Epigenetica Theorie en mogelijke implicaties Dr. Marco Boks Dr. Bart Rutten
Disclosure Bart Rutten Speaker fees received from: Lundbeck Positions held on Advisory Boards: No Grants and sponsoring: No
Disclosure Marco Boks Speaker fees received from: - Astra Zenica - Lundbeck Positions held on Advisory Boards: - Geen Grants and sponsoring: - Geen
Stellingen 1. Alleen de DNA sequentie (i.e. genetische factoren) is overerfbaar 2. Het epigenetisch profiel van een individu is stabiel over de tijd 3. Epigenetische mechanismen medieren de persistentie van de invloeden van omgevingsinvloeden op phenotypes
Development of the number of citations including the term epigenetic. Gräff J et al. Physiol Rev 2011;91:603-649 2011 by American Physiological Society
From epidemiology to neuroscience Hersenen Van Os, Kenis, Rutten. Nature. 2010
EPIGENETICS X X X DNA mutation no DNA mutation Genotype unchanged Phenotype unchanged Genotype changed Phenotype changed Genotype unchanged Phenotype changed
Epigenetic Mechanisms DNA methylation histone tail alterations microrna, etc 2 meters DNA per cell millions of neurons
ENVIRONMENT` Epigenetics & the environment = changes in phenotype and/or gene expression by mechanisms other than changes in the DNA sequence itself
DNA Methylation Gene Transcription MTHFR, DNMT1, DNMT3a, DNMT3b I. blocks transcription factors methyl gene promoter exon 1 exon 2 II. attracts gene repressing molecules quantity * e.g. MeCP2, mutations in MeCP2 -> Rett syndrome Pishva et al. Translational Neuroscience. 2012
Agouti ACATATACGCGCGCGCGCGCGCGATATATCTGTCAA Agouti-gen promoter exon 1 exon 2 Jirtle et al. NRG 2007
Identical genotype Agouti X X = methyl pregnancy Jirtle et al. NRG 2007
Postnatal environment methyl administration Low maternal care High maternal care methyl glucocorticoid receptor gene promoter exon 1 exon 2 RNA of glucocorticoid receptor in hippocampus
Epigenetics and childhood trauma in human brain Glucocorticoid receptor methylation Glucocorticoid receptor mrna expression McGowan et al. Nature Neuroscience 2009
DNA methylation in psychosis
Histone Tail Alterations Tsankova et al. NRN 2007
Social Stress bdnf gene bdnf bdnf Hippocampus protein no stress chronic stress bdnf bdnf bdnf BDNF BDNF bdnf bdnf bdnf chronic stress chronic TCA BDNF Tsankova et al. NRN 2007
Genes regulating chromatin & bipolar disorder? Genetic variations in genes involved in H3K4 methylation show associations with bipolar disorder
Transgenerational Epigenetics pregnant female Altered DNA methylation Several generations: Identical genetic sequence Identical environment Altered DNA methylation Altered phenotype F4 Anyway et al. Science 2005 Jirtle et al. NRG 2007
History repeating? Jean-Baptiste Lamarck 1744-1829 Theory: Heritability of acquired traits Lamarckism 1920s, William McDougall: training rats in a maze Offspring of trained rats >> offspring of non-trained rats
DNA Environment gene SNP/mutation promoter exon 1 exon 2 EPIGENETIC RNA Inheritable Protein quantity quality Cell functions
Working model Subclinical experiences Prodromal state Disorder Paternal age Maternal infection Childhood trauma Cannabis Perinatal events Maternal stress Urban environment Stress Nutrition Rearing environment Migration Hypoxia Rutten & Mill. Schiz Bull. 2009
Epigenetica: theorie en mogelijke implicaties Deel II Marco Boks Bart Rutten
Stelling Epigenetische veranderingen zijn zeldzaam
Relatie met psychiatrische aandoeningen Relatie met medicatie Omgevingsinvloed Quiz
Wat is interessant aan epigenetica? Erfelijk Omgeving Trans generationele leer effecten Belangrijk in ontwikkeling Beïnvloedbaar door medicatie en dieet
Uitdagingen Invloed leeftijd en geslacht Invloed van DNA sequence variatie Invloed van medicatie Weefsel type
Correlatie tussen bloed en brein voor methylation levels onder invloed van leeftijd Horvath et al. Genome Biology 2012 13:R97
Sample plot of methylation levels by genotype groups Boks MP et al. The relationship of DNA methylation with age, gender and genotype in twins and healthy controls. PLoS One. 2009.
Cis and Trans correlations between DNA methylation and gene expression van Eijk KR, de Jong S, Boks MP, et albmc Genomics. 2012 Nov 17;13(1):636.
Stelling Epigenetische medicijnen zijn volop in ontwikkeling
MPM Boks et al, Epigenetics, 2012
Boks MP, de Jong NM, Kas MJ, Vinkers CH, Fernandes C, Kahn RS, Mill J, Ophoff RA. Current status and future prospects for epigenetic psychopharmacology. Epigenetics. 2012 Jan 1;7(1)
Stelling De belangrijkste invloed op epigenetica is voor de geboorte
Omgevingsinvloed Prenatal nutrition Prenatal exposure to alcohol Other drugs of abuse Prenatal stress Maternal care Traumatic early life experiences Environmental enrichment
Kofink, Boks, Kas, Neuroscience and Biobehavioral Reviews, in press
Psychiatrische aandoeningen Depressie Autisme Schizofrenie Bipolaire stoornis Cocaïne afhankelijkheid Alcoholisme Alzheimer
Bunnik Angry Bird Epigenetics Award 12 stellingen Rechterhand omhoog is JUIST Bij fout antwoord gaan zitten
Vragen Er zijn meer dan 25 epigenetische mechanismen Honger voor de geboorte heeft effect op de epigenetische status van het kind Met de leeftijd neemt DNA methylatie af (alles wordt minder). Er zijn geen medicijnen die direct op DNA methylatie werken
Natriumvalproaat is een HDAC inhibitor DNA methylatie verlaagd de expressie van genen
Vragen?
Universiteit Maastricht Bart Rutten b.rutten@maastrichtuniversity.nl UMC Utrecht Marco Boks mboks@umcutrecht.nl mboks@umcutrecht.nl