Over Fruitvliegen, Boomschors en Darmkanker

Transcriptie

1 Over Fruitvliegen, Boomschors en Darmkanker Ron Smits Dept. of Gastroenterology and Hepatology Erasmus MC, Rotterdam, the Netherlands

2 Incidentie van alle patiënten met kanker in Nederland van

3 Overleving van patiënten met kanker is in diezelfde periode verbeterd

4 Incidentie van alle patiënten met kanker in Nederland van

5 We worden steeds ouder

6 Kanker is voor een belangrijk deel een ouderdomsziekte

7

8 De dunne darm; een groot oppervlak voor voedselopname Totaal oppervlakte gelijk aan tennisveld

9

10 Incidentie van alle patiënten met Maag- of Darmkanker in Nederland van

11

12 Life-time risico in Nederland in 2005 (%) Man Vrouw Gemiddeld Darm 6,25 5,56 5,90 Maag 1,43 0,91 1,17 Slokdarm 1,11 0,50 0,81 Totaal GI-tract 8,79 6,96 7, Bron: Kennisnetwerk integrale kankercentra k

13 Symptomen Darmkanker Symptomen darmkanker: - Verandering in ontlastingpatroon (afwisselend verstopping/diarree) - Bloed en/of slijm bij de ontlasting - Loze aandrang Later stadium: - Bloedarmoede die tot vermoeidheid leidt - Vage buikpijn - Een gevoelige plek in de buik

14 Ook darmkanker is een ouderdomsziekte # nieuwe gevallen darmkanker (2008) # Sterfgevallen darmkanker (2008)

15 Vroege detectie van darmkanker Aantonen bloed in ontlasting: - Niet heel gevoelig - Niet heel specifiek Colonoscopie:

16

17 Niet alle poliepen zijn gemakkelijk te zien

18 Over Fruitvliegen, Boomschors en Darmkanker Ron Smits Dept. of Gastroenterology and Hepatology Erasmus MC, Rotterdam, the Netherlands

19 De klassieke adenoma-carcinoma progressie in darmkanker intestinal epithelial l cell Goedaardige adenoom/poliep Kwaadaardige carcinoom

20 Fruitvliegen oftewel Drosophila melanogaster

21 De Wingless mutatie in Drosophila melanogaster

22 De Wnt-signalerings pathway is oorspronkelijk ontdekt in Drosophila No Wingless protein

23 Een defect in het intracellulaire Armadillo eiwit geeft een vergelijkbaar defect Armadillo mutant -verstoorde aanmaak huidcellen met haartjes - geen naakte huidcellen Armadillo: Spaans voor gordeldier

24 De WNT Signaal Transductie route in fruitvlieg WNT Armadillo Armadillo Maak een vleugel of maak een segment zonder haren

25 Het Armadillo eiwit van de fruitvlieg lijkt sterk op -catenine van zoogdieren Armadillo 65% identiek in de volgorde van aminozuren -catenine

26 -catenine is in zoogdieren belangrijk voor celhechting -catenine

27 -catenine is essentieel voor een goede celadhesie Cadherins -catenin -catenin -catenin -catenin Y

28 Erfelijke darmkanker Familiare Adenomateuze Polyposis (FAP) Sporadic (>90%) 5-10% FAP HNPCC Familial Colorectal Cancer

29 Familiare Adenomateuze Polyposis (FAP) 1- Goedaardige poliepen carcinoma Resected colon from FAP patient Macroscopic detail of multiple polyps

30 APC is het gemuteerde gen in FAP patiënten - Germline APC mutations are responsible for Familial Adenomatous Polyposis (FAP). (Groden et al. 1991; Nishisho et al., 1991).

31 Het APC tumor suppressor eiwit NH 2 - EE E EI EI -COOH * * * *** ** * oligomerization DLG/PTP-BL binding ß-catenin binding armadillo-repeat E Nuclear export signal ß-catenin downregulation microtubules binding I Nuclear import signal SAMP (axin/conductin binding) EB1/RP1 binding * CDK consensus phosphorylation site p34-cdc2 binding?

32 The WNT Signal Transduction Pathway Frizzled WNT Conductin/ Axin GSK-3 Dsh GSK-3 APC -catenin P Conductin/ Axin APC -catenin degradation -catenin -catenin TCF/LEF TRANSCRIPTION

33 Conclusie 1: Zowel in de fruitvlieg als de mens functioneert Armadillo/ -catenine als signaal molecuul Hetzelfde geldt voor alle meercellige diersoorten

34 APC mutaties leiden tot een verkort eiwit NH 2 - -COOH ß-catenin binding ß-catenin downregulation SAMP (axin/conductin binding)

35 Wnt Signaal Transductie in Darmkanker: twee alternatieve scenarios -catenin -catenin -catenin * -catenint i * -catenin -catenin * APC X -catenin -catenin * -catenin * -catenin TCF/LEF CONSTITUTIVE TRANSCRIPTION -catenin TCF/LEF * CONSTITUTIVE TRANSCRIPTION 85% of the cases 5-10% of the cases

36 Tumoren met een defect in de Wnt/ -catenin pathway worden gekenmerkt door kernstapeling van -catenine -catenine kleuring van een darmtumor in een Apc mutante muis

37 The classical adenoma-carcinoma sequence in colorectal cancer intestinal epithelial l cell adenoma carcinoma APC -catenin K-RAS SMAD2/4 chr. 18q LOH p53 chr. 17p LOH

38 Villus ~3.500 cellsp p Apoptotic cells Stem cells Paneth cells Transient-amplifying cells Absorptive cells Goblet cells Enteroendocrine cells Mouth of crypt Cell turnover: - muis 3-4 dagen -mens 4-6 dagen Specialized intestinal cells in crypt and villus Crypt Transient amplifying cells ~250 cells Stem cells in the lower crypt

39 Use of the 12.4 kb Villin promoter to drive intestinal gene expression 12.4kb Villin-LacZ Madison, B. B. et al. J. Biol. Chem. 2002;277:

40 Basic principle of the Villin-rtTA model (Tet-ON) [1] Transgenic line 1 Villin rtta rtta rtta expressed in the intestinal tract

41 Basic principle of the Villin-rtTA model (Tet-ON) [2] Transgenic line 2 Your gene of interest No gene expression induced

42 Basic principle of the Villin-rtTA model (Tet-ON) [3] Villin DOX rtta rtta expressed in the intestinal tract rtta Your gene of interest Still Expression no gene is expression induced induced

43 Villin-rtTA/H2B-GFP Villin rtetr VP16 Villin-rtTA/H2B-GFP after 7d pulse TRE mcmv VP16rtetR H2B-GFP H2B-GFP duodenum jejunum ileum colon colon duodeum ileum

44 Villin-rtTA/H2B-GFP Villin rtetr VP16 VP16 rtetr TRE mcmv H2B-GFP H2B-GFP Chase: Days after stop of doxycycline different time points to fine-tune system Day 2, 4, 7, 10, 14, 21, 28, 35, 42, 63, 70 Villin-rtTA/H2B-GFP Villin rtetr VP16 VP16 rtetr tr TRE mcmv H2B-GFP H2B-GFP off

45 Chase at multiple time points - duodenum day 0 day 2 day 4 day 7 day 10 day 14 day 21

46 Villus ~3.500 cellsp p Apoptotic cells Stem cells Paneth cells Transient-amplifying cells Absorptive cells Goblet cells Enteroendocrine cells Proliferation Apoptosis Mouth of crypt Specialized intestinal cells in crypt and villus Crypt Transient amplifying cells ~250 cells Stem cells in the lower crypt

47 Stamcellen bevinden zich op de bodem van de crypt Mouse 2x10 8 cells shed/small intestine/day Man ~10 11 cells shed/small intestine/day 1400 cells/villus/day VILLUS 3500 cells 6-10 crypts/villus 1-2 cells positions/h 300 cells /crypt/day 20 CRYPT 250 cells M 150 proliferative cells Tc = 12 h ~32 clonogenic cells 5 S Adapted from Potten CS and Loeffler M. Development 1990; 110:

48 Wat is een stamcel? - Het is zelf niet een terminaal gedifferentieerde cel - Een cel met een oneindige delingscapaciteit - Bij iedere deling ontstaat minimaal één nieuwe stamcel en een tweede cel die zich uiteindelijk meestal gaat differentiëren ië tot een gespecialiseerd celtype

49 Schematische weergave van stamcel principes Deelt 1-2x Deelt 1 2x per dag

50 Schematische weergave van stamcel principes

51 Stamcellen bevinden zich op de bodem van de crypt Mouse 2x10 8 cells shed/small intestine/day Man ~10 11 cells shed/small intestine/day 1400 cells/villus/day VILLUS 3500 cells 6-10 crypts/villus 1-2 cells positions/h 300 cells /crypt/day 20 CRYPT 250 cells M 150 proliferative cells Tc = 12 h ~32 clonogenic cells Bron van Wnt signaal 5 S

52 De Wnt/ -catenine signalering pathway is één van de belangrijkste regulatie systemen voor het handhaven van stamcel kenmerken

53 catenine kleuring van de dunne darm van een muis

54 De WNT Signalering Pathway Frizzled WNT Conductin/ Axin GSK-3 Dsh GSK-3 APC -catenin P Conductin/ Axin APC -catenine afbraak -catenin -catenin TCF/LEF TRANSCRIPTIE

55 catenine kleuring van de dunne darm van een muis

56 Signal OFF Signal ON + - Specialisatie tot cel met specifieke functie Stamcel

57 De WNT Signalering Pathway in Colorectale Kanker -catenin -catenin -catenin * -catenin * APC -catenin -catenin * APC -catenin -catenin * -catenin * -catenin TCF/LEF CONSTITUTIVE TRANSCRIPTION -catenin TCF/LEF * CONSTITUTIVE TRANSCRIPTION 85% van darmtumoren 5-10% van darmtumoren

58 Darmkanker begint met een enkele APC gemuteerde cel Mouse 2x10 8 cells shed/small intestine/day Man ~10 11 cells shed/small intestine/day 1400 cells/villus/day VILLUS 3500 cells 6-10 crypts/villus 1-2 cells positions/h 300 cells /crypt/day 20 CRYPT 250 cells M 150 proliferative cells Tc = 12 h ~32 clonogenic cells Bron van Wnt signaal 5 S

59 stamcel principes en tumorgroei: de kanker stamcel APC APC APC APC APC APC APC APC APC APC APC APC APC APC APC APC APC

60

61 The classical adenoma-carcinoma sequence in colorectal cancer intestinal epithelial l cell adenoma carcinoma APC -catenin K-RAS SMAD2/4 chr. 18q LOH p53 chr. 17p LOH

62 Conclusies 2: -catenine signalering is in de darm belangrijk voor het instandhouden van de stamcellen Door een mutatie in APC of -catenine blijven cellen zich als stamcellen gedragen waardoor een poliep ontstaat Door spontane fouten in andere genen wordt een poliep uiteindelijk kwaadaardig en zaait uit

63 Het 2-hit model van Knudson: APC als voorbeeld -Waarom krijgen FAP patiënten 1000-en poliepen? - Waarom krijgen de meeste mensen geen of hoogstens één tot enkele darmtumoren?

64 APC is een tumor suppressor: Beide allelen moeten gemuteerd raken voor tumorvorming normal cell tumor cell precursor cell 1e hit (mutatie) 2e hit (mutatie) FAP patiënten

65 Over Fruitvliegen, Boomschors en Darmkanker Ron Smits Dept. of Gastroenterology and Hepatology Erasmus MC, Rotterdam, the Netherlands

66

67

68 Aspirin, Salicylates and Plants: Salycilates regulate signal transduction leading to acquired resistance to infectious agents by apoptosis induction

69 l

70

71 Spontaneous deamination and change of nucleotide Thymine-analogue

72 DNA polymerase is slecht in tellen: repetitieve sequenties hebben grotere kans om een mutatie op te lopen E A E K T I D S E gaggcagaaaaaactattgattctgaa Insertion of one A gaggcagaaaaaaactattgattctgaa E A E K N Y Stop