectaal Carcinoom (HNPCC) Bewezen Lynch

Nadere informatie

Chapter 10. Nederlandse samenvatting

Chapter 10. Nederlandse samenvatting Nederlandse samenvatting Hereditair Nonpolyposis Colorectaal Carcinoom, afgekort als (HNPCC), ook wel Lynch syndroom genoemd, is een autosomaal dominante erfelijke aandoening met een hoge penetrantie (80-85%),

Nadere informatie

Eind goed, al goed? Of ook nog erfelijkheidsonderzoek? Margreet Ausems Afdeling Medische Genetica UMCU

Eind goed, al goed? Of ook nog erfelijkheidsonderzoek? Margreet Ausems Afdeling Medische Genetica UMCU Eind goed, al goed? Of ook nog erfelijkheidsonderzoek? Margreet Ausems Afdeling Medische Genetica UMCU Darmkanker in de familie? familie anamnese negatief: 85% -sporadische vorm- familie anamnese positief:

Nadere informatie

Nederlandse samenvatting

Nederlandse samenvatting Dikkedarmkanker is na longkanker de meest voorkomende doodsoorzaak ten gevolge van kanker in de westerse wereld. Dikkedarmkanker manifesteert zich na een accumulatie van verscheidene genetische veranderingen.

Nadere informatie

GENETISCHE COUNSELING SYLVIA DE NOBELE, GENETISCH COUNSELOR CENTRUM MEDISCHE GENETICA, UZGENT (CMGG) FAPA 19/11/2016

GENETISCHE COUNSELING SYLVIA DE NOBELE, GENETISCH COUNSELOR CENTRUM MEDISCHE GENETICA, UZGENT (CMGG) FAPA 19/11/2016 GENETISCHE COUNSELING SYLVIA DE NOBELE, GENETISCH COUNSELOR CENTRUM MEDISCHE GENETICA, UZGENT (CMGG) FAPA 19/11/2016 INHOUD 1. Erfelijke dikkedarmkanker 2. Betrokken genen en overerving 3. DNA, chromosomen

Nadere informatie

Genetic Counseling en Kanker

Genetic Counseling en Kanker Genetic Counseling en Kanker (erfelijke en familiaire kanker in de praktijk) dr Rolf Sijmons, klinisch geneticus afdeling Genetica UMC Groningen (Theoretische en) Practische aspecten Erfelijke Kanker Counseling

Nadere informatie

Nederlandse Samenvatting

Nederlandse Samenvatting 11 Nederlandse Samenvatting 113 Chapter 11 Dikke darmkanker (colorectaal carcinoom, CRC) is een veelvoorkomend gezwel in de westerse wereld en is na longkanker de belangrijkste oorzaak van sterfte aan

Nadere informatie

Darmkanker en het bevolkingsonderzoek (en klein stukje erfelijkheid)

Darmkanker en het bevolkingsonderzoek (en klein stukje erfelijkheid) Darmkanker en het bevolkingsonderzoek (en klein stukje erfelijkheid) Huisartsen nascholing en GIO-keten Marleen de Leest (MDL-arts), Arnhem, 28 mei 2013 Marcel Spanier (MDL-arts), Zevenaar, 11 juni 2013

Nadere informatie

Erfelijkheid & kanker. Titia Brouwer Maatschappelijk werker Afdeling Genetica 11 april 2016

Erfelijkheid & kanker. Titia Brouwer Maatschappelijk werker Afdeling Genetica 11 april 2016 Erfelijkheid & kanker Titia Brouwer Maatschappelijk werker Afdeling Genetica 11 april 2016 Erfelijkheidsonderzoek wegwijzer voor de praktijk Historie van de genetica Mendel 1822-1884 DNA, Watson & Crick,

Nadere informatie

Erfelijkheid & kanker. Titia Brouwer Maatschappelijk werker Afdeling Genetica 13 maart 2017

Erfelijkheid & kanker. Titia Brouwer Maatschappelijk werker Afdeling Genetica 13 maart 2017 Erfelijkheid & kanker Titia Brouwer Maatschappelijk werker Afdeling Genetica 13 maart 2017 Erfelijkheidsonderzoek wegwijzer voor de praktijk Historie van de genetica Mendel 1822-1884 DNA, Watson & Crick,

Nadere informatie

Uitnodiging. 6e Up-to-date. 25 jaar Lynch Syndroom. Oncologische themadag 7 december 2017, 9.15 uur Radboudumc, Nijmegen

Uitnodiging. 6e Up-to-date. 25 jaar Lynch Syndroom. Oncologische themadag 7 december 2017, 9.15 uur Radboudumc, Nijmegen Uitnodiging 6e Up-to-date 25 jaar Lynch Syndroom Oncologische themadag 7 december 2017, 9.15 uur Radboudumc, Nijmegen Toelichting 6e Up-to-date in erfelijke kanker: 25 jaar Lynch Syndroom Wat is er in

Nadere informatie

Erfelijkheidsonderzoek anno 2015. Lizet van der Kolk klinisch geneticus 11-06-2015

Erfelijkheidsonderzoek anno 2015. Lizet van der Kolk klinisch geneticus 11-06-2015 Erfelijkheidsonderzoek anno 2015 Lizet van der Kolk klinisch geneticus 11-06-2015 Erfelijkheidsonderzoek Bij wie, hoe en waarom? Consequenties en belang voor patiënt(e) en familieleden Nieuwe ontwikkelingen

Nadere informatie

Erfelijkheidsonderzoek bij ovariumcarcinoom. - terugkoppeling en vooruitblik -

Erfelijkheidsonderzoek bij ovariumcarcinoom. - terugkoppeling en vooruitblik - Klinische Genetica Vooraanstaand in erfelijkheidsvraagstukken Erfelijkheidsonderzoek bij ovariumcarcinoom - terugkoppeling en vooruitblik - Margriet Collée, klinisch geneticus j.collee@erasmusmc.nl (potentiële)

Nadere informatie

CONCEPT Richtlijn Erfelijke Darmkanker Revisie 2015

CONCEPT Richtlijn Erfelijke Darmkanker Revisie 2015 CONCEPT Richtlijn Erfelijke Darmkanker Revisie 2015 Conceptversie december 2014 Concept richtlijn Erfelijke darmkanker december 2014 1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25

Nadere informatie

10. Nederlandse samenvatting

10. Nederlandse samenvatting . Nederlandse samenvatting Nederlandse samenvatting 227 Dit proefschrift onderzoekt de klinische en pathologische eigenschappen van kanker van het spijsverteringskanaal bij overlevenden van Hodgkin lymfoom.

Nadere informatie

Mee-naar-huis-neem boodschappen 2014

Mee-naar-huis-neem boodschappen 2014 COIG cursusdag klinische genetica in de interne geneeskunde Mee-naar-huis-neem boodschappen 2014 Hes Bredenoord Bongers & Deegens Helderman-van der Enden & Rennenberg Meijers-Heijboer & Hoogerbrugge van

Nadere informatie

Indeling voordracht. Epidemiologie coloncarcinoom. Klinisch beeld. Erfelijk coloncarcinoom. Polyposis syndromen. HNPCC Lynch syndroom

Indeling voordracht. Epidemiologie coloncarcinoom. Klinisch beeld. Erfelijk coloncarcinoom. Polyposis syndromen. HNPCC Lynch syndroom VMDLV Coloncarcinoom; voorkomen is beter dan genezen 7 oktober 2005 Koningshof, Veldhoven Fokko M Nagengast, MDL-arts Afdeling MDL-ziekten UMCN Nijmegen Indeling voordracht Epidemiologie coloncarcinoom

Nadere informatie

Workshop DNA-schade. Erfelijkheidsonderzoek bij borstkanker: met welk doel? Dr. Jan C. Oosterwijk klinisch geneticus, UMCGroningen

Workshop DNA-schade. Erfelijkheidsonderzoek bij borstkanker: met welk doel? Dr. Jan C. Oosterwijk klinisch geneticus, UMCGroningen Workshop DNA-schade Erfelijkheidsonderzoek bij borstkanker: met welk doel? Dr. Jan C. Oosterwijk klinisch geneticus, UMCGroningen Erfelijkheidsonderzoek ging over Down syndroom, Duchenne spierdystrofie,

Nadere informatie

Samenvatting. Chapter 7.2

Samenvatting. Chapter 7.2 Samenvatting Chapter 7.2 Samenvatting In mijn proefschrift geef ik een overzicht van het Li-Fraumeni syndroom in Nederland, zowel klinisch als moleculair. Het belangrijkste doel van mijn studie was om

Nadere informatie

Mammacarcinoom en erfelijkheid. Dr. Marleen Kets, klinisch geneticus Afdeling genetica UMC St Radboud

Mammacarcinoom en erfelijkheid. Dr. Marleen Kets, klinisch geneticus Afdeling genetica UMC St Radboud Mammacarcinoom en erfelijkheid Dr. Marleen Kets, klinisch geneticus Afdeling genetica UMC St Radboud Mammacarcinoom Life time risk 12-13% Meest voorkomende kanker bij vrouwen Circa 20% hiervan heeft een

Nadere informatie

Richtlijn Erfelijke darmkanker 2007

Richtlijn Erfelijke darmkanker 2007 Concept Richtlijn Erfelijke darmkanker 2007 versie 7 1 november 2007 1 Opgesteld en geautoriseerd door: Vereniging Klinische Genetica Nederland In samenwerking met: Georganiseerd Landelijk Overleg van

Nadere informatie

Lynch Syndroom. Infobrochure voor patiënten en hun familie

Lynch Syndroom. Infobrochure voor patiënten en hun familie Lynch Syndroom Infobrochure voor patiënten en hun familie Inhoudstafel Inleiding... 3 Dikkedarmkanker... 4 Erfelijke dikkedarmkanker: Lynch syndroom... 5 Risico op kanker bij Lynch syndroom... 6 Het ontstaan

Nadere informatie

Familiair coloncarcinoom

Familiair coloncarcinoom Familiair coloncarcinoom Dit is een uitgave van het Flevoziekenhuis i.s.m. Zorggroep Almere Afdeling Maag-, Darm en Leverziekten Maart 2013 Inleiding Geachte collega, Voor u ligt de folder ter ondersteuning

Nadere informatie

Gebruik van prognostische en predictieve factoren bij de behandeling van het colorectaal carcinoom GIOCA congres 2017

Gebruik van prognostische en predictieve factoren bij de behandeling van het colorectaal carcinoom GIOCA congres 2017 Gebruik van prognostische en predictieve factoren bij de behandeling van het colorectaal carcinoom GIOCA congres 2017 Prof.dr. Kees Punt afd. Medische Oncologie AMC Amsterdam Colorectaal carcinoom Vroeger

Nadere informatie

Moleculaire Diagnostiek in de Pathologie

Moleculaire Diagnostiek in de Pathologie Moleculaire Diagnostiek in de Pathologie Informatiebrochure Afdeling Pathologie VU medisch centrum Amsterdam Inhoudsopgave Pagina Inleiding 3 Indicatiegebieden en bijbehorende Moleculaire Diagnostiek:

Nadere informatie

Kanker in de familie.

Kanker in de familie. Inhoud workshop Kanker in de familie. Dr. Margreet Ausems klinisch geneticus UMCU Introductie Verwachtingen deelnemers Achtergrondinformatie (cijfers!) Hoe ontstaat kanker? Erfelijke kanker en erfelijkheidsonderzoek

Nadere informatie

Mee-naar-huis-neem boodschappen 2013

Mee-naar-huis-neem boodschappen 2013 COIG cursusdag klinische genetica in de interne geneeskunde Mee-naar-huis-neem boodschappen 2013 Bredenoord, Deegens, Helderman-van der Enden, Hes, Knoers, Menko, Rennenberg, van Tintelen, Vasen, Wilde

Nadere informatie

NGS testen in de neuro-oncologie uitdagingen en (on)mogelijkheden

NGS testen in de neuro-oncologie uitdagingen en (on)mogelijkheden NGS testen in de neuro-oncologie uitdagingen en (on)mogelijkheden Erik Jan Dubbink Klinisch Moleculair Bioloog in de Pathologie Department of Pathology Erasmus MC, Rotterdam h.dubbink@erasmusmc.nl 9e Bijeenkomst

Nadere informatie

NIPT. Nascholing Counseling NIPT

NIPT. Nascholing Counseling NIPT NIPT Dr. Diane Van Opstal, Laboratoriumspecialist Klinische Genetica, Erasmus MC Dr. Maarten Knapen, gynaecoloog-perinatoloog Erasmus MC en medisch directeur SPSZN Nascholing Counseling NIPT Disclosure

Nadere informatie

BRCA diagnostiek en PARP inhibitoren

BRCA diagnostiek en PARP inhibitoren BRCA diagnostiek en PARP inhibitoren Ovariumcarcinoom Hooggradig sereus ovariumcarcinoom (HGSOC) Ongeveer 50% vertoont een defect in een gen betrokken bij homologe recombinatie gemedieerde DNA reparatie

Nadere informatie

Deze folder bevat informatie over het Lynch-syndroom. Het beschrijft:

Deze folder bevat informatie over het Lynch-syndroom. Het beschrijft: Lynch-syndroom Deze folder bevat informatie over het Lynch-syndroom. Het beschrijft: Wat Lynch-syndroom is. Hoe het Lynch-syndroom te herkennen is. Wat te doen als het Lynch-syndroom is vastgesteld. Wat

Nadere informatie

Nederlandse samenvatting

Nederlandse samenvatting 136 Melanoom van de huid is kanker die uitgaat van de pigmentcellen in de huid. Melanoom bij twee of meer eerstegraads verwanten of drie tweedegraads verwanten noemen we erfelijk. Als deze vorm van kanker

Nadere informatie

NIPT. K. Huijsdens Labspecialist klinische genetica, AMC. Nascholing Counseling NIPT

NIPT. K. Huijsdens Labspecialist klinische genetica, AMC. Nascholing Counseling NIPT NIPT K. Huijsdens Labspecialist klinische genetica, AMC Nascholing Counseling NIPT Disclosure belangen sprekers (potentiële) belangenverstrengeling Geen / zie hieronder Voor bijeenkomst mogelijk relevante

Nadere informatie

Herkennen van erfelijke kanker: nieuwe eenvoudige verwijscriteria voor solide vormen van kanker

Herkennen van erfelijke kanker: nieuwe eenvoudige verwijscriteria voor solide vormen van kanker Herkennen van erfelijke kanker: nieuwe eenvoudige verwijscriteria voor solide vormen van kanker Recognizing hereditary cancer: new simple referral criteria for solid cancers Auteur Trefwoorden Key words

Nadere informatie

NEDERLANDSE SAMENVATTING

NEDERLANDSE SAMENVATTING NEDERLANDSE SAMENVATTING Analyse van chromosomale afwijkingen in gastrointestinale tumoren In het ontstaan van kanker spelen vele moleculaire processen een rol. Deze processen worden in gang gezet door

Nadere informatie

Voorbij het 1000$ Genoom van diagnostiek naar screening

Voorbij het 1000$ Genoom van diagnostiek naar screening Voorbij het 1000$ Genoom van diagnostiek naar screening Rolf Sijmons Afdeling Genetica Op weg naar het 1000$ Genoom Een gen codeert voor 1 of (meestal) meerdere eiwitten Al ons DNA samen is ons GENOOM

Nadere informatie

Molecular aspects of HNPCC and identification of mutation carriers Niessen, Renee

Molecular aspects of HNPCC and identification of mutation carriers Niessen, Renee Molecular aspects of HNPCC and identification of mutation carriers Niessen, Renee IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please

Nadere informatie

Een zeldzame genetische diagnose, en dan..?

Een zeldzame genetische diagnose, en dan..? Een zeldzame genetische diagnose, en dan..? Antwerpen, 29 januari 2016 Esther Bakker-van Gijssel, AVG Tjitske Kleefstra, klinisch geneticus Afdeling Eerstelijnsgeneeskunde Afdeling Genetica Geneeskunde

Nadere informatie

NEDERLANDSE SAMENVATTING

NEDERLANDSE SAMENVATTING NEDERLANDSE SAMENVATTING ACHTERGROND Klinische aspecten van dikke darmkanker Dikke darmkanker is een van de meest voorkomende vormen van kanker in de westerse wereld. Als we kijken naar aan kanker gerelateerde

Nadere informatie

Het bi-allelisch Lynch syndroom

Het bi-allelisch Lynch syndroom Het bi-allelisch Lynch syndroom Wat is het bi-allelisch Lynch syndroom? Het biallelisch Lynch syndroom is een erfelijke ziekte veroorzaakt door twee foutjes in het erfelijk materiaal waardoor kinderen

Nadere informatie

Dr. Jan C. Oosterwijk. Nieuwe getallen en nieuwe diagnostiek bij erfelijke borstkanker

Dr. Jan C. Oosterwijk. Nieuwe getallen en nieuwe diagnostiek bij erfelijke borstkanker Dr. Jan C. Oosterwijk klinisch geneticus, UMCG Nieuwe getallen en nieuwe diagnostiek bij erfelijke borstkanker Disclosure belangen spreker geen geen geen Overzicht Nog even de verwijscriteria Risicogetallen

Nadere informatie

CHAPTER 11. Nederlandse samenvatting. Curriculum vitae. List of additional publications

CHAPTER 11. Nederlandse samenvatting. Curriculum vitae. List of additional publications CHAPTER 11 Nederlandse samenvatting Curriculum vitae List of additional publications Nederlandse samenvatting Dikke darmkanker (colorectaal carcinoom, CRC) is de op een na meest voorkomende doodsoorzaak

Nadere informatie

Moleculaire Diagnostiek binnen een routine Pathologie Laboratorium

Moleculaire Diagnostiek binnen een routine Pathologie Laboratorium Moleculaire Diagnostiek binnen een routine Pathologie Laboratorium Winand N.M. Dinjens Laboratorium voor Moleculaire Diagnostiek Afdeling Pathologie Josephine Nefkens Instituut (JNI) Erasmus MC, Universitair

Nadere informatie

Detectie van chromosomale imbalances mbv Next Generation Sequencing (NGS)

Detectie van chromosomale imbalances mbv Next Generation Sequencing (NGS) Detectie van chromosomale imbalances mbv Next Generation Sequencing (NGS) Winand Dinjens, KMBP Afdeling Pathologie Laboratorium voor Moleculaire Diagnostiek w.dinjens@erasmusmc.nl Week van de Pathologie

Nadere informatie

3 e Up-to-date in erfelijke kanker. 14 maart 2013. Is het erfelijk? Oncologische themadag

3 e Up-to-date in erfelijke kanker. 14 maart 2013. Is het erfelijk? Oncologische themadag Oncologische themadag Is het erfelijk? Ewout Boesaard student 3 e Up-to-date in erfelijke kanker 14 maart 2013 Aanvang: 13.30 uur Locatie: Auditorium (route 296) UMC St Radboud Nijmegen De tijd staat niet

Nadere informatie

Samenvatting van dr. J.J. Koornstra (maag-darm-leverarts) en prof. dr. R.M.W.Hofstra

Samenvatting van dr. J.J. Koornstra (maag-darm-leverarts) en prof. dr. R.M.W.Hofstra Medische Publieksacademie UMCG Thema: Dikkedarmkanker Samenvatting van dr. J.J. Koornstra (maag-darm-leverarts) en prof. dr. R.M.W.Hofstra (moleculair geneticus). Dikkedarmkanker is één van de meest voorkomende

Nadere informatie

Professionele Bachelor Agro- en Biotechnologie Biotechnologie

Professionele Bachelor Agro- en Biotechnologie Biotechnologie Professionele Bachelor Agro- en Biotechnologie Biotechnologie Glioblastomen onder de loep: MGMT-promotor hypermethylering Promotoren: Prof. Dr. E.J. Speel Ing. G.M.J.M Roemen Dr. ir. I. Smets. academisch

Nadere informatie

BRCA themamiddag, zaterdag 31 oktober 2015. UMCG expertisecentrum borst - eierstokkanker. Welkom

BRCA themamiddag, zaterdag 31 oktober 2015. UMCG expertisecentrum borst - eierstokkanker. Welkom BRCA themamiddag, zaterdag 31 oktober 2015 UMCG expertisecentrum borst - eierstokkanker Welkom BRCA themamiddag, zaterdag 31 oktober 2015 UMCG expertisecentrum borst - eierstokkanker Welkom, namens de

Nadere informatie

Genetische counseling Dementie

Genetische counseling Dementie Genetische counseling Dementie Desiderius Erasmus Alois Alzheimer Erfelijkheid en Dementie Genen in Alzheimer en Frontotemporale Dementie Genetische counseling : waarom, wie, wat, wanneer, hoe? Welk nut

Nadere informatie

Gastro-intestinale stromacel tumor: Risico classificatie en mutatie analyse door de patholoog. Dr. Judith V.M.G. Bovee Patholoog LUMC

Gastro-intestinale stromacel tumor: Risico classificatie en mutatie analyse door de patholoog. Dr. Judith V.M.G. Bovee Patholoog LUMC Gastro-intestinale stromacel tumor: Risico classificatie en mutatie analyse door de patholoog Dr. Judith V.M.G. Bovee Patholoog LUMC GastroIntestinale Stromacel Tumor 11-15 GISTen per 100.000 mensen (Scandinavië)

Nadere informatie

Voor akkoord verklaring

Voor akkoord verklaring Voor akkoord verklaring Dit eindwerk is een examen; eventuele fouten die worden vastgesteld tijdens de eindwerkverdediging of erna worden niet gecorrigeerd. Het gebruik als referentie in publicaties is

Nadere informatie

Van gen tot genoom en daarbuiten: recente revoluties in genetisch onderzoek

Van gen tot genoom en daarbuiten: recente revoluties in genetisch onderzoek Van gen tot genoom en daarbuiten: recente revoluties in genetisch onderzoek Anne Herkert, klinisch geneticus Jan Jongbloed, moleculair geneticus Landelijke dag erfelijke hartziekten 29 oktober 2016 Erfelijkheid

Nadere informatie

Prof.dr. Epie Boven Medisch oncoloog

Prof.dr. Epie Boven Medisch oncoloog Prof.dr. Epie Boven Medisch oncoloog Nieuwe antikanker medicijnen, hoge kosten Waarom ontsporen cellen in ons lichaam? De normale cel bevat 46 chromosomen, ook wel DNA genoemd - het DNA vormt ons genetisch

Nadere informatie

Zit t nou in de familie of in de genen?

Zit t nou in de familie of in de genen? Zit t nou in de familie of in de genen? klinisch genetische introductie 3 e congres werkgroep erfelijke borst- en eierstokkanker BVN Nieuwegein,18 april 2009 Dr. Jan C. Oosterwijk klinisch geneticus, UMCGroningen

Nadere informatie

Juvenile polyposis : aspects of molecular genetics and histology on the pathogenesis of a precancerous syndrome van Hattem, W.A.

Juvenile polyposis : aspects of molecular genetics and histology on the pathogenesis of a precancerous syndrome van Hattem, W.A. UvA-DARE (Digital Academic Repository) Juvenile polyposis : aspects of molecular genetics and histology on the pathogenesis of a precancerous syndrome van Hattem, W.A. Link to publication Citation for

Nadere informatie

Patiënten Informatie Brochure Erfelijkheidsonderzoek: Exoom Sequencing

Patiënten Informatie Brochure Erfelijkheidsonderzoek: Exoom Sequencing 2 Patiënten Informatie Brochure Erfelijkheidsonderzoek: Exoom Sequencing Algemene informatie Exoom Sequencing is een nieuwe techniek voor erfelijkheidsonderzoek. In deze folder vindt u informatie over

Nadere informatie

FAP (Familiale adenomateuse polyposis)

FAP (Familiale adenomateuse polyposis) FAP (Familiale adenomateuse polyposis) Kenmerken Familiale Adenomateuse Polyposis (FAP) wordt gekenmerkt door het vóórkomen van honderden tot duizenden poliepen in de dikke darm (colon en rectum). De eerste

Nadere informatie

Brochure ExomeScan. Whole Exome Sequencing. Achtergrond

Brochure ExomeScan. Whole Exome Sequencing. Achtergrond Brochure Whole Exome Sequencing De laatste jaren is er een schat aan informatie gepubliceerd over de genetische achtergrond van overerfbare en somatische aandoeningen. In grootschalige Next Generation

Nadere informatie

Molecular Pathology for Pathologists. Pr P. Pauwels

Molecular Pathology for Pathologists. Pr P. Pauwels Molecular Pathology for Pathologists Pr P. Pauwels NGS moleculair pathologie rapport ontcijferen Nomenclatuur waarin gerapporteerd wordt: EGFR c.2573t>g, p.(leu858arg) Coderende sequentie Eiwit/proteïne

Nadere informatie

Kanker en Erfelijkheid

Kanker en Erfelijkheid Kanker en Erfelijkheid Em. Prof. dr. Joep Geraedts Gezondheidsuniversiteit Maastricht 3 december 2014 Borstkanker Kans op borstkanker afhankelijk van leeftijd waarop puberteit begint Jaarlijks bij ongeveer

Nadere informatie

Oncogenese. Sporadische kankers (> 90%) Familiale kankersyndromen (kleine groep)

Oncogenese. Sporadische kankers (> 90%) Familiale kankersyndromen (kleine groep) Oncogenese Sporadische kankers (> 90%) accumulatie van verworven mutaties, onder invloed van externe factoren Familiale kankersyndromen (kleine groep) overerfbare mutatie in 1 gen accumulatie van genetische

Nadere informatie

Conceptrichtlijn Erfelijke darmkanker

Conceptrichtlijn Erfelijke darmkanker Conceptrichtlijn Erfelijke darmkanker versie 5 14 mei 2007 1 Opgesteld en geautoriseerd door: Vereniging Klinische Genetica Nederland In samenwerking met: Georganiseerd Landelijk Overleg van Begeleiders

Nadere informatie

Onderzoeksgroep Neurodegeneratieve Hersenziekten

Onderzoeksgroep Neurodegeneratieve Hersenziekten WETENSCHAPPELIJK ONDERZOEK NAAR DE ROL VAN GENETICA IN JONGDEMENTIE: FAMILIES, MUTATIES EN GENETISCHE TESTEN. Christine Van Broeckhoven Neurodegeneratieve Hersenziekten Groep, Department Moleculaire Genetica,

Nadere informatie

NEDERLANDSE SAMENVATTING

NEDERLANDSE SAMENVATTING Chapter 6 NEDERLANDSE SAMENVATTING 316 Inleiding Darmkanker en darmpoliepen In Nederland wordt elk jaar bij ongeveer 11.000 mensen de diagnose darmkanker gesteld. Meestal is dit op oudere leeftijd (na

Nadere informatie

Diagnose en therapie. Prof dr Martin J van den Bent Neuroloog

Diagnose en therapie. Prof dr Martin J van den Bent Neuroloog Diagnose en therapie Prof dr Martin J van den Bent Neuroloog Hersentumoren: soorten en maten Verschillende tumoren, sterk verschillende uitkomsten - Meningeomen: doorgaans goedaardige hersentumoren, uitgaande

Nadere informatie

Mee-naar-huis-neem boodschappen 2015

Mee-naar-huis-neem boodschappen 2015 COIG cursusdag klinische genetica in de interne geneeskunde Mee-naar-huis-neem boodschappen 2015 Hes Bredenoord Bongers & Deegens Helderman-van der Enden & Rennenberg Hoedemaekers & Postema Menko en Smorenburg

Nadere informatie

Informatie voor de huisarts over. het Lynch syndroom (HNPCC)

Informatie voor de huisarts over. het Lynch syndroom (HNPCC) Informatie voor de huisarts over het Algemene aandachtspunten bij de begeleiding van patiënten met zeldzame ziekten Afhankelijk van het ziektebeeld kunnen bepaalde aandachtspunten in het overzicht niet

Nadere informatie

Analyse en behandeling bij verdenking op maligniteit bij de oudste ouderen

Analyse en behandeling bij verdenking op maligniteit bij de oudste ouderen Dr. M.E. Hamaker Klinisch geriater mhamaker@diakhuis.nl Analyse en behandeling bij verdenking op maligniteit bij de oudste ouderen Disclosure belangen spreker (potentiële) belangenverstrengeling Voor bijeenkomst

Nadere informatie

Molecular genetic alterations in gastrointestinal polyposis syndromes: with emphasis on the Peutz-Jeghers syndrome Entius, M.M.

Molecular genetic alterations in gastrointestinal polyposis syndromes: with emphasis on the Peutz-Jeghers syndrome Entius, M.M. UvA-DARE (Digital Academic Repository) Molecular genetic alterations in gastrointestinal polyposis syndromes: with emphasis on the Peutz-Jeghers syndrome Entius, M.M. Link to publication Citation for published

Nadere informatie

hoofdstuk 2 hoofdstuk 3

hoofdstuk 2 hoofdstuk 3 Samenvatting Hereditair nonpolyposis colorectaal carcinoom (HNPCC) is een relatief vaak voorkomend kanker-syndroom. Het wordt gekenmerkt door de ontwikkeling van kwaadaardige laesies in verschillende organen,

Nadere informatie

Cover Page. The handle http://hdl.handle.net/1887/18632 holds various files of this Leiden University dissertation.

Cover Page. The handle http://hdl.handle.net/1887/18632 holds various files of this Leiden University dissertation. Cover Page The handle http://hdl.handle.net/1887/18632 holds various files of this Leiden University dissertation. Author: Joosse, Simon Andreas Title: Prediction of "BRCAness" in breast cancer by array

Nadere informatie

2.1 Ovariumcarcinoom H2 EPIDEMIOLOGIE EN ETIOLOGIE

2.1 Ovariumcarcinoom H2 EPIDEMIOLOGIE EN ETIOLOGIE 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 H2 EPIDEMIOLOGIE EN ETIOLOGIE

Nadere informatie

Wie zijn SCEN-artsen? Bregje Onwuteaka-Philipsen Isis van Gennip Roeline Pasman

Wie zijn SCEN-artsen? Bregje Onwuteaka-Philipsen Isis van Gennip Roeline Pasman Wie zijn SCEN-artsen? Bregje Onwuteaka-Philipsen Isis van Gennip Roeline Pasman Disclosure belangen spreker (potentiële) belangenverstrengeling Voor bijeenkomst mogelijk relevante relaties met bedrijven

Nadere informatie

CARDIOGENETICA. Marja van Brug, Verpleegkundig Specialist CNE Hartfalen 29 oktober 2013

CARDIOGENETICA. Marja van Brug, Verpleegkundig Specialist CNE Hartfalen 29 oktober 2013 CARDIOGENETICA Marja van Brug, Verpleegkundig Specialist CNE Hartfalen 29 oktober 2013 Inhoud Polikliniek Cardiogenetica DNA en mutaties Erfelijkheid en gedilateerde cardiomyopathie Taken Verpleegkundig

Nadere informatie

Genetische testen. Professor Martina Cornel and Professor Heather Skirton Gen-Equip Project.

Genetische testen. Professor Martina Cornel and Professor Heather Skirton Gen-Equip Project. Genetische testen Professor Martina Cornel and Professor Heather Skirton Gen-Equip Project. Inzicht krijgen in genetische testen en testresultaten Inhoud Wat is genetisch testen? Klinische toepassingen

Nadere informatie

Wat verandert er in de counseling?

Wat verandert er in de counseling? Wat verandert er in de counseling? [NAAM SPREKER] Nascholing counseling NIPT Disclosure belangen sprekers (potentiële) belangenverstrengeling Geen / zie hieronder Voor bijeenkomst mogelijk relevante relaties

Nadere informatie

SKML rondzending FISH MYC, BCL2 en BCL6 translocatie detectie (2016.2)

SKML rondzending FISH MYC, BCL2 en BCL6 translocatie detectie (2016.2) SKML rondzending FISH MYC, BCL2 en BCL6 translocatie detectie (2016.2) Elise van der Logt Week van de pathologie Workshop Hematologie 28-03-2017 Disclosure belangen spreker (potentiële) belangenverstrengeling

Nadere informatie

Stichting Lynch - Polyposis. Strategisch beleidsplan 2014-2018. 1. Inleiding

Stichting Lynch - Polyposis. Strategisch beleidsplan 2014-2018. 1. Inleiding Stichting Lynch - Polyposis Strategisch beleidsplan 2014-2018 1. Inleiding In de in 2013 opgestelde statuten van de stichting Lynch-Polyposis, waarin Vereniging HNPCC-Lynch en stichting PPC zijn opgegaan,

Nadere informatie

PD-L1 staining: een echte biomarker?

PD-L1 staining: een echte biomarker? PD-L1 staining: een echte biomarker? 10e NVMO Nascholing Targeted Therapy Donderdag 21 april 2016 Antropia, Driebergen Stefan M. Willems MD PhD Dept Pathology UMC Utrecht, Utrecht, The Netherlands Dept

Nadere informatie

Cardiologisch onderzoek

Cardiologisch onderzoek Het lange QT-syndroom Het lange QT-syndroom (LQTS) is een erfelijke aandoening waarbij de elektrische functie van het hart is verstoord. Hierdoor is er een verhoogd risico op hartritmestoornissen. Het

Nadere informatie

Voorkomende nierziekte waarbij een deel van patiënten een erfelijke vorm hebben: - nefrotisch syndroom

Voorkomende nierziekte waarbij een deel van patiënten een erfelijke vorm hebben: - nefrotisch syndroom Diagnostiek en advies inzake erfelijkheid bij erfelijke nierziekte Elena Levtchenko kinderarts-nefroloog 4 November 2006 Mogelijke situaties Voorkomende nierziekte waarbij een deel van patiënten een erfelijke

Nadere informatie

Brochure ExomeScan. Whole Exome Sequencing. Achtergrond

Brochure ExomeScan. Whole Exome Sequencing. Achtergrond Brochure Whole Exome Sequencing De laatste jaren is er een schat aan informatie gepubliceerd over de genetische achtergrond van overerfbare en somatische aandoeningen. In grootschalige Next Generation

Nadere informatie

demedisch Specialist Klinisch geneticus Eva Brilstra: Dit vak is dynamisch, booming en nooit saai

demedisch Specialist Klinisch geneticus Eva Brilstra: Dit vak is dynamisch, booming en nooit saai GATEN IN HET ROOSTER In de knel door individualisering opleiding DEAL! Geheimen van goed onderhandelen demedisch Specialist 1 ARTSEN OVER PAPIERWERK Lusten en lasten van registraties APRIL 2016 UITGAVE

Nadere informatie

Predictieve genetische tests

Predictieve genetische tests Predictieve genetische tests De ervaring bij de ziekte van Huntington Gerry Evers-Kiebooms (1) De genetica in de gezondheidszorg (2) Predictieve test voor de ziekte van Huntington (3) Predictief testen

Nadere informatie

Ziekte van von Hippel Lindau

Ziekte van von Hippel Lindau Ziekte van von Hippel Lindau Kenmerken De ziekte van von Hippel Lindau (VHL) is een zeldzame erfelijke aandoening die wordt gekenmerkt door goed- of kwaadaardige gezwellen (tumoren) op verschillende plaatsen

Nadere informatie

Disclosure belangen sprekers

Disclosure belangen sprekers Disclosure belangen sprekers Francien van Nederveen, patholoog PAL Dordrecht Mariette Schoofs, internist-endocrinoloog Albert Event, Albert Schweizer ziekenhuis, 19 maart 2014 (potentiële) belangenverstrengeling

Nadere informatie

MSI/ KRAS/ NRAS consequenties behandeling? Hanneke Wilmink Internist-oncoloog AMC

MSI/ KRAS/ NRAS consequenties behandeling? Hanneke Wilmink Internist-oncoloog AMC MSI/ KRAS/ NRAS consequenties behandeling? Hanneke Wilmink Internist-oncoloog AMC Casus 1 74-jarige man, stadium II (T3N0M0) sigmoid carcinoom, nu 30 dagen na laparoscopische sigmoid resectie, MSS tumor,

Nadere informatie

Next Generation Sequencing: meer met minder

Next Generation Sequencing: meer met minder Next Generation Sequencing: meer met minder Robert van der Geize Klinisch Moleculair Bioloog in de Pathologie (KMBP) Xs2HiTek-workshop 'Diagnostiek in de Pathologie' 2015 www.labpon.nl Boerhaavelaan 59

Nadere informatie

Oncogenetica. bij zeldzame aandoeningen. Mei 2013. Generiek zorgthema ten behoeve van zorgstandaarden voor zeldzame aandoeningen

Oncogenetica. bij zeldzame aandoeningen. Mei 2013. Generiek zorgthema ten behoeve van zorgstandaarden voor zeldzame aandoeningen Oncogenetica bij zeldzame aandoeningen Mei 2013 Generiek zorgthema ten behoeve van zorgstandaarden voor zeldzame aandoeningen Auteur: Drs. S.A. Hendriks, VSOP Met adviezen en bijdragen van: Dr. F. J. Hes,

Nadere informatie

(MAP) Informatie over het ziektebeeld

(MAP) Informatie over het ziektebeeld MUTYH-geassocieerde polyposis (MAP) Informatie over het ziektebeeld Wat is MAP? Polyposis coli is een erfelijke aandoening die wordt D gekenmerkt door de ontwikkeling van poliepen in de dikke darm. De

Nadere informatie

Hoe ervaren we ISO15189 accreditatie? Stand van zaken.

Hoe ervaren we ISO15189 accreditatie? Stand van zaken. Hoe ervaren we ISO15189 accreditatie? Stand van zaken. Disclosure belangen spreker (potentiële) belangenverstrengeling Voor bijeenkomst mogelijk relevante relaties met bedrijven Sponsoring of onderzoeksgeld

Nadere informatie