Moleculaire Diagnostiek binnen een routine Pathologie Laboratorium

Maat: px
Weergave met pagina beginnen:

Download "Moleculaire Diagnostiek binnen een routine Pathologie Laboratorium"

Transcriptie

1 Moleculaire Diagnostiek binnen een routine Pathologie Laboratorium Winand N.M. Dinjens Laboratorium voor Moleculaire Diagnostiek Afdeling Pathologie Josephine Nefkens Instituut (JNI) Erasmus MC, Universitair Medisch Centrum Rotterdam Hogeschool Rotterdam, 11 oktober 2011

2 DNA in de Cel chromosome cell nucleus Double stranded DNA molecule Individuele nucleotiden

3

4 Beschrijving (haploide) genoom: 3 x 10 9 basen In de celkern: haploide genoom = 3 x 10 9 baseparen Dus: haploide genoom = 6 x 10 9 basen Dus: diploide genoom = 12 x 10 9 basen 3 x 10 6 dubbelzijdige A4 (pts 12) = 150 meter

5 Kankerbiologie dogma: Kanker is een ziekte van het DNA Wordt veroorzaakt door afwijkingen (mutaties) in het DNA die leiden tot afwijkingen (afwezigheid, inactivatie, overexpressie of activatie) in eiwitten.

6 GEN (DNA) mrna Eiwit

7 * * * gemuteerd gen (DNA) gemuteerd mrna gemuteerd Eiwit

8 Karyogram van normale cellen van een man

9 Chromosomale instabilieit (CIN) Spectraal karyogram van een kankercel

10 Normale cel meerdere genetische veranderingen ongecontroleerde groei clonale expansie benigne tumor meerdere genetische veranderingen invasief en metastaserend maligne tumor

11 Proto-oncogenen oncogenen activatie Oncogenen (gereguleerd) (gedereguleerd) activatie celcyclus activatie celcyclus remming apoptose remming apoptose

12 Tumorsuppressorgenen inactivatie remming celcyclus remming geïnactiveerd stimuleren apoptose apoptose geremd

13 PROTO-ONCOGEN ONCOGEN ACTIVATIE EN TUMORSUPPRESSORGEN INACTIVATIE wildtype afwijking Tumor fenotype PROTO-ONCOGEN ONCOGEN ACTIVERENDE MUTATIE 1 activerende hit TUMOR SUPPRESSORGEN DELETIE OF INACTIVERENDE MUTATIE DELETIE OF INACTIVERENDE MUTATIE 2 inactiverende hits Knudson s 2 hit hypothesis

14 Tumoren: A: clonaal B: DNA afwijkingen C: activatie proto-oncogenen oncogenen D: inactivatie tumorsuppressorgenen

15 Clonaliteitsbepaling van meerdere tumoren binnen een patient

16 Tumorcellen onderscheiden zich van normale cellen door het voorkomen van afwijkingen in hun DNA Die DNA afwijkingen kunnen worden gebruikt als tumor-specifieke clonale markers

17 Vrouw 49 jaar: Mammatumor (T1) 35 maanden later tumor (T2) in lies lymfeklier Vraag: tumor in liesklier metastase mammatumor?

18 DNA isolatie: - normaal weefsel - mammatumor (T1) - liesklier tumor (T2) LOH-analyse

19 Mammatumor (T1)

20 Lymfeklier tumor (T2)

21 Laser Capture Microscopie microdissectie

22 DNA polymorfismen: In de natuur voorkomende variatie in de DNA volgorde binnen één soort

23 Polymorfismen Microsatelliet: CA/TG di-nucleotide repeat aatgccacacacacacacacacacacagggat ttacggtgtgt GTGTGTGTGTGTGTGTcccta Aantal CA: 19, 20, 21, 22, 23, 24 Frequentie: 0,1-0,3-0,1-0,2-0,05-0,25

24 Polymorfismen CA/TG di-nucleotide repeat: - Hoog polymorf ( ) - Frequent in het genoom ( > maal) - Geflankeerd door uniek DNA

25 Analyse van polymorfe microsatellieten om DNA afwijkingen te detecteren NORMAAL DNA p p Loss Of Heterozygosity (LOH) 14(a) 14(b) (CA)20 (CA)15 q CA(20) q CA(15) PCR amplificatie van normaal DNA 14(a) 14(b) Hoog-resolutie fragment scheiding Heterozygoot

26 Analyse van polymorfe microsatellieten om DNA afwijkingen te detecteren NORMAAL DNA p p Loss Of Heterozygosity (LOH) 14(a) 14(b) (CA)20 (CA)15 p TUMOR DNA p q PCR amplificatie van normaal en q q tumor DNA CA(20) CA(15) CA(20) 14(a) 14(b) Hoog-resolutie fragment scheiding 14(a) 14(b) NORMAAL Heterozygoot

27 Analyse van polymorfe microsatellieten om DNA afwijkingen te detecteren NORMAAL DNA p p Loss Of Heterozygosity (LOH) 14(a) 14(b) (CA)20 (CA)15 p TUMOR DNA p q PCR amplificatie van normaal en q q tumor DNA CA(20) CA(15) CA(20) 14(a) 14(b) Hoog-resolutie fragment scheiding 14(a) 14(b) NORMAAL TUMOR Heterozygoot LOSS LOH

28 D13S155 N T1 LOH - Upper T2 No - loss T1 # T2

29 D8S133 N T1 T2 No - loss LOH - Lower T1 # T2

30 D17S786 N T1 T2 LOH Lower LOH Upper T1 # T2

31 Resultaat: - Beide tumoren vertonen een verschillend LOH patroon Conclusie: - Lymfeklier metastase waarschijnlijk niet afkomstig van mammatumor

32 Patiënte opnieuw onderzocht: Ovariumtumor (T3) LOH analyse

33 Ovariumtumor (T3)

34 D13S155 N T1 LOH - Upper T2 No - Loss T3 No - Loss T2 = T3 # T1

35 D8S133 N T2 = T3 # T1 T1 T2 T3 No - Loss LOH - Lower LOH - Lower

36 D17S786 N T2 = T3 # T1 T1 T2 T3 LOH Lower LOH Upper LOH Upper

37 Resultaat: - Ovarium- (T3)) en liesklier tumor (T2( T2) identiek LOH patroon - Mammatumor (T1( T1) ) verschillend LOH patroon Conclusie: Lymfekliermetastase zeer waarschijnlijk afkomstig van ovariumtumor

38 Behandeling tumoren conventioneel: one size fits all : bij bepaald tumortype en stadium standaard behandeling (chemo-radiotherapie etc.)

39 PROTO-ONCOGEN ONCOGEN ACTIVATIE wildtype afwijking Tumor fenotype PROTO-ONCOGEN ONCOGEN ACTIVERENDE MUTATIE 1 activerende hit

40 Oncogene addiction : Tumorcel is verslaafd aan moleculaire afwijking(en) voor overleving en groei: Remming van (effect van) moleculaire afwijking leidt tot remming van de proliferatie en mogelijk tot dood van de tumorcellen.

41 Behandeling tumoren modern: personalized therapy : targeted therapy : patient-tailored therapy : therapie gebaseerd op moleculaire karakteristieken van de tumor (en de patiënt) pharmacogenetics : pharmacogenomics : Mamma carcinoom Her2/neu gen amplificatie Her2/neu eiwit over-expressie Herceptin/trastuzumab (anti-her2/neu) therapie response

42 Targeted therapieën Een nieuwe generatie meer selectieve kanker drugs

43 Behandeling tumoren modern:

44 EGFR Wildtype

45 EGFR-gen activerende mutatie

46 EGFR-gen activerende mutatie + TKI Targeted therapy

47 Targeted therapy in longkanker * Tyrosine Kinase Inhibitors (TKIs) beschikbaar die de Epidermal Growth Factor Receptor (EGFR) activatie remmen: Erlotinib en Gefitinib

48 EGFR (en KRAS) mutatie analyse in NSCLC dus van belang voor de behandeling met TKIs Gefitinib en Erlotinib

49 EGFR en KRAS mutatie analyse: DNA sequencing - DNA isolatie uit hoog percentage tumorcellen - manuele of laser microscoop dissectie - routine FFPE weefsel: resectie, biopt, cytologie blokje, ongekleurde coupes, gekleurde coupes - cytologie suspensie, ongekleurd, gekleurd preparaat

50 DNA isolatie uit rourine verkregen preparaten Paraffine blokje Paraffine coupe H&E gekleurde coupe Immuno gekleurde coupe (gekleurd) cytologiepreparaat)

51 Hoog % tumorcellen voor DNA isolatie: manuele of laser capture microscoop microdissectie

52 EGFR/KRAS analyse Op elke aanvraag worden de volgende bepalingen uitgevoerd: - EGFR-gen mutatie-analyse (exonen 18, 19, 20 en 21) - KRAS gen mutatie-analyse (codon 12 en 13)

53 EGFR-gen DNA sequentie analyse Wildtype Mutant TGC Cysteine TAC Tyrosine

54 Toekomst moleculaire diagnostiek NSCLC: Bepaald door het beschikbaar komen van andere addicted-oncogene remmers

55 Nabije toekomst moleculaire diagnostiek voor targeted therapies II Bepaald door het beschikbaar komen van andere addicted-oncogene remmers: - EML4-ALK fusie ALK inhibitor Crizotinib +/- 5% NSCLC, KRAS mutually exclusive - KRAS mutatie RAF-MEK-ERK signaaltransductie inhibitor Sorafinib, +/- 15% NSCLC - BRAF codon 600 mutatie inhibitor PLX4032/RG % melanomen

56 Dank voor uw aandacht

Gebruik van nieuwe technieken in de moleculaire pathologie. John Hinrichs, klinisch moleculair bioloog

Gebruik van nieuwe technieken in de moleculaire pathologie. John Hinrichs, klinisch moleculair bioloog Gebruik van nieuwe technieken in de moleculaire pathologie John Hinrichs, klinisch moleculair bioloog Gebruik van nieuwe technieken in de moleculaire pathologie 1. Introductie moleculaire pathologie 2.

Nadere informatie

Moleculaire revolutie in de pathologie: next generation sequencing

Moleculaire revolutie in de pathologie: next generation sequencing Moleculaire revolutie in de pathologie: next generation sequencing John Hinrichs, klinisch moleculair bioloog in de pathologie UMC Utrecht, afdeling pathologie De (moleculaire) pathologie maakt op dit

Nadere informatie

Pharmacogenomics: een uitdaging voor de Moleculaire Diagnostiek in de Pathologie

Pharmacogenomics: een uitdaging voor de Moleculaire Diagnostiek in de Pathologie Pharmacogenomics: een uitdaging voor de Moleculaire Diagnostiek in de Pathologie Winand Dinjens Afdeling Pathologie Josephine Nefkens Instituut Erasmus MC, Rotterdam w.dinjens@erasmusmc.nl Werkgroep Moleculaire

Nadere informatie

NEDERLANDSE SAMENVATTING

NEDERLANDSE SAMENVATTING 2 NEDERLANDSE SAMENVATTING VOOR NIET-INGEWIJDEN In gezonde personen is er een goede balans tussen cellen die delen en cellen die doodgaan. In sommige gevallen wordt deze balans verstoord en delen cellen

Nadere informatie

Rol van de pathologische anatomie in de oncologie. 16 maart 2013 Dr. Pascale De Paepe AZ St Jan Brugge-Oostende AV

Rol van de pathologische anatomie in de oncologie. 16 maart 2013 Dr. Pascale De Paepe AZ St Jan Brugge-Oostende AV Rol van de pathologische anatomie in de oncologie 16 maart 2013 Dr. Pascale De Paepe AZ St Jan Brugge-Oostende AV De oncologische patiënt Multidisciplinaire benadering: huisarts patholoog chirurg oncoloog

Nadere informatie

Basisbegrippen Oncologie

Basisbegrippen Oncologie Basisbegrippen Oncologie Tumor afmeting Diagnose periode Behandel periode Preventie/interventie periode Invasie interventie Tijd Detectie drempel Van normale naar kankercel Normale cel Van celkern naar

Nadere informatie

NGS testen in de neuro-oncologie uitdagingen en (on)mogelijkheden

NGS testen in de neuro-oncologie uitdagingen en (on)mogelijkheden NGS testen in de neuro-oncologie uitdagingen en (on)mogelijkheden Erik Jan Dubbink Klinisch Moleculair Bioloog in de Pathologie Department of Pathology Erasmus MC, Rotterdam h.dubbink@erasmusmc.nl 9e Bijeenkomst

Nadere informatie

Erfelijkheidsonderzoek bij ovariumcarcinoom. - terugkoppeling en vooruitblik -

Erfelijkheidsonderzoek bij ovariumcarcinoom. - terugkoppeling en vooruitblik - Klinische Genetica Vooraanstaand in erfelijkheidsvraagstukken Erfelijkheidsonderzoek bij ovariumcarcinoom - terugkoppeling en vooruitblik - Margriet Collée, klinisch geneticus j.collee@erasmusmc.nl (potentiële)

Nadere informatie

10 e Post O.N.S. Meeting. Ted Goossens Verpleegkundig specialist Oncologie SJG Weert

10 e Post O.N.S. Meeting. Ted Goossens Verpleegkundig specialist Oncologie SJG Weert 10 e Post O.N.S. Meeting Ted Goossens Verpleegkundig specialist Oncologie SJG Weert 1 BIOMARKERS, PERSONALISED MEDICINE EN (BIOBANKING) 2 Indeling: Definitie Geschiedenis Plaats in diagnostiek en therapie

Nadere informatie

178 Chapter 10. Samenvatting

178 Chapter 10. Samenvatting 178 Chapter 10 Samenvatting In Nederland staat kanker van de dikke- en endeldarm (colorectaal carcinoom) bij mannen op de derde plaats en bij vrouwen op de tweede plaats van de meest voorkomende tumoren.

Nadere informatie

BRAF rondzending SKML 2012

BRAF rondzending SKML 2012 BRAF rondzending SKML 2012 Presentatie van de resultaten op de deelnemersbijeenkomst 5 februari 2013 Riki Willems Patricia Groenen Willeke Blokx Adriaan van den Brule Casus 1 Langerhanscel histiocytose

Nadere informatie

Nederlandse samenvatting

Nederlandse samenvatting Dikkedarmkanker is na longkanker de meest voorkomende doodsoorzaak ten gevolge van kanker in de westerse wereld. Dikkedarmkanker manifesteert zich na een accumulatie van verscheidene genetische veranderingen.

Nadere informatie

Moleculaire Diagnostiek in de Pathologie

Moleculaire Diagnostiek in de Pathologie Moleculaire Diagnostiek in de Pathologie Informatiebrochure Afdeling Pathologie VU medisch centrum Amsterdam Inhoudsopgave Pagina Inleiding 3 Indicatiegebieden en bijbehorende Moleculaire Diagnostiek:

Nadere informatie

Richtlijn verslaglegging moleculaire diagnostiek

Richtlijn verslaglegging moleculaire diagnostiek Richtlijn verslaglegging moleculaire diagnostiek Juni 2012 Werkgroep Moleculaire Diagnostiek in de Pathologie Dr. Ir. Saskia van den Berg van Erp De Toren van Babel- Pieter Bruegel de Oudere (ca. 1560)

Nadere informatie

7. Verworven aandoeningen : kanker

7. Verworven aandoeningen : kanker 7. Verworven aandoeningen : kanker 7.1 Inleiding : de moleculaire basis van kanker De levensloop van een cel in een multicelullair organisme is nauwkeurig geregeld door verschillende signaalcascades en

Nadere informatie

Gepersonaliseerde aanpak bij longkanker

Gepersonaliseerde aanpak bij longkanker Gepersonaliseerde aanpak bij longkanker Dr. André VERSTRAETEN Dr. Elke GOVAERTS Dienst longziekten Pneumo-oncologie - Longkanker is de belangrijkste oorzaak van kankergerelateerde mortaliteit in beide

Nadere informatie

NEDERLANDSE SAMENVATTING

NEDERLANDSE SAMENVATTING NEDERLANDSE SAMENVATTING ACHTERGROND Klinische aspecten van dikke darmkanker Dikke darmkanker is een van de meest voorkomende vormen van kanker in de westerse wereld. Als we kijken naar aan kanker gerelateerde

Nadere informatie

Nederlandse samenvatting en discussie

Nederlandse samenvatting en discussie 9 Nederlandse samenvatting en discussie 158 Chapter 9 Variaties in het humane genoom: geschikte markers voor weefsel identificatie en het testen van allelische instabiliteit 9.1 Samenvatting en algemene

Nadere informatie

Molecular Pathology for Pathologists. Pr P. Pauwels

Molecular Pathology for Pathologists. Pr P. Pauwels Molecular Pathology for Pathologists Pr P. Pauwels NGS moleculair pathologie rapport ontcijferen Nomenclatuur waarin gerapporteerd wordt: EGFR c.2573t>g, p.(leu858arg) Coderende sequentie Eiwit/proteïne

Nadere informatie

Biologicals in de longziekten. Piet van Valenberg, longarts.

Biologicals in de longziekten. Piet van Valenberg, longarts. Biologicals in de longziekten. Piet van Valenberg, longarts. Biologicals Astma : anti IgE : omalizumab = Xolair Sarcoidosis : infliximab : anti-tnfalfa Bronchuscarcinoom Bronchus carcinoom Chemotherapie

Nadere informatie

Kankercellen in een kweekschaaltje. HeLa

Kankercellen in een kweekschaaltje. HeLa Kankercellen in een kweekschaaltje HeLa De Eigenschappen van een Tumor Hanahan and Weinberg, Cell 2011 A! H! B! Kanker = (cellulaire) remmen die niet goed werken: tumor suppressor eiwitten (bv. p53) (cellulaire)

Nadere informatie

Gastro-intestinale stromacel tumor: Risico classificatie en mutatie analyse door de patholoog. Dr. Judith V.M.G. Bovee Patholoog LUMC

Gastro-intestinale stromacel tumor: Risico classificatie en mutatie analyse door de patholoog. Dr. Judith V.M.G. Bovee Patholoog LUMC Gastro-intestinale stromacel tumor: Risico classificatie en mutatie analyse door de patholoog Dr. Judith V.M.G. Bovee Patholoog LUMC GastroIntestinale Stromacel Tumor 11-15 GISTen per 100.000 mensen (Scandinavië)

Nadere informatie

Next Generation Sequencing: meer met minder

Next Generation Sequencing: meer met minder Next Generation Sequencing: meer met minder Robert van der Geize Klinisch Moleculair Bioloog in de Pathologie (KMBP) Xs2HiTek-workshop 'Diagnostiek in de Pathologie' 2015 www.labpon.nl Boerhaavelaan 59

Nadere informatie

Summary in Dutch. Chapter 14

Summary in Dutch. Chapter 14 Summary in Dutch Chapter 14 Chapter 14 14.1 Samenvatting Ondanks de dalende incidentie cijfers van maagkanker is het wereldwijd nog steeds de op een na meest frequente oorzaak van sterfte aan kanker. Patiënten

Nadere informatie

Cover Page. The handle http://hdl.handle.net/1887/21043 holds various files of this Leiden University dissertation.

Cover Page. The handle http://hdl.handle.net/1887/21043 holds various files of this Leiden University dissertation. Cover Page The handle http://hdl.handle.net/1887/21043 holds various files of this Leiden University dissertation. Author: Kuijjer, Marieke Lydia Title: A systems biology approach to study high-grade osteosarcoma

Nadere informatie

19 mei 2009 Jaarbeurs Utrecht. Longkanker. Nieuwe inzichten en aanpak. Annemieke Kreiter Nurse practitioner oncologie SKB Winterswijk

19 mei 2009 Jaarbeurs Utrecht. Longkanker. Nieuwe inzichten en aanpak. Annemieke Kreiter Nurse practitioner oncologie SKB Winterswijk 19 mei 2009 Jaarbeurs Utrecht Longkanker Nieuwe inzichten en aanpak Annemieke Kreiter Nurse practitioner oncologie SKB Winterswijk Met dank aan Diane Paolilli, Elizabeth Waxman en Cynthia Chernecky Cijfers

Nadere informatie

1 (~20 minuten; 20 punten)

1 (~20 minuten; 20 punten) TENTAMEN Moleculaire Cel Biologie (8A840) Prof. Dr. Ir. L. Brunsveld & Dr. M. Merkx 27-01-2012 14:00 17:00 (totaal 100 punten) 6 opgaven in totaal + 1 bonusvraag! (aangegeven tijd is indicatie) Gebruik

Nadere informatie

In Situ Hybridisatie in de routine pathologie diagnostiek

In Situ Hybridisatie in de routine pathologie diagnostiek In Situ Hybridisatie in de routine pathologie diagnostiek Winand Dinjens Afdeling Pathologie Josephine Nefkens Instituut (JNI) Erasmus MC, Rotterdam Pathologendagen; 11 april 2007, Ede In Situ Hybridisatie

Nadere informatie

De rol van de pathologie en genetica bij de herkenning van Lynch syndroom

De rol van de pathologie en genetica bij de herkenning van Lynch syndroom De rol van de pathologie en genetica bij de herkenning van Lynch syndroom Marjolijn Ligtenberg Laboratorium specialist klinische genetica Klinisch moleculair bioloog in de Pathologie VAP dag 28-3-2017

Nadere informatie

Het leveren van de juiste behandelingen, op het juiste moment, iedere keer, bij de juiste persoon

Het leveren van de juiste behandelingen, op het juiste moment, iedere keer, bij de juiste persoon Het leveren van de juiste behandelingen, op het juiste moment, iedere keer, bij de juiste persoon Barack Obama NIEUWE PRECISIE ONCOLOGISCHE TEST OM DE MEEST EFFECTIEVE BEHANDELING TEGEN KANKER TE IDENTIFICEREN

Nadere informatie

Moleculaire pathologie als leiddraad voor individuele kankerbehandeling

Moleculaire pathologie als leiddraad voor individuele kankerbehandeling Moleculaire pathologie als leiddraad voor individuele kankerbehandeling Amersfoort 24 Maart 2015 Stefan Willems, MD PhD Pathologist, Depts of Pathology, UMC Utrecht and NKI-AvL Amsterdam Research fellow

Nadere informatie

KANKER. Finish! kankercellen

KANKER. Finish! kankercellen KANKER Kanker is een ziekte(in aanleg) veroorzaakt door afwijkingen in het erfelijkheidsmateriaal(= afwijkende genen = mutaties). Bijvoorbeeld: beschadigde genen, afwijkend aantal genen, foutief gereguleerde

Nadere informatie

Eén van de taken van het immuunsysteem is het organisme (mens en dier) te beschermen tegen de ongewenste effecten van het binnendringen van

Eén van de taken van het immuunsysteem is het organisme (mens en dier) te beschermen tegen de ongewenste effecten van het binnendringen van Samenvatting Eén van de taken van het immuunsysteem is het organisme (mens en dier) te beschermen tegen de ongewenste effecten van het binnendringen van pathogenen, waaronder bacteriën, virussen en parasieten.

Nadere informatie

Immuuntherapie: resultaten tot nu toe bij patiënten met een longcarcinoom Willemijn Theelen

Immuuntherapie: resultaten tot nu toe bij patiënten met een longcarcinoom Willemijn Theelen Immuuntherapie: resultaten tot nu toe bij patiënten met een longcarcinoom 15-06-2017 Willemijn Theelen w.theelen@nki.nl Risicofactoren Longcarcinoom Roken in 90% de oorzaak Passief roken : 1,2-1,3 x verhoogd

Nadere informatie

Summary in Dutch (Nederlandse samenvatting voor leken)

Summary in Dutch (Nederlandse samenvatting voor leken) Summary in Dutch (Nederlandse samenvatting voor leken) 13_Smakman.indd 173 10-02-2006 11:30:37 Het menselijk lichaam bestaat uit een groot aantal organen en weefsels die zijn opgebouwd uit miljarden cellen.

Nadere informatie

The diagnostic and prognostic value of genetic aberrations in resectable distal bile duct cancer Rijken, A.M.

The diagnostic and prognostic value of genetic aberrations in resectable distal bile duct cancer Rijken, A.M. UvA-DARE (Digital Academic Repository) The diagnostic and prognostic value of genetic aberrations in resectable distal bile duct cancer Rijken, A.M. Link to publication Citation for published version (APA):

Nadere informatie

KANKER. kankercellen Finish!

KANKER. kankercellen Finish! KANKER Kanker is een ziekte veroorzaakt door afwijkingen in het erfelijkheidsmateriaal(= afwijkende genen = mutaties). Besproken: Eigenschappen van het erfelijkheidsmateriaal en het ontstaan van mutaties(dna

Nadere informatie

Cover Page. The handle http://hdl.handle.net/1887/18977 holds various files of this Leiden University dissertation.

Cover Page. The handle http://hdl.handle.net/1887/18977 holds various files of this Leiden University dissertation. Cover Page The handle http://hdl.handle.net/1887/18977 holds various files of this Leiden University dissertation. Author: Filali, Mariam el Title: Knowledge-based treatment in uveal melanoma Date: 2012-05-22

Nadere informatie

Palliatieve zorg bij longkanker. Jeske Staal-van den Brekel, longarts ZGT, locatie Almelo

Palliatieve zorg bij longkanker. Jeske Staal-van den Brekel, longarts ZGT, locatie Almelo Palliatieve zorg bij longkanker Jeske Staal-van den Brekel, longarts ZGT, locatie Almelo Dhr E, 21-05-1943 Maart 2010:analyse dyspnoe Voorgeschiedenis: -2007 acuut myocard infarct, gevolgd door CABG -2008

Nadere informatie

Nederlandse samenvatting

Nederlandse samenvatting Nederlandse samenvatting 129 In de ontwikkelde landen krijgt een op de drie mensen kanker. Ondanks betere screening en behandelingsmogelijkheden is kanker in ontwikkelde landen nog steeds de meest voorkomende

Nadere informatie

Precisie geneeskunde in de longoncologie. Michel van den Heuvel, longarts

Precisie geneeskunde in de longoncologie. Michel van den Heuvel, longarts Precisie geneeskunde in de longoncologie Michel van den Heuvel, longarts Leerdoelen Therapie op maat bij longkanker De huidige standaardzorg bij longkanker Wat komt er aan Immuuntherapie http://www.cijfersoverkanker.nl/

Nadere informatie

Moleculaire pathways/merkers/therapie. Wim Demey, medische oncologie

Moleculaire pathways/merkers/therapie. Wim Demey, medische oncologie Moleculaire pathways/merkers/therapie Wim Demey, medische oncologie Receptor tyrosine kinase: Transmembranaire groeifactorreceptor met een intrinsieke ligandgecontroleerde tyrosine kinase activiteit

Nadere informatie

'Vergelijking van het expressieprofiel van enkele tumor suppressor genen in mammatumoren tussen mens en hond'

'Vergelijking van het expressieprofiel van enkele tumor suppressor genen in mammatumoren tussen mens en hond' UNIVERSITEIT GENT FACULTEIT DIERGENEESKUNDE Academiejaar 2011 2012 'Vergelijking van het expressieprofiel van enkele tumor suppressor genen in mammatumoren tussen mens en hond' door Kirsten MEIJER Promotor:

Nadere informatie

Casuïstiek bespreking: EGFR mutaties. Jeske Staal-van den Brekel, longarts

Casuïstiek bespreking: EGFR mutaties. Jeske Staal-van den Brekel, longarts . Casuïstiek bespreking: EGFR mutaties Jeske Staal-van den Brekel, longarts Mw N, 31-10-1948 Anamnese (sept 2015) Sinds 2 maanden progressieve dyspneu d effort. Pijnlijk gevoel over rechter thorax. Droge

Nadere informatie

Focused on What Really Matters. Focused on What Really Matters. Gepersonaliseerde kankertherapie. Focused on What Really Matters 1

Focused on What Really Matters. Focused on What Really Matters. Gepersonaliseerde kankertherapie. Focused on What Really Matters 1 Focused on What Really Matters. Focused on What Really Matters. Gepersonaliseerde kankertherapie Focused on What Really Matters 1 Gepersonaliseerde kankertherapie - hoe het werkt nucleus met gezond DNA

Nadere informatie

Folliculair Lymfoom graad 3B (FL3B)

Folliculair Lymfoom graad 3B (FL3B) Nederlandse samenvatting Folliculair Lymfoom graad 3B (FL3B) Inleiding Een maligne lymfoom is een kwaadaardige woekering van witte bloedcellen die zich meestal manifesteert in lymfeklieren en zich verspreidt

Nadere informatie

Gebruik van prognostische en predictieve factoren bij de behandeling van het colorectaal carcinoom GIOCA congres 2017

Gebruik van prognostische en predictieve factoren bij de behandeling van het colorectaal carcinoom GIOCA congres 2017 Gebruik van prognostische en predictieve factoren bij de behandeling van het colorectaal carcinoom GIOCA congres 2017 Prof.dr. Kees Punt afd. Medische Oncologie AMC Amsterdam Colorectaal carcinoom Vroeger

Nadere informatie

Moleculaire mechanismen. De connectie tussen interacties van eiwitten en activiteiten van cellen

Moleculaire mechanismen. De connectie tussen interacties van eiwitten en activiteiten van cellen Moleculaire mechanismen De connectie tussen interacties van eiwitten en activiteiten van cellen The Hallmarks of Cancer Hanahan and Weinberg, Cell 2000 Niet afhankelijk van groei signalen Apoptose ontwijken

Nadere informatie

Nederlandse samenvatting

Nederlandse samenvatting Nederlandse samenvatting Er bestaan grote onderlinge verschillen tussen patiënten met darmkanker, oftewel colorectale carcinomen zowel op het niveau van de patient als op het niveau van tumorbiologie.

Nadere informatie

EGFR klinische relevantie bij longkanker

EGFR klinische relevantie bij longkanker EGFR klinische relevantie bij longkanker Longkanker oud Incidentie Histologie Stadiëring Behandeling roken EGFR Pathofysiologie Behandeling Varia Erik Thunnissen ethunnissen@vumc.nl 3. VIKC 2005 Incidentie

Nadere informatie

Nederlandse samenvatting

Nederlandse samenvatting Nederlandse samenvatting nederlandse samenvatting Algemene inleiding Primair bot lymfoom is een zeldzame aandoening. Het is een extranodaal subtype van het grootcellig B non Hodgkin lymfoom, dat zich

Nadere informatie

Leven met kanker Nieuwste ontwikkelingen in de behandeling bij longkanker. Judith Herder 2017

Leven met kanker Nieuwste ontwikkelingen in de behandeling bij longkanker. Judith Herder 2017 Leven met kanker Nieuwste ontwikkelingen in de behandeling bij longkanker Judith Herder 2017 Deze presentatie Enkele feiten over kanker Wat is longkanker nou eigenlijk? Behandeling bij uitgezaaid longkanker

Nadere informatie

Chapter 10. Nederlandse samenvatting

Chapter 10. Nederlandse samenvatting Chapter 10 Nederlandse samenvatting Chapter 10 Samenvatting Moleculaire markers voor dikkedarmkankerscreening en het voorspellen van respons op chemotherapie Kanker van de dikke darm en de endeldarm (ook

Nadere informatie

Nederlandse Samenvatting

Nederlandse Samenvatting Nederlandse Samenvatting 105 Nederlandse Samenvatting Het doel van het onderzoek beschreven in dit proefschrift is het bestuderen van de relatie tussen de expressie van potentieel prognostische tumormarkers

Nadere informatie

Cover Page. The handle http://hdl.handle.net/1887/33832 holds various files of this Leiden University dissertation

Cover Page. The handle http://hdl.handle.net/1887/33832 holds various files of this Leiden University dissertation Cover Page The handle http://hdl.handle.net/1887/33832 holds various files of this Leiden University dissertation Author: Krens, Lisanne Title: Refining EGFR-monoclonal antibody treatment in colorectal

Nadere informatie

CHAPTER 10. Nederlandse samenvatting

CHAPTER 10. Nederlandse samenvatting CHAPTER 10 Nederlandse samenvatting Om uit te groeien tot een kwaadaardige tumor met uitzaaiïngen moeten kankercellen een aantal karakteristieken verwerven. Eén daarvan is het vermogen om angiogenese,

Nadere informatie

02/03/2010 P. Schöffski 29

02/03/2010 P. Schöffski 29 Mammographie 02/03/2010 P. Schöffski 29 Evolutie van de kanker mortaliteit bij mannen (USA 1930-2000) 100 Rate Per 100,000 Lung & bronchus 80 60 40 Stomach Colon & rectum Prostate 20 Pancreas 0 Leukemia

Nadere informatie

Nederlandse samenvatting

Nederlandse samenvatting Nieuwe vooruitzichten in de karakterisering en behandeling van acute myeloïde leukemie Nederlandse samenvatting 134 Acute myeloïde leukemie (AML) is een vorm van bloedkanker, een kwaadaardige aandoening

Nadere informatie

O.N.S.. Meeting. What s new in HER1 and 2

O.N.S.. Meeting. What s new in HER1 and 2 9 e Post-O.N.S O.N.S.. Meeting What s new in HER1 and 2 Diagnostiek en behandelingsopties Manon Komen Research Coördinator Oncologie Medisch Centrum Alkmaar Introductie De erbb tyrosine kinase familie

Nadere informatie

MSI/ KRAS/ NRAS consequenties behandeling? Hanneke Wilmink Internist-oncoloog AMC

MSI/ KRAS/ NRAS consequenties behandeling? Hanneke Wilmink Internist-oncoloog AMC MSI/ KRAS/ NRAS consequenties behandeling? Hanneke Wilmink Internist-oncoloog AMC Casus 1 74-jarige man, stadium II (T3N0M0) sigmoid carcinoom, nu 30 dagen na laparoscopische sigmoid resectie, MSS tumor,

Nadere informatie

DNA & eiwitsynthese Oefen- en zelftoetsmodule behorende bij hoofdstuk 16 en 17 van Campbell, 7 e druk December 2008

DNA & eiwitsynthese Oefen- en zelftoetsmodule behorende bij hoofdstuk 16 en 17 van Campbell, 7 e druk December 2008 DNA & eiwitsynthese Oefen- en zelftoetsmodule behorende bij hoofdstuk 16 en 17 van Campbell, 7 e druk December 2008 DNA 1. Hieronder zie je de schematische weergave van een dubbelstrengs DNA-keten. Een

Nadere informatie

Chapter 10. Nederlandse samenvatting

Chapter 10. Nederlandse samenvatting Nederlandse samenvatting Hereditair Nonpolyposis Colorectaal Carcinoom, afgekort als (HNPCC), ook wel Lynch syndroom genoemd, is een autosomaal dominante erfelijke aandoening met een hoge penetrantie (80-85%),

Nadere informatie

Nederlandse samenvatting

Nederlandse samenvatting 8 Nederlandse samenvatting maligniteit. Van de ruim 81.000 nieuwe gevallen van kanker in 2005 waren het er 2650 in het hoofd-halsgebied. In vergelijking met andere landen vaak mond- keelholte en strottenhoofdkanker

Nadere informatie

Nieuwe ontwikkelingen in de behandeling van gliomen. Dr J Bromberg, prof M.J. van den Bent Neurologen Erasmus MC Kanker Instituut Rotterdam

Nieuwe ontwikkelingen in de behandeling van gliomen. Dr J Bromberg, prof M.J. van den Bent Neurologen Erasmus MC Kanker Instituut Rotterdam Nieuwe ontwikkelingen in de behandeling van gliomen Dr J Bromberg, prof M.J. van den Bent Neurologen Erasmus MC Kanker Instituut Rotterdam Nieuwe ontwikkelingen in de behandeling van gliomen Twee uitersten

Nadere informatie

Hoofdstuk 1 Hoofdstuk 2 Hoofdstuk 3

Hoofdstuk 1 Hoofdstuk 2 Hoofdstuk 3 Samenvatting 12 Samenvatting Groei is een complex proces, dat wordt gereguleerd door verschillende externe en interne factoren. Een afwijking van het normale groeipatroon kan een aanwijzing zijn voor

Nadere informatie

Vragen bij paragraaf 5.1 en 5.2

Vragen bij paragraaf 5.1 en 5.2 Vragen bij paragraaf 5.1 en 5.2 1. Geef van onderstaande begrippen een omschrijving. celdifferentiatie overgang van stamcellen in specifieke cellen (specialisatie) katalysator een stof die een bepaalde

Nadere informatie

Nederlandse samenvatting

Nederlandse samenvatting 6 78 Nederlandse samenvatting Colon kanker Colon (dikke darm) kanker is één van de meest voorkomende kankers en is de tweede doodsoorzaak door kanker in geïndustrialiseerde landen. Het voorstadium van

Nadere informatie

Naam: Studentnummer: Opleiding:..

Naam: Studentnummer: Opleiding:.. 1 Slaaptekort en genregulatie (~20 minuten; 20 punten) Recent is in Engeland een interessante studie gedaan naar de invloed van slaaptekort op de regulatie van genen. Bij mensen met een chronisch slaaptekort

Nadere informatie

Organisatieniveaus (niveau: expert)

Organisatieniveaus (niveau: expert) Organisatieniveaus (niveau: expert) Ontwikkeld door het Cancer Genomics Centre In samenwerking met het Freudenthal Instituut voor Didactiek van Wiskunde en Natuurwetenschappen van de Universiteit Utrecht

Nadere informatie

Van mens tot Cel oefenvragen 1. De celdeling bestaat uit verschillende fasen. Hoe heten de G1, S en de G2 fase samen?

Van mens tot Cel oefenvragen 1. De celdeling bestaat uit verschillende fasen. Hoe heten de G1, S en de G2 fase samen? Van mens tot Cel oefenvragen 1. De celdeling bestaat uit verschillende fasen. Hoe heten de G1, S en de G2 fase samen? A: interfase B: profase C: anafase D: cytokinese 2. Een SNP (single nucleotide polymorphism)

Nadere informatie

Hoofdstuk 1 Hoofdstuk 2 Hoofdstuk 3 Hoofdstuk 4 175

Hoofdstuk 1 Hoofdstuk 2 Hoofdstuk 3 Hoofdstuk 4 175 Samenvatting Chapter 11 174 Samenvatting In dit hoofdstuk worden de studies die in dit proefschrift worden beschreven samengevat en bediscussieerd. Dit proefschrift richt zich op kankercel specifieke middelen,

Nadere informatie

NEDERLANDSE SAMENVATTING KANKER

NEDERLANDSE SAMENVATTING KANKER NEDERLANDSE SAMENVATTING KANKER Kanker is een ziekte die ontstaat door een opeenstapeling van beschadigingen (mutaties) in het DNA. Deze beschadigingen kunnen zowel erfelijk als verworven zijn. Voorbeelden

Nadere informatie

100 jaar Antoni van Leeuwenhoek

100 jaar Antoni van Leeuwenhoek 100 jaar Antoni van Leeuwenhoek Onze toekomstdroom Het Antoni van Leeuwenhoek koos 100 jaar geleden al voor de grensverleggende weg door onderzoek en specialistische zorg samen te voegen met één scherp

Nadere informatie

Signaaltransductie versie

Signaaltransductie versie Signaaltransductie versie 2015-2016 Vragen bij COO over hoofdstuk 16 van Alberts Essential Cell Biology, 4e druk De vragen die voorkomen in het COO-programma zijn op dit formulier weergegeven. Het is de

Nadere informatie

BIOLOGIE MOLECULAIRE GENETICA EIWITSYNTHESE VWO KLASSE 6

BIOLOGIE MOLECULAIRE GENETICA EIWITSYNTHESE VWO KLASSE 6 BIOLOGIE MOLECULAIRE GENETICA EIWITSYNTHESE VWO KLASSE 6 Henry N. Hassankhan Scholengemeenschap Lelydorp [HHS-SGL] ARTHUR A. HOOGENDOORN ATHENEUM - VRIJE ATHENEUM - AAHA Docent: A. Sewsahai DOELSTELLINGEN:

Nadere informatie

Chapter. Nederlandse samenvatting

Chapter. Nederlandse samenvatting Chapter Nederlandse samenvatting Chapter NEDERLANDSE SAMENVATTING Over tumoren, bloedvaten en angiogenese Kanker vormt al jaren één van de belangrijkste doodsoorzaken. Wereldwijd stierven er in 2004 zo

Nadere informatie

Biologicals; nieuwe therapeutische opties

Biologicals; nieuwe therapeutische opties Biologicals; nieuwe therapeutische opties Lidwine Tick, internist hemato-oncoloog Veldhoven, 19 september 2013 "De wereld van Mab-jes, Nib-jes en Mus-sen". Anti-tumor behandeling Chirurgie Radiotherapie

Nadere informatie

Vectibix (panitumumab) Educatief materiaal voor de arts

Vectibix (panitumumab) Educatief materiaal voor de arts De Europese gezondheidsautoriteiten hebben bepaalde voorwaarden verbonden aan het in de handel brengen van het geneesmiddel Vectibix. Het verplicht plan voor risicobeperking in België, waarvan deze informatie

Nadere informatie

Medische genetica samenvatting

Medische genetica samenvatting Medische genetica samenvatting 3 typen genetische ziekten: 1. Chromosoom afwijkingen: a. Medische genetica 2. Monogene aandoeningen: a. Medische genetica 3. Multifactoriële aandoeningen: a. Humane genetica

Nadere informatie

Cover Page. The handle http://hdl.handle.net/1887/35942 holds various files of this Leiden University dissertation

Cover Page. The handle http://hdl.handle.net/1887/35942 holds various files of this Leiden University dissertation Cover Page The handle http://hdl.handle.net/1887/35942 holds various files of this Leiden University dissertation Author: Ent, Wietske van der Title: In vivo modelling of Ewing sarcoma in zebrafish Issue

Nadere informatie

Nieuwe doelgerichte behandeling van longkanker

Nieuwe doelgerichte behandeling van longkanker Klinische les Nieuwe doelgerichte behandeling van longkanker Harry J.M. Groen, Thijo J.N. Hiltermann, Ed Schuuring en Wim Timens Dames en Heren, Bij ongeveer 10% van de patiënten met een adenocarcinoom

Nadere informatie

Chapter 6. Nederlandse samenvatting

Chapter 6. Nederlandse samenvatting Chapter 6 Nederlandse samenvatting Chapter 6 122 Nederlandse samenvatting Het immuunsysteem Het immuunsysteem (of afweersysteem) beschermt het lichaam tegen lichaamsvreemde en ziekmakende organismen zoals

Nadere informatie

Antwoorden COIG-cursus Moleculaire biologie najaar 2015

Antwoorden COIG-cursus Moleculaire biologie najaar 2015 Antwoorden COIG-cursus Moleculaire biologie najaar 2015 Vraag 1.1.a. Een germ-line mutatie komt voor in alle cellen van het lichaam, en bloed (met witte bloedcellen met DNA erin) is prima materiaal om

Nadere informatie

Signaaltransductie en celcyclus (COO 6)

Signaaltransductie en celcyclus (COO 6) Signaaltransductie en celcyclus (COO 6) oefen- en zelftoets-module behorende bij hoofdstuk 9 en 12 van Unit 1 van Campbell, 10 e druk versie 2014-2015 Communicatie 1. Hier zie je drie manieren waarop een

Nadere informatie

Chapter 12. Samenvatting en conclusies

Chapter 12. Samenvatting en conclusies Samenvatting en conclusies Dit proefschrift richt zich op fibroadenomen en phyllodes tumoren, beide fibroepitheliale tumoren. Deze tumoren worden bifasisch genoemd omdat zij opgebouwd zijn uit twee componenten,

Nadere informatie

Kanker: klinisch beeld,

Kanker: klinisch beeld, Kanker: klinisch beeld, epidemiologie, biologie en pathofysiologie Prof. Patrick Schöffski, M.D., M.P.H. Dienst Algemene Medische Oncologie Universitair Ziekenhuis Gasthuisberg Leuvens Kanker Instituut

Nadere informatie

Kanker. Carcinomas: epitheel tumoren (long, borst, slokdarm,..) 90% van alle kankers

Kanker. Carcinomas: epitheel tumoren (long, borst, slokdarm,..) 90% van alle kankers Kanker 3 types Carcinomas: epitheel tumoren (long, borst, slokdarm,..) 90% van alle kankers Sarcomas: mesodorme tumoren (vet adiposaroom, spieren myosarcoom, been, ) Lymfomen en leukemies: tumoren in de

Nadere informatie

Cover Page. The handle http://hdl.handle.net/1887/18632 holds various files of this Leiden University dissertation.

Cover Page. The handle http://hdl.handle.net/1887/18632 holds various files of this Leiden University dissertation. Cover Page The handle http://hdl.handle.net/1887/18632 holds various files of this Leiden University dissertation. Author: Joosse, Simon Andreas Title: Prediction of "BRCAness" in breast cancer by array

Nadere informatie

Samenvating in het Nederlands

Samenvating in het Nederlands Samenvating in het Nederlands Inleiding Dit proefschrift gaat over de behandeling van solide tumoren met immuuntherapie. Het immuunsysteem herkent en bestrijdt niet alleen schadelijke virussen, bacteriën

Nadere informatie

Teveel centrosomen in kankercellen

Teveel centrosomen in kankercellen Teveel centrosomen in kankercellen Ongecoördineerde celdeling zorgt ervoor dat kankercellen steeds verder ontsporen, denkt een onderzoeksgroep van oncologen uit Boston. Kankercellen zijn vaak aneuploïd:

Nadere informatie

Nieuwe strategieën voor de behandeling van chondrosarcomen. Nederlandse samenvatting

Nieuwe strategieën voor de behandeling van chondrosarcomen. Nederlandse samenvatting Nieuwe strategieën voor de behandeling van chondrosarcomen Nederlandse samenvatting Inhoud Chondrosarcomen: entiteit, gradering, behandeling en prognose Benigne versus maligne kraakbeenvormende tumoren

Nadere informatie

Non-Hodgkin Lymfomen: naar therapie op maat?

Non-Hodgkin Lymfomen: naar therapie op maat? Non-Hodgkin Lymfomen: naar therapie op maat? LYMMCARE Patiëntensymposium 13 november 2014 Rien van Oers non-hodgkin lymfomen Inleiding: indeling non-hodgkin lymfomen Behandeling anno 2014 Nieuwe ontwikkelingen

Nadere informatie

Nederlandse Samenvatting

Nederlandse Samenvatting Alle levende wezens zijn opgebouwd uit cellen en elke cel bevat de volledige genetische informatie van het organisme, het genoom, opgeslagen in het DNA. De coderende delen van het DNA worden genen genoemd,

Nadere informatie

Oncogenetica. Divisie Medische Genetica. 11 februari Oncogenetica Genetische aspecten van kanker. Genetische aspecten van kanker

Oncogenetica. Divisie Medische Genetica. 11 februari Oncogenetica Genetische aspecten van kanker. Genetische aspecten van kanker 2 Oncogenetica Genetische aspecten van kanker en DNA-diagnostiek Oncogenetica Genetische aspecten van kanker en DNA-diagnostiek Onderwerpen:. Inleiding oncogenetica 2. Genetica van borstkanker 3. DNA-diagnostiek

Nadere informatie

Hematologie: werken in teamverband!

Hematologie: werken in teamverband! Hematologie: werken in teamverband! Hematologie Zeer intense samenwerking tussen clinicus, klinisch bioloog, anatomopatholoog en cytogeneticus is cruciaal Aan hand van twee casussen willen we het zorgpad

Nadere informatie

Leerlingenhandleiding

Leerlingenhandleiding Leerlingenhandleiding Niveau: expert Lees de taal van de tumor Ontwikkeld door het Cancer Genomics Centre (CancerGenomiCs.nl) in samenwerking met het Freudenthal Instituut voor Didactiek van Wiskunde en

Nadere informatie

Het vaccin waarmee de meisjes worden geïnjecteerd, beschermt onder andere tegen HPV18.

Het vaccin waarmee de meisjes worden geïnjecteerd, beschermt onder andere tegen HPV18. Examentrainer Vragen HPV-vaccinatie Baarmoederhalskanker is een vorm van kanker die relatief vaak voorkomt bij vrouwen. De ziekte kan zijn veroorzaakt door een infectie met het humaan papillomavirus (HPV).

Nadere informatie