Zin of onzin van moleculaire onco-hematologie in een perifeer labo

Maat: px
Weergave met pagina beginnen:

Download "Zin of onzin van moleculaire onco-hematologie in een perifeer labo"

Transcriptie

1 Zin of onzin van moleculaire onco-hematologie in een perifeer labo een kwestie van service! 06 januari 2004 Pieter De Schouwer 1

2 periferie??? Waar is het centrum? 06 januari 2004 Pieter De Schouwer 2

3 Leuven? 06 januari 2004 Pieter De Schouwer 3

4 06 januari 2004 Pieter De Schouwer 4

5 Centra voor onco-hematologie Vlaamse CMD s: Aalst: Onze-Lieve-Vrouw ZKH Antwerpen: UZA Antwerpen: OCMW ZKH (ZINA) Brugge: St-Jan ZKH Brussel: VUB Gent: UZG Hasselt: Virga-Jesse ZKH Leuven: UZL Roeselare: Heilig Hart ZKH 06 januari 2004 Pieter De Schouwer 5

6 CMD s: Centraal of Perifeer? 06 januari 2004 Pieter De Schouwer 6

7 Service = Snelheid Wijzigen van therapie!!! -bij diagnose - bij therapiekeuze i.f.v. prognose - bij opvolging - respons op therapie? -minitransplant - moleculaire remissie? - blijvende remissie? - recidief? 06 januari 2004 Pieter De Schouwer 7

8 Moleculaire onco-hematologie Huidige stand van zaken vb. CML Diagnose en MRD opvolging RQ-PCR (real time quantitative PCR) vb. CLL Prognose IGH hypermutatie status sequencing FISH voor chromosomen 12, 13, 11q, 17p p53 mutatie sequencing Chimerisme opsporen bij allogene transplanten Toekomst GEP (Gene expression profiling) = microarray s 06 januari 2004 Pieter De Schouwer 8

9 Chronische Myeloiede Leukemie 06 januari 2004 Pieter De Schouwer 9

10 T(9;22)(q34;q11): Philadelphia 06 januari 2004 Pieter De Schouwer 10

11 CML: t(9;22)(q34;q11) 06 januari 2004 Pieter De Schouwer 11

12 t(9;22)(q34;q11): BCR-ABL fusie 06 januari 2004 Pieter De Schouwer 12

13 BCR-ABL fusie p210: tyrosine kinase 06 januari 2004 Pieter De Schouwer 13

14 4 mogelijke BCR-ABL fusies 06 januari 2004 Pieter De Schouwer 14

15 Real-time quantitative PCR RQ-PCR 06 januari 2004 Pieter De Schouwer 15

16 Een typische CML met b3a2 06 januari 2004 Pieter De Schouwer 16

17 Een typische CML met b2a2 06 januari 2004 Pieter De Schouwer 17

18 RQ-PCR voor MRD kwantitatief van der Velden VHJ et al (2003) Leukemia 17: januari 2004 Pieter De Schouwer 18

19 Moleculaire onco-hematologie Huidige stand van zaken vb. CML Diagnose en MRD opvolging RQ-PCR (real time quantitative PCR) vb. CLL Prognose IGH hypermutatie status sequencing FISH voor chromosomen 12, 13, 11q, 17p p53 mutatie sequencing Chimerisme opsporen bij allogene transplanten Toekomst GEP (Gene expression profiling) = microarray s 06 januari 2004 Pieter De Schouwer 19

20 Chronische Lymfatische Leukemie 06 januari 2004 Pieter De Schouwer 20

21 CLL 06 januari 2004 Pieter De Schouwer 21

22 06 januari 2004 Pieter De Schouwer 22

23 IGH gen herschikking V H 1 V H 2 V H 3 V H 4 V H 5 V H n D H J H C µ s D -> J joining n V -> D-J joining 5 (P) (P) (P) (P) FR I FR II FR III V H 4 D H 3 J H 4 N N 3 V H FRI primer V H FRII primer V H FR III primer J H primer 06 januari 2004 Pieter De Schouwer 23

24 IGH framework III PCR (page) Monoclonal: 1 Polyclonal Monoclonal: bp 151 bp 140 bp 118 bp 100 bp 82 bp 66 bp 200 bp 151 bp 140 bp 118 bp 100 bp 82 bp 66 bp 06 januari 2004 Pieter De Schouwer 24

25 [PAGE en Genescan in ALL (D&R)] Germano G et al (2003) Leukemia 17: januari 2004 Pieter De Schouwer 25

26 IGH VH hypermutatie analyse 06 januari 2004 Pieter De Schouwer 26

27 IGH VH hypermutatie analyse TGCAGCCTCTGGATTCaCCTTCAGTACCTATAGCATGAACTGGGTCC GCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAG TAGTAGTAGTTACATATACTACGCAGACTCAGTGAAGGGCCGATTCA CCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAAC AGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGAGA CTAAGGCCTATGAACCAGCTGCTTTTTCCTACTACTACTACATGGACG TCTGGGGCAAAGGGACCACGGTCACCGTCTCCTC TTGGAGCCTCTGGAtTcACCTTTCGTGACTaTTGGATGAGCTGGGTCC GCCAGGCTCCaTATAAGGGGCTGGAGTGGGTGGCCAACATAAAGCA GGATGGAACTGAGAAATTTTATGTGGACTCTGTGAGGGGCCGATTCA CCATCTCCAGAGACAACGCCAAGAACTTACTGTATCTGGAAATGAAC AACGTGAGAGCCGAGGACATGGCCGTCTATTACTGTGCGAGAGGGC ACTATTTTGACTTCTTCTGGGGCCAGGGAACCCTGGTCACCGTCTCC TCAGGTAAGA 06 januari 2004 Pieter De Schouwer 27

28 06 januari 2004 Pieter De Schouwer 28

29 IGH VH mutatie analyse : results: VH3-21, 99% homologie : results: VH3-7, 91,5% homologie 06 januari 2004 Pieter De Schouwer 29

30 Geen hypermutatie is slechte prognose Estimated median survival time for the VH homology 98% or greater and less than 98% groups were 79 months and 152 months, respectively. Kröber A et al (2002) Blood 100: januari 2004 Pieter De Schouwer 30

31 VH3-21 is slechte prognose Kaplan-Meier curve of the CLL patient material investigated in the study showing mutated (n 79), unmutated (n=134), and VH3-21 cases (n= 31) with a median survival of 137, 64, and 83 months, respectively. Tobin et al (2003) Blood 101: januari 2004 Pieter De Schouwer 31

32 Chromosomale afwijkingen (Binet stageapatients and 98% VH homology cut-off): 17p 36 months, 11q 68 months, VH 98% or greater 86 months, and VH less than 98% not reached (52% survival at 152 months). Kröber A et al (2002) Blood 100: januari 2004 Pieter De Schouwer 32

33 FISH voor 11q-, 17p-, 13q- en p p14 +12q biallelic 13p14- Stilgenbauer S et al. (2002) Leukemia 16(6): januari 2004 Pieter De Schouwer 33

34 17p13-06 januari 2004 Pieter De Schouwer 34

35 biallelic 13p14-06 januari 2004 Pieter De Schouwer 35

36 -13p14 +12q 06 januari 2004 Pieter De Schouwer 36

37 11q23- Mayo Reference Services, Communiqué Januari januari 2004 Pieter De Schouwer 37

38 P53 (17p13) en prognose in CLL VH mutated (n=117) (310 months) P53 loss or mutation (n=6+9) (49 months) VH unmutated (n=73) (119 months) Osier D et al (2002) Blood 100: januari 2004 Pieter De Schouwer 38

39 P53 mutatie: puntmutatie G -> T (A) Control DNA (wild type) (B) mutated (sense sequencing) (C) mutated (antisense sequencing) Lens D et al (1997) Br J Haematol januari 2004 Pieter De Schouwer 39

40 P53 mutatie: in frame met deletie van 27 basen in exon 8 Lens D et al (1997) Blood 89: januari 2004 Pieter De Schouwer 40

41 Moleculaire onco-hematologie Huidige stand van zaken vb. CML Diagnose en MRD opvolging RQ-PCR (real time quantitative PCR) vb. CLL Prognose IGH hypermutatie status sequencing FISH voor chromosomen 12, 13, 11q, 17p p53 mutatie sequencing Chimerisme opsporen bij allogene transplanten Toekomst GEP (Gene expression profiling) = microarray s 06 januari 2004 Pieter De Schouwer 41

42 Chimerisme opsporen ladder acceptor donor post 1 06 januari 2004 Pieter De Schouwer 42

43 Moleculaire onco-hematologie Huidige stand van zaken vb. CML Diagnose en MRD opvolging RQ-PCR (real time quantitative PCR) vb. CLL Prognose IGH hypermutatie status sequencing FISH voor chromosomen 12, 13, 11q, 17p p53 mutatie sequencing Chimerisme opsporen bij allogene transplanten Toekomst GEP (Gene expression profiling) = microarray s 06 januari 2004 Pieter De Schouwer 43

44 GEP en AML FAB-subtypes Clustering of patients based on the expression data of the 213 FAB subtypespecific genes. Each column represents a patient, and each row represents a gene. Patient numbers are colored according to their FAB subtypes. M2-, M4/M5-, and M7-specific genes are indicated by red (A), green (B), and purple (C) vertical bars, respectively. M2, M4/M5, and M7 clusters of patients are indicated by red, green, and purple horizontal bars, respectively. Yagi T. et al (2003) Blood 105, 5 pp januari 2004 Pieter De Schouwer 44

45 GEP en ALL translocaties bij kinderen Fine BM et al (2003) Blood DOI /blood januari 2004 Pieter De Schouwer 45

46 GEP en ALL translocaties bij kinderen Ross ME et al Blood (2003) 102: januari 2004 Pieter De Schouwer 46

47 GEP en ALL translocaties bij kinderen: 31 geselecteerde genen Ross ME et al Blood (2003) 102: januari 2004 Pieter De Schouwer 47

48 Remissie of recidief voor T-ALL bij volwassenen Expression of 19 selected genes in T-ALL from 8 patients who remained in CCR for >2 years and 16 patients who relapsed <2 years after achieving CR. Asterisks identify the top 3 genes that provide the smallest prediction error. Chiaretti S et al Blood (2003); /blood januari 2004 Pieter De Schouwer 48

49 AML met gekende goede of slechte prognose: identificatie van 33 genen Yagi T. et al (2003) Blood 105, 5 pp januari 2004 Pieter De Schouwer 49

50 Toepassen van deze 33 genen op alle gevallen van AML: => twee groepen Yagi T. et al (2003) Blood 105, 5 pp januari 2004 Pieter De Schouwer 50

51 Twee groepen met verschillende overleving (inclusief de gekende prognostische groepen) Yagi T. et al (2003) Blood 105, 5 pp januari 2004 Pieter De Schouwer 51

52 Twee groepen met verschillende overleving (exclusief de gekende prognostische groepen) Yagi T. et al (2003) Blood 105, 5 pp januari 2004 Pieter De Schouwer 52

53 Moleculaire onco-hematologie Huidige stand van zaken vb. CML Diagnose en MRD opvolging RQ-PCR (real time quantitative PCR) vb. CLL Prognose IGH hypermutatie status sequencing FISH voor chromosomen 12, 13, 11q, 17p p53 mutatie sequencing Chimerisme opsporen bij allogene transplanten Toekomst GEP (Gene expression profiling) = microarray s Beste wensen voor januari 2004 Pieter De Schouwer 53

Hematologie: werken in teamverband!

Hematologie: werken in teamverband! Hematologie: werken in teamverband! Hematologie Zeer intense samenwerking tussen clinicus, klinisch bioloog, anatomopatholoog en cytogeneticus is cruciaal Aan hand van twee casussen willen we het zorgpad

Nadere informatie

Overzicht van DNA technieken in de onco-hematologie

Overzicht van DNA technieken in de onco-hematologie Overzicht van DNA technieken in de onco-hematologie Cytogenetica en moleculaire diagnostiek Friedel Nollet, PhD Moleculair Bioloog AZ Sint-Jan Brugge-Oostende AV Overzicht Chromosomen DNA (RNA) Genoom

Nadere informatie

WETENSCHAPPELIJK INSTITUUT VOLKSGEZONDHEID COMMISSIE VOOR KLINISCHE BIOLOGIE DIENST VOOR LABORATORIA VAN KLINISCHE BIOLOGIE COMITE VAN DESKUNDIGEN

WETENSCHAPPELIJK INSTITUUT VOLKSGEZONDHEID COMMISSIE VOOR KLINISCHE BIOLOGIE DIENST VOOR LABORATORIA VAN KLINISCHE BIOLOGIE COMITE VAN DESKUNDIGEN WETENSCHAPPELIJK INSTITUUT VOLKSGEZONDHEID COMMISSIE VOOR KLINISCHE BIOLOGIE DIENST VOOR LABORATORIA VAN KLINISCHE BIOLOGIE COMITE VAN DESKUNDIGEN JAARRAPPORT 2010 EXTERNE KWALITEITSEVALUATIE VOOR ANALYSEN

Nadere informatie

Kwaliteitscontrole binnen de moleculaire diagnostiek van hematologische maligniteiten

Kwaliteitscontrole binnen de moleculaire diagnostiek van hematologische maligniteiten Radboud University Medical Centre Nijmegen Centre for Molecular Life Sciences Kwaliteitscontrole binnen de moleculaire diagnostiek van hematologische maligniteiten Bert van der Reijden, PhD Laboratorium

Nadere informatie

Therapie op maat voor patiënt met Acute lymfatische Leukemie. Dr V. de Haas Kinderarts-oncoloog/hematoloog Hoofd SKION laboratorium

Therapie op maat voor patiënt met Acute lymfatische Leukemie. Dr V. de Haas Kinderarts-oncoloog/hematoloog Hoofd SKION laboratorium Therapie op maat voor patiënt met Acute lymfatische Leukemie Dr V. de Haas Kinderarts-oncoloog/hematoloog Hoofd SKION laboratorium Casus 8-jarig meisje wordt gezien door huisarts - Sinds een week bleek

Nadere informatie

MRD als prognostische merker in CLL

MRD als prognostische merker in CLL MRD als prognostische merker in CLL Jan Philippé 2011 Universitair Ziekenhuis Gent 1 Behandelingsstrategieën bij CLL Cramer & Hallek Nat Rev Clin Oncol 2010 2 2 Hoe kan men CLL opvolgen? Watch and wait

Nadere informatie

Dysplasie in AML en (cyto)genetische. afwijkingen: Chromosoom 3q26 afwijkingen en EVI1

Dysplasie in AML en (cyto)genetische. afwijkingen: Chromosoom 3q26 afwijkingen en EVI1 Dysplasie in AML en (cyto)genetische afwijkingen: Chromosoom 3q26 afwijkingen en EVI1 patient 0390606 BM H11-172 8-2-2011 patient 0390606 dag 24 kuur I H11-428 4-4-2011 patient 0390606 dag 24 kuur I H11-428

Nadere informatie

MOLECULAIRE BIOLOGIE Artikel 33 bis

MOLECULAIRE BIOLOGIE Artikel 33 bis U FEDERALE OVERHEIDSDIENST, VOLKSGEZONDHEID, VEILIGHEID VAN DE VOEDSELKETEN EN LEEFMILIEU COMMISSIE VOOR KLINISCHE BIOLOGIE DIENST VOOR LABORATORIA VAN KLINISCHE BIOLOGIE COMITE VAN DESKUNDIGEN JAARRAPPORT

Nadere informatie

Toegespitste benadering voor de individuele patiënt met acute myeloïde leukemie

Toegespitste benadering voor de individuele patiënt met acute myeloïde leukemie Toegespitste benadering voor de individuele patiënt met acute myeloïde leukemie 4 oktober 2018 Jurjen Versluis j.versluis.1@erasmusmc.nl Klinische Dag NVvH 04 oktober 2018 Disclosure belangen Jurjen Versluis

Nadere informatie

De moleculaire diagnostiek van B-NHL: detectie van breuken met behulp van FISH

De moleculaire diagnostiek van B-NHL: detectie van breuken met behulp van FISH De moleculaire diagnostiek van B-NHL: detectie van breuken met behulp van FISH Philip Kluin, UMCG, Daphne de Jong, VUMC Yvonne van Norden, HOVON en Alle deelnemers HOVON kwaliteitsronde De oorsprong en

Nadere informatie

Minimal Residual Disease (MRD)) onderzoek. bij hematologische maligniteiten

Minimal Residual Disease (MRD)) onderzoek. bij hematologische maligniteiten Minimal Residual Disease (MRD)) onderzoek bij hematologische maligniteiten MRD Principe, doel en eigenschappen Technieken voor MRD analyse Klinische toepassingen Minimal Residual Disease Bij diagnose:

Nadere informatie

Figure 1 Shares of Students in Basic, Middle, and Academic Track of Secondary School Academic Track Middle Track Basic Track 29 Figure 2 Number of Years Spent in School by Basic Track Students 9.5 Length

Nadere informatie

Van transplantatie tot pil

Van transplantatie tot pil Van transplantatie tot pil Ontwikkelingen binnen de afdeling Hematologie Hanneke C. Kluin-Nelemans Afdeling Hematologie samen werken aan de zorg voor kanker Hematologen houden van bloed! Afdeling Hematologie

Nadere informatie

Chronische Lymfatische Leukemie. anno 2015

Chronische Lymfatische Leukemie. anno 2015 Chronische Lymfatische Leukemie anno 2015 Marten R. Nijziel, internist-hematoloog Máxima Medisch Centrum Eindhoven/Veldhoven Hematon Leukemiedag Soesterberg, 3 oktober 2015 Wat is CLL? Wat is nodig voor

Nadere informatie

Een patiente met acute leukemie Bloed en beenmerg Acute leukemie Chronische leukemie

Een patiente met acute leukemie Bloed en beenmerg Acute leukemie Chronische leukemie Thema: Leukemie Een patiente met acute leukemie Bloed en beenmerg Acute leukemie Chronische leukemie Prof.dr. Hanneke C. Kluin-Nelemans Afdeling Hematologie Samenstelling van onstolbaar gemaakt bloed Bloedcellen

Nadere informatie

FRAME [UPRIGHT MODEL] / [DEPTH] / [HEIGHT] / [FINISH] TYPE OF BASEPLATE P Base plate BP80 / E alternatives: ZINC finish in all cases

FRAME [UPRIGHT MODEL] / [DEPTH] / [HEIGHT] / [FINISH] TYPE OF BASEPLATE P Base plate BP80 / E alternatives: ZINC finish in all cases FRAME XS UPRIGHT BASE PLATE UPRIGHT HORIZONTAL PROFILE DIAGONAL PROFILE DESCRIPTION A vertical structure consisting of 2 uprights, joined by a system of bracing profiles, and base plates intended to support

Nadere informatie

CAR-T THERAPIE VOOR ACUTE LEUKEMIE: SUCCESSEN, UITDAGINGEN, OPEN VRAGEN

CAR-T THERAPIE VOOR ACUTE LEUKEMIE: SUCCESSEN, UITDAGINGEN, OPEN VRAGEN DIENST HEMATOLOGIE UZ GENT CAR-T THERAPIE VOOR ACUTE LEUKEMIE: SUCCESSEN, UITDAGINGEN, OPEN VRAGEN PENTALFA 15 NOVEMBER 2018 Prof. Dr. Tessa Kerre UZG ACUTE LEUKEMIE: ALL VS AML VS MPAL 2 ALL VS AML Hematopoëse

Nadere informatie

Persisterende complete moleculaire remissie na imatinib behandeling voor chronische fase CML. wat nu?

Persisterende complete moleculaire remissie na imatinib behandeling voor chronische fase CML. wat nu? Persisterende complete moleculaire remissie na imatinib behandeling voor chronische fase CML wat nu? J.H.F Falkenburg Afdeling Hematologie Leids Universitair Medisch Centrum Geen conflicts of interest

Nadere informatie

Mutaties in MPN en de impact op de nieuwe WHO criteria

Mutaties in MPN en de impact op de nieuwe WHO criteria Mutaties in MPN en de impact op de nieuwe WHO criteria Bert van der Reijden, PhD Laboratory of Hematology Dept of Laboratory Medicine Radboud UMC, Nijmegen The Netherlands Week van de pathologie, 28 maart

Nadere informatie

GOVERNMENT NOTICE. STAATSKOERANT, 18 AUGUSTUS 2017 No NATIONAL TREASURY. National Treasury/ Nasionale Tesourie NO AUGUST

GOVERNMENT NOTICE. STAATSKOERANT, 18 AUGUSTUS 2017 No NATIONAL TREASURY. National Treasury/ Nasionale Tesourie NO AUGUST National Treasury/ Nasionale Tesourie 838 Local Government: Municipal Finance Management Act (56/2003): Draft Amendments to Municipal Regulations on Minimum Competency Levels, 2017 41047 GOVERNMENT NOTICE

Nadere informatie

Themaweek dikke darmkanker

Themaweek dikke darmkanker Themaweek dikke darmkanker AZ Sint-Lucas Gent Workshop 4 De artsen van AZ Sint-Lucas hebben deze presentatie met zorg opgemaakt. De inhoud ervan is echter algemeen en indicatief. AZ Sint-Lucas en de artsen

Nadere informatie

CML Chronische Myeloide Leukemie

CML Chronische Myeloide Leukemie CML Chronische Myeloide Leukemie Dr. Peter E. Westerweel, Internist-hematoloog Albert Schweitzer Ziekenhuis Dordrecht Hematon patientvereniging Landelijke contactdag 10 mei 2014 Lezing Wat is CML? Enige

Nadere informatie

Post-ASCO 2014 Nieuwe geneesmiddelen. Hans Gelderblom

Post-ASCO 2014 Nieuwe geneesmiddelen. Hans Gelderblom Post-ASCO 2014 Nieuwe geneesmiddelen Hans Gelderblom Disclosure belangen spreker (potentiële) belangenverstrengeling Voor bijeenkomst mogelijk relevante relaties met bedrijven Sponsoring of onderzoeksgeld

Nadere informatie

CML Stoppen van TKI behandeling

CML Stoppen van TKI behandeling CML Stoppen van TKI behandeling Nicole Blijlevens, internist-hematoloog Doelen van CML behandeling 1. Overleving - voorkomen progressie - voorkomen CML-gerelateerde dood 2. Tolereerbare behandeling 3.

Nadere informatie

Lichamelijke factoren als voorspeller voor psychisch. en lichamelijk herstel bij anorexia nervosa. Physical factors as predictors of psychological and

Lichamelijke factoren als voorspeller voor psychisch. en lichamelijk herstel bij anorexia nervosa. Physical factors as predictors of psychological and Lichamelijke factoren als voorspeller voor psychisch en lichamelijk herstel bij anorexia nervosa Physical factors as predictors of psychological and physical recovery of anorexia nervosa Liesbeth Libbers

Nadere informatie

Chronische lymfatische leukemie Arnon Kater

Chronische lymfatische leukemie Arnon Kater Chronische lymfatische leukemie Arnon Kater http://www.lymmcare.nl/ CLL Epidemiologie Prognostische factoren Biologie en targeted therapy Huidige behandeling en studies CLL: epidemiologie CLL is de meest

Nadere informatie

CLL in de praktijk. Moderator Prof. Dr. J.H. Veelken. 1st author / speaker Arnon Kater

CLL in de praktijk. Moderator Prof. Dr. J.H. Veelken. 1st author / speaker Arnon Kater CLL in de praktijk Moderator Prof. Dr. J.H. Veelken 1st author / speaker Arnon Kater Belangenverklaring In overeenstemming met de regels van de Inspectie van de Gezondheidszorg (IGZ) Naam: Organisatie:

Nadere informatie

Nederlandse samenvatting

Nederlandse samenvatting Nieuwe vooruitzichten in de karakterisering en behandeling van acute myeloïde leukemie Nederlandse samenvatting 134 Acute myeloïde leukemie (AML) is een vorm van bloedkanker, een kwaadaardige aandoening

Nadere informatie

Common Mental Disorders Prediction of Sickness Absence Durations and Recurrences. Giny Norder NVAB kring Noord 14 april 2016

Common Mental Disorders Prediction of Sickness Absence Durations and Recurrences. Giny Norder NVAB kring Noord 14 april 2016 Common Mental Disorders Prediction of Sickness Absence Durations and Recurrences Giny Norder NVAB kring Noord 14 april 2016 Common Mental Disorders Prediction of Sickness Absence Durations and Recurrences

Nadere informatie

SUPPLEMENTARY FIGURES AND TABLES

SUPPLEMENTARY FIGURES AND TABLES Altered RECQL5 expression in urothelial bladder carcinoma increases cellular proliferation and makes RECQL5 helicase activity a novel target for chemotherapy SUPPLEMENTARY FIGURES AND TABLES Supplementary

Nadere informatie

Pharmacogenomics: een uitdaging voor de Moleculaire Diagnostiek in de Pathologie

Pharmacogenomics: een uitdaging voor de Moleculaire Diagnostiek in de Pathologie Pharmacogenomics: een uitdaging voor de Moleculaire Diagnostiek in de Pathologie Winand Dinjens Afdeling Pathologie Josephine Nefkens Instituut Erasmus MC, Rotterdam w.dinjens@erasmusmc.nl Werkgroep Moleculaire

Nadere informatie

Molecular Pathology for Pathologists. Pr P. Pauwels

Molecular Pathology for Pathologists. Pr P. Pauwels Molecular Pathology for Pathologists Pr P. Pauwels NGS moleculair pathologie rapport ontcijferen Nomenclatuur waarin gerapporteerd wordt: EGFR c.2573t>g, p.(leu858arg) Coderende sequentie Eiwit/proteïne

Nadere informatie

De achilleshiel van CLL

De achilleshiel van CLL De achilleshiel van CLL Dr. S.H. Tonino 22 november 2012 Afdeling Hematologie AMC, Amsterdam Chronische lymfatische leukemie 1. wat is chronische lymfatische leukemie (CLL?) 2. behandeling anno 2012 3.

Nadere informatie

Nieuwe middelen in acute lymfatische leukemie. Anita W Rijneveld Erasmus MC, Rotterdam

Nieuwe middelen in acute lymfatische leukemie. Anita W Rijneveld Erasmus MC, Rotterdam Nieuwe middelen in acute lymfatische leukemie Anita W Rijneveld Erasmus MC, Rotterdam EFS bij volwassenen 100% 80% 1989-1994 1995-2000 2001-2006 2007-2012 RSR 60% 40% 2007-2012 20% 0% 1989-1994 0 1 2 3

Nadere informatie

Moleculaire markers & risicostratificatie in 2020

Moleculaire markers & risicostratificatie in 2020 Moleculaire markers & risicostratificatie in 2020 Belangenverklaring NAAM :J.H. Jansen ORGANISATIE: Radboudumc In overeenstemming met de regels van de Inspectie van de Gezondheidszorg (IGZ), zijn sprekers

Nadere informatie

PROJECT PREMIER PRECISE MUTATION ANALYSIS IN EMERGING TKI RESISTANCE

PROJECT PREMIER PRECISE MUTATION ANALYSIS IN EMERGING TKI RESISTANCE PROJECT PREMIER PRECISE MUTATION ANALYSIS IN EMERGING TKI RESISTANCE Next Generation Sequencing (NGS) BCR-ABL1 puntmutatietest voor optimale monitoring van CML en Ph+ ALL patiënten Voordelen NGS BCR-ABL1

Nadere informatie

Gastro-intestinale stromacel tumor: Risico classificatie en mutatie analyse door de patholoog. Dr. Judith V.M.G. Bovee Patholoog LUMC

Gastro-intestinale stromacel tumor: Risico classificatie en mutatie analyse door de patholoog. Dr. Judith V.M.G. Bovee Patholoog LUMC Gastro-intestinale stromacel tumor: Risico classificatie en mutatie analyse door de patholoog Dr. Judith V.M.G. Bovee Patholoog LUMC GastroIntestinale Stromacel Tumor 11-15 GISTen per 100.000 mensen (Scandinavië)

Nadere informatie

Genes, Molecular Mechanisms and Risk Prediction for Abdominal Aortic Aneurysm

Genes, Molecular Mechanisms and Risk Prediction for Abdominal Aortic Aneurysm Genes, Molecular Mechanisms and Risk Prediction for Abdominal Aortic Aneurysm Arne IJpma Clinical Genetics Department, Erasmus MC, Rotterdam, The Netherlands Financial Disclosure I have no financial relationships

Nadere informatie

Inhoud. Schematische voorstelling van de afname van leukemiecellen in de loop van de behandeling

Inhoud. Schematische voorstelling van de afname van leukemiecellen in de loop van de behandeling CML Patiënten Pas De behandeling van chronische myeloïde leukemie (CML) is gericht op het doden van tenminste 99,9% van de leukemiecellen in de eerste 12 maanden van de behandeling. In de meeste gevallen

Nadere informatie

Integrale diagnostiek van hematologische maligniteiten in bloed en beenmerg

Integrale diagnostiek van hematologische maligniteiten in bloed en beenmerg Integrale diagnostiek van hematologische maligniteiten in bloed en beenmerg Wat de afdeling Hematologie VU medisch centrum u, in nauwe samenwerking met de afdelingen Klinische Genetica en Pathologie, te

Nadere informatie

WHO classificatie AML RBM 15-januari 2009

WHO classificatie AML RBM 15-januari 2009 WHO classificatie AML 2008 RBM 15-januari 2009 AML > 20% blasten in beenmerg of bloed uitzondering AML met t(8;21), inv(16),t(16;16) of t(15;17) Promonocyten worden bij de blasten gerekend AML with recurrent

Nadere informatie

Van Samenwerking tot Valorisatie in Translationeel Diabetes Onderzoek

Van Samenwerking tot Valorisatie in Translationeel Diabetes Onderzoek Centrum voor Medische Innovatie Van Samenwerking tot Valorisatie in Translationeel Diabetes Onderzoek Bart Keymeulen M.D. Ph.D. Hoofd Klinische Studies van Center for Beta Cell Therapy in Diabetes Senior

Nadere informatie

MOLECULAIRE EN CYTOGENETISCHE AFWIJKINGEN BIJ EEN THERAPIE-

MOLECULAIRE EN CYTOGENETISCHE AFWIJKINGEN BIJ EEN THERAPIE- MOLECULAIRE EN CYTOGENETISCHE AFWIJKINGEN BIJ EEN THERAPIE- GERELATEERDE MYELOÏDE NEOPLASIE: NUT VAN DIAGNOSTIEK? ARIANE LUYCKX CAT VOORSTELLING 27-03-2012 PROMOTOR - PROF. DR. N. BOECKX, MET DANK AAN

Nadere informatie

Minimale restziekte en leukemische stamceldetectie bij acute myeloïde leukemie: nieuwe aanpak van klinische besluitvorming

Minimale restziekte en leukemische stamceldetectie bij acute myeloïde leukemie: nieuwe aanpak van klinische besluitvorming Minimale restziekte en leukemische stamceldetectie bij acute myeloïde leukemie: nieuwe aanpak van klinische besluitvorming Minimal residual disease and leukemic stem cell detection in acute myeloid leukemia:

Nadere informatie

Presentatie Een 24-jarige vrouw presenteert zich met hypermenorrhoea, veel hematomen en bloedneuzen. Haar vorige menstruatie verliep normaal.

Presentatie Een 24-jarige vrouw presenteert zich met hypermenorrhoea, veel hematomen en bloedneuzen. Haar vorige menstruatie verliep normaal. CASUS 2 Presentatie Een 24-jarige vrouw presenteert zich met hypermenorrhoea, veel hematomen en bloedneuzen. Haar vorige menstruatie verliep normaal. Lichamelijk onderzoek Bleek, veel hematomen, veel bloed

Nadere informatie

Is er een rol voor het gebruik van Immunoglobulinen bij CML? M. Roeven Canisius Wilhemina Ziekenhuis Nijmegen

Is er een rol voor het gebruik van Immunoglobulinen bij CML? M. Roeven Canisius Wilhemina Ziekenhuis Nijmegen Is er een rol voor het gebruik van Immunoglobulinen bij CML? M. Roeven Canisius Wilhemina Ziekenhuis Nijmegen Opbouw Casus Bespreking literatuur Hypothesen met betrekking tot casus Voorgeschiedenis: 1957

Nadere informatie

Hodgkin lymfoom. Elly Lugtenburg 11 de nascholing hematologie verpleegkundigen 16 Maart 2018

Hodgkin lymfoom. Elly Lugtenburg 11 de nascholing hematologie verpleegkundigen 16 Maart 2018 Hodgkin lymfoom Elly Lugtenburg 11 de nascholing hematologie verpleegkundigen 16 Maart 2018 11 de nascholing Hematologie verpleegkundigen 16 Maart 2018 Disclosure belangen: PJ Lugtenburg Voor bijeenkomst

Nadere informatie

Werkstuk Biologie Het onstaan van chronische myeloide leukemie

Werkstuk Biologie Het onstaan van chronische myeloide leukemie Werkstuk Biologie Het onstaan van chronische myeloide leukemie Werkstuk door een scholier 1565 woorden 6 februari 2006 6,3 32 keer beoordeeld Vak Biologie Inleiding: Leukemie is een vorm van kanker, namelijk

Nadere informatie

Socio-economic situation of long-term flexworkers

Socio-economic situation of long-term flexworkers Socio-economic situation of long-term flexworkers CBS Microdatagebruikersmiddag The Hague, 16 May 2013 Siemen van der Werff www.seo.nl - secretariaat@seo.nl - +31 20 525 1630 Discussion topics and conclusions

Nadere informatie

Prognostische toepassing van flowcytometrie bij het myelodysplastisch syndroom

Prognostische toepassing van flowcytometrie bij het myelodysplastisch syndroom Workshop Flowcytometrie in MDS 5 september 2012 Prognostische toepassing van flowcytometrie bij het myelodysplastisch syndroom Canan Alhan VU Medisch Centrum Cancer Center Amsterdam Klinische prognostische

Nadere informatie

Down syndroom en myeloide proliferaties. Marjolein Blink

Down syndroom en myeloide proliferaties. Marjolein Blink Down syndroom en myeloide proliferaties Marjolein Blink Overzicht presentatie Syndroom van Down en leukemie TMD (transiente leukemie) en ML-DS (Myeloid Leukemia of Down Syndrome) TMD screeningsstudie Casus

Nadere informatie

K.B In werking B.S

K.B In werking B.S K.B. 4.5.2010 In werking 1.8.2010 B.S. 7.6.2010 Artikel 33bis GENETISCHE ONDERZOEKEN Wijzigen Invoegen Verwijderen 1. Moleculaire Biologische testen op menselijk genetisch materiaal bij verworven aandoeningen.

Nadere informatie

CML en stoppen moleculaire diagnostiek

CML en stoppen moleculaire diagnostiek CML en stoppen moleculaire diagnostiek Moderator Dr. P. Kuiper-Kramer 1st author / speaker Dr. Bert A. van der Reijden Bert.vanderReijden@radboudumc.nl Dept of Laboratory Medicine, Laboratory of Hematology

Nadere informatie

Reeks 13 Vergeten Organen Avond 5: Het bloed Prof.dr. Schouten

Reeks 13 Vergeten Organen Avond 5: Het bloed Prof.dr. Schouten Reeks 13 Vergeten Organen Avond 5: Het bloed Prof.dr. Schouten Hematologie voor de Dummies Gezondheidsuniversiteit PSC MSC plt ery mono neutro eo baso LSC Blympho T lympho PSC SCF MSC IL3 LSC GM-CSF MPL

Nadere informatie

GENETISCHE ONDERZOEKEN Art. 33bis pag. 1 officieuze coördinatie

GENETISCHE ONDERZOEKEN Art. 33bis pag. 1 officieuze coördinatie GENETISCHE ONDERZOEKEN Art. 33bis pag. 1 "Artikel 33bis. 1. Moleculaire Biologische testen op menselijk genetisch materiaal bij verworven aandoeningen." "K.B. 31.8.2009" (in werking 1.11.2009) "A." + "

Nadere informatie

K.B B.S Erratum B.S In werking

K.B B.S Erratum B.S In werking K.B. 18.6.2017 B.S. 29.6.2017 + Erratum B.S. 14.7.2017 In werking 1.8.2017 Artikel 33bis GENETISCHE ONDERZOEKEN Wijzigen Invoegen Verwijderen 1. Moleculaire Biologische testen op menselijk genetisch materiaal

Nadere informatie

Digital municipal services for entrepreneurs

Digital municipal services for entrepreneurs Digital municipal services for entrepreneurs Smart Cities Meeting Amsterdam October 20th 2009 Business Contact Centres Project frame Mystery Shopper Research 2006: Assessment services and information for

Nadere informatie

Laboratoriumdiagnostiek hematologische maligniteiten Radboud universitair medisch centrum

Laboratoriumdiagnostiek hematologische maligniteiten Radboud universitair medisch centrum Laboratoriumdiagnostiek hematologische maligniteiten Radboud universitair medisch centrum Versie 3 08-2015 Inhoudsopgave Introductie 3 Contact informatie 4 Benodigde materialen 5 Acute Myeloïde Leukemie

Nadere informatie

Multipel myeloom 2012

Multipel myeloom 2012 Multipel myeloom 2012 Op weg naar genezing? Prof. Dr. R Schots MYELOOMKLINIEK UZ Brussel Mijlpalen in de geschiedenis 1969 2008 1996 Mijlpalen in de behandeling van multipel myeloom Autologe stamceltransplantatie

Nadere informatie

Acute Lymfatische Leukemie bij kinderen

Acute Lymfatische Leukemie bij kinderen Acute Lymfatische Leukemie bij kinderen 6 e symposium hematomorfologie, Rotterdam op 31 maart 2016 Auke Beishuizen Kinderarts oncoloog/ hematoloog Erasmus MC Sophia Kinderziekenhuis Inhoud - Inleiding/

Nadere informatie

Psychometrische Eigenschappen van de Youth Anxiety Measure for DSM-5 (YAM-5) Psychometric Properties of the Youth Anxiety Measure for DSM-5 (YAM-5)

Psychometrische Eigenschappen van de Youth Anxiety Measure for DSM-5 (YAM-5) Psychometric Properties of the Youth Anxiety Measure for DSM-5 (YAM-5) Psychometrische Eigenschappen van de Youth Anxiety Measure for DSM-5 (YAM-5) Psychometric Properties of the Youth Anxiety Measure for DSM-5 (YAM-5) Hester A. Lijphart Eerste begeleider: Dr. E. Simon Tweede

Nadere informatie

Voorstellen. Winnie van El Verpleegkundig Specialist Diabeteszorg Universitair Medisch Centrum Groningen

Voorstellen. Winnie van El Verpleegkundig Specialist Diabeteszorg Universitair Medisch Centrum Groningen Voorstellen Winnie van El Verpleegkundig Specialist Diabeteszorg Universitair Medisch Centrum Groningen Niertransplantatie UMCG Niertransplantatie 8 centra NL * UMC 1 e jaar UMC vervolg 2 e lijn, periferie

Nadere informatie

SAMPLE 11 = + 11 = + + Exploring Combinations of Ten + + = = + + = + = = + = = 11. Step Up. Step Ahead

SAMPLE 11 = + 11 = + + Exploring Combinations of Ten + + = = + + = + = = + = = 11. Step Up. Step Ahead 7.1 Exploring Combinations of Ten Look at these cubes. 2. Color some of the cubes to make three parts. Then write a matching sentence. 10 What addition sentence matches the picture? How else could you

Nadere informatie

Acute myeloïde leukemie. Annoek Broers 7e nascholing hematologie 20-03-2014

Acute myeloïde leukemie. Annoek Broers 7e nascholing hematologie 20-03-2014 Acute myeloïde leukemie Annoek Broers 7e nascholing hematologie 20-03-2014 Bloedcelvorming - hematopoiese selfrenewal Multilineage differentiation Acute myeloïde leukemie - AML Normaal beenmerg Bloedarmoede

Nadere informatie

K.B In werking B.S

K.B In werking B.S K.B. 11.9.2016 In werking 1.11.2016 B.S. 27.9.2016 Artikel 33bis GENETISCHE ONDERZOEKEN Wijzigen Invoegen Verwijderen 1. Moleculaire Biologische testen op menselijk genetisch materiaal bij verworven aandoeningen.

Nadere informatie

POH-GGZ, Jim van Os

POH-GGZ, Jim van Os Het nut van specialisatie? POH-GGZ, 02-02-2017 Jim van Os Nee het is depressie..ander zorgpad Nee het is psychose..ander zorgpad Nee het is verslaving.ander zorgpad Nee het is persoonlijkheid.ander zorgpad

Nadere informatie

Prognose en kwaliteit van leven na cardio-pulmonaire reanimatie

Prognose en kwaliteit van leven na cardio-pulmonaire reanimatie Prognose en kwaliteit van leven na cardio-pulmonaire reanimatie D. Benoit, MD, PhD Intensieve Zorgen 12K12IB Ghent University Hospital Medicine is learned by the bedside and not in the classroom. Let not

Nadere informatie

73e NVVO dag Multipel Myeloom moleculaire diagnose, prognose en behandeling (basale aspecten)

73e NVVO dag Multipel Myeloom moleculaire diagnose, prognose en behandeling (basale aspecten) 73e NVVO dag 30-09-2015 Multipel Myeloom moleculaire diagnose, prognose en behandeling (basale aspecten) Dr. A. Broijl, hematoloog ErasmusMC Kankerinstituut Disclosure belangen spreker (potentiële) belangenverstrengeling

Nadere informatie

Ontpopping. ORGACOM Thuis in het Museum

Ontpopping. ORGACOM Thuis in het Museum Ontpopping Veel deelnemende bezoekers zijn dit jaar nog maar één keer in het Van Abbemuseum geweest. De vragenlijst van deze mensen hangt Orgacom in een honingraatpatroon. Bezoekers die vaker komen worden

Nadere informatie

Translocatie Detectie Met Behulp Van Targeted Next Generation Sequencing In FFPE Weefsels. Tom van Wezel Pathologie LUMC

Translocatie Detectie Met Behulp Van Targeted Next Generation Sequencing In FFPE Weefsels. Tom van Wezel Pathologie LUMC Translocatie Detectie Met Behulp Van Targeted Next Generation Sequencing In FFPE Weefsels Tom van Wezel Pathologie LUMC Tom van Wezel 14-Mar-16 Gene fusions in cancer The emerging complexity of gene fusions

Nadere informatie

Kanker Instituut. Integrale Diagnostiek Hemato-oncologische Laboratoria Erasmus MC Rotterdam. Hematologie Immunologie Klinische Genetica Pathologie

Kanker Instituut. Integrale Diagnostiek Hemato-oncologische Laboratoria Erasmus MC Rotterdam. Hematologie Immunologie Klinische Genetica Pathologie Kanker Instituut Integrale Diagnostiek Hemato-oncologische Laboratoria Erasmus MC Rotterdam Hematologie Immunologie Klinische Genetica Pathologie 2017 Introductie Integrale diagnostiek is van essentieel

Nadere informatie

Acute myeloïde leukemie. Dimitri A. Breems, MD, PhD Internist-Hematoloog Ziekenhuis Netwerk Antwerpen

Acute myeloïde leukemie. Dimitri A. Breems, MD, PhD Internist-Hematoloog Ziekenhuis Netwerk Antwerpen Acute myeloïde leukemie Dimitri A. Breems, MD, PhD Internist-Hematoloog Ziekenhuis Netwerk Antwerpen Normale bloedcelvorming Acute myeloïde leukemie (AML) Klonale proliferatie van immature hematopoëtische

Nadere informatie

B-cel-chronische lymfatische leukemie: risicostratificatie en behandeling

B-cel-chronische lymfatische leukemie: risicostratificatie en behandeling B-cel-chronische lymfatische leukemie: risicostratificatie en behandeling Auteur Trefwoorden M.H.J. van Oers B-cel-chronische lymfatische leukemie, prognose, behandeling Samenvatting Nog niet zo lang geleden

Nadere informatie

Melanoom Niet één diagnose, niet één standaardbehandeling

Melanoom Niet één diagnose, niet één standaardbehandeling Melanoom Niet één diagnose, niet één standaardbehandeling Wolter J. Mooi VU medisch centrum Amsterdam Melanoomclassificatie Superficieel spreidend melanoom Nodulair melanoom Acrolentigineus melanoom Lentigo

Nadere informatie

K.B In werking B.S

K.B In werking B.S K.B. 18.3.2011 In werking 1.5.2011 B.S. 30.3.2011 Artikel 33bis GENETISCHE ONDERZOEKEN Wijzigen Invoegen Verwijderen 1. Moleculaire Biologische testen op menselijk genetisch materiaal bij verworven aandoeningen.

Nadere informatie

Bijlage bij EsPhALL2017/COGAALL1631

Bijlage bij EsPhALL2017/COGAALL1631 Bijlage bij International phase 3 trial in Philadelphia chromosomepositive acute lymphoblastic leukemia (Ph+ ALL) testing imatinib in combination with two different cytotoxic chemotherapy backbones EsPhALL

Nadere informatie

Uitkomstenonderzoek in non-hodgkin lymphoma. Hedwig Blommestein

Uitkomstenonderzoek in non-hodgkin lymphoma. Hedwig Blommestein Uitkomstenonderzoek in non-hodgkin lymphoma ~Kansen en uitdagingen~ Hedwig Blommestein Inleiding Inhoud presentatie Uitkomstenonderzoek Casus rituximab maintenance Achtergrond Resultaten t Conclusie Uitkomstenonderzoek

Nadere informatie

Secundaire ijzerstapeling

Secundaire ijzerstapeling Secundaire ijzerstapeling een belangrijke chronische transfusiecomplicatie Marlijn Hoeks Hematoloog io Radboudumc PhD student CCTR Sanquin Research Leiden 29-11-2017 1 Inhoud Achtergrond secundaire ijzerstapeling

Nadere informatie

Intensivering deel IIA en IIB (duur circa 50 dagen)

Intensivering deel IIA en IIB (duur circa 50 dagen) HOVON 70 Samenvatting + Checklist Geheugensteun HOVON 70 studie opbergen in polistatus, kopie klinische status Naam patiënt.. AZG nummer.. Geboortedatum.. -.. 19.. Datum Dag 0: Pre-fase (duur 1 week) Dag

Nadere informatie

EuroClonality Kwaliteitsrondzendingen via het web: Voor interpretatie van B- en T-cel clonaliteits analyse

EuroClonality Kwaliteitsrondzendingen via het web: Voor interpretatie van B- en T-cel clonaliteits analyse EuroClonality Kwaliteitsrondzendingen via het web: Voor interpretatie van B- en T-cel clonaliteits analyse Dr. Patricia Groenen Moleculaire Pathologie Radboud University Nijmegen Medical Centre (RUNMC)

Nadere informatie

Innovatie in de Hematologie. het belang van onderzoek en toetsing. Prof. Dr. P. Sonneveld Afdeling Hematologie Erasmus MC Rotterdam

Innovatie in de Hematologie. het belang van onderzoek en toetsing. Prof. Dr. P. Sonneveld Afdeling Hematologie Erasmus MC Rotterdam Innovatie in de Hematologie het belang van onderzoek en toetsing Prof. Dr. P. Sonneveld Afdeling Hematologie Erasmus MC Rotterdam Hematologie Ziekten van bloed, beenmerg en lymfeklieren Acute en chronische

Nadere informatie

Folliculair Lymfoom graad 3B (FL3B)

Folliculair Lymfoom graad 3B (FL3B) Nederlandse samenvatting Folliculair Lymfoom graad 3B (FL3B) Inleiding Een maligne lymfoom is een kwaadaardige woekering van witte bloedcellen die zich meestal manifesteert in lymfeklieren en zich verspreidt

Nadere informatie

Leukemie: spellingsfouten in de DNA code

Leukemie: spellingsfouten in de DNA code Leukemie: spellingsfouten in de DNA code Prof. Jan Cools KU Leuven - Centrum voor Menselijke Erfelijkheid VIB - Center for the Biology of Disease contact: jan.cools@med.kuleuven.be Overzicht 1. De werking

Nadere informatie

HLA-B*27 diagnostiek: is sequentie analyse the way to go?

HLA-B*27 diagnostiek: is sequentie analyse the way to go? HLA-B*27 diagnostiek: is sequentie analyse the way to go? 14 juni 2011 Bouke Hepkema Transplantatie-Immunologie Laboratoriumgeneeskunde UMCG Kwaliteit in Harmonisatie of Harmonisatie in Kwaliteit UMCG

Nadere informatie

c-met amplificatie/ exon14 skippingpatiënt L. Hijmering/Harry J M Groen Longarts UMCG

c-met amplificatie/ exon14 skippingpatiënt L. Hijmering/Harry J M Groen Longarts UMCG c-met amplificatie/ exon14 skippingpatiënt L. Hijmering/Harry J M Groen Longarts UMCG Voorgeschiedenis 2000 Femoralis stent. 2016 ct2bn3m1b adenocarcinoom van de long uitgaande van de LBK met o.a. hersenmetastasen

Nadere informatie

Leukemie op de kinderleeftijd. Eveline de Bont, hoofd kinderoncologie/hematologie, Beatrix Kinderziekenhuis, UMCG, Groningen

Leukemie op de kinderleeftijd. Eveline de Bont, hoofd kinderoncologie/hematologie, Beatrix Kinderziekenhuis, UMCG, Groningen Leukemie op de kinderleeftijd Eveline de Bont, hoofd kinderoncologie/hematologie, Beatrix Kinderziekenhuis, UMCG, Groningen André Mulder, arts klinisch chemicus, Laboratoriumgeneeskunde, UMCG, Groningen

Nadere informatie

Hematologische tumoren hoever is IO therapie? Monique Minnema, hematoloog UMC Utrecht Cancer Center 2 de multidisciplinair IO symposium

Hematologische tumoren hoever is IO therapie? Monique Minnema, hematoloog UMC Utrecht Cancer Center 2 de multidisciplinair IO symposium Hematologische tumoren hoever is IO therapie? Monique Minnema, hematoloog UMC Utrecht Cancer Center 2 de multidisciplinair IO symposium Vraag 1: Behandelt u patiënten met Morbus Hodgkin? 1. ja 2. nee Vraag

Nadere informatie

OLIJFdag 3 oktober 2015

OLIJFdag 3 oktober 2015 OLIJFdag 3 oktober 2015 Nieuwe behandelingen bij eierstokkanker Els Witteveen Internist-oncoloog Huidige en nieuwe inzichten Intraperitoneale toediening Toevoeging van bevacizumab Dose dense toediening

Nadere informatie

Moleculaire diagnostiek in de Klinische Biologie Spek voor mijn bek?

Moleculaire diagnostiek in de Klinische Biologie Spek voor mijn bek? Moleculaire diagnostiek in de Klinische Biologie Spek voor mijn bek? Datum: Dinsdag 6 januari 2004 Aanvang: 12.00 u Lokatie: Auditorium GA1 Onderwijs & Navorsing, UZ-Gasthuisberg Herestraat 49, 3000 12.00

Nadere informatie

Immuunmodelutoire interventies rond allogene stamceltransplantaties

Immuunmodelutoire interventies rond allogene stamceltransplantaties Immuunmodelutoire interventies rond allogene stamceltransplantaties Moderator Dr E. Meijer Speaker Dr. M.D. Hazenberg Belangenverklaring In overeenstemming met de regels van de Inspectie van de Gezondheidszorg

Nadere informatie

Global TV Canada s Pulse 2011

Global TV Canada s Pulse 2011 Global TV Canada s Pulse 2011 Winnipeg Nobody s Unpredictable Methodology These are the findings of an Ipsos Reid poll conducted between August 26 to September 1, 2011 on behalf of Global Television. For

Nadere informatie

NEDERLANDSE SAMENVATTING

NEDERLANDSE SAMENVATTING 2 NEDERLANDSE SAMENVATTING VOOR NIET-INGEWIJDEN In gezonde personen is er een goede balans tussen cellen die delen en cellen die doodgaan. In sommige gevallen wordt deze balans verstoord en delen cellen

Nadere informatie

Engels op Niveau A2 Workshops Woordkennis 1

Engels op Niveau A2 Workshops Woordkennis 1 A2 Workshops Woordkennis 1 A2 Workshops Woordkennis 1 A2 Woordkennis 1 Bestuderen Hoe leer je 2000 woorden? Als je een nieuwe taal wilt spreken en schrijven, heb je vooral veel nieuwe woorden nodig. Je

Nadere informatie

Werkgroep MRSA- en infectiepreventie. De Montil Affligem 24 maart 2007

Werkgroep MRSA- en infectiepreventie. De Montil Affligem 24 maart 2007 Werkgroep MRSA- en infectiepreventie De Montil Affligem 24 maart 2007 In 2006 sessie omtrent MRSA Belangrijke topic voor dialysewerkvloer Variatie in aanpak in diverse centra Nood aan intervisie en evidence

Nadere informatie

Chronische lymfatische leukemie. Mark-David Levin Afd. Interne geneeskunde Albert Schweitzer ziekenhuis Dordrecht

Chronische lymfatische leukemie. Mark-David Levin Afd. Interne geneeskunde Albert Schweitzer ziekenhuis Dordrecht Chronische lymfatische leukemie Mark-David Levin Afd. Interne geneeskunde Albert Schweitzer ziekenhuis Dordrecht Chronische lymfatische leukemie 1. Wat is CLL? 2. Biologie nieuwe inzichten 3. Prognostische

Nadere informatie

WATERFILTERS HANDMATIG EN DISC-FILTRATIE. Tuinbouwtechniek & -benodigdheden. KaRo BV Tulpenmarkt PK Zwaagdijk

WATERFILTERS HANDMATIG EN DISC-FILTRATIE. Tuinbouwtechniek & -benodigdheden. KaRo BV Tulpenmarkt PK Zwaagdijk Arkal's filtration systems use a specially designed disc filtration technology. Color-coded Polypropylene or Nylon discs are grooved on both sides to a specific micron size. A series of these discs are

Nadere informatie

University of Groningen. Quantitative CT myocardial perfusion Pelgrim, Gert

University of Groningen. Quantitative CT myocardial perfusion Pelgrim, Gert University of Groningen Quantitative CT myocardial perfusion Pelgrim, Gert IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check

Nadere informatie

Nonrespons en ernstige klachten bij OCD: richtlijnen herzien? Else de Haan PhD Lidewij Wolters PhD Amsterdam, the Netherlands

Nonrespons en ernstige klachten bij OCD: richtlijnen herzien? Else de Haan PhD Lidewij Wolters PhD Amsterdam, the Netherlands Nonrespons en ernstige klachten bij OCD: richtlijnen herzien? Else de Haan PhD Lidewij Wolters PhD Amsterdam, the Netherlands Behandeling OCS bij kinderen Cognitieve gedragstherapie (CGT) Combinatie CGT

Nadere informatie

MVA Flu. Figuur 1: A: Middels homologe recombinatie (op basis van de homologie van de Del III flanks in het MVA

MVA Flu. Figuur 1: A: Middels homologe recombinatie (op basis van de homologie van de Del III flanks in het MVA Figuur 1: A: Middels homologe recombinatie (op basis van de homologie van de Del III flanks in het MVA genoom en het plasmide) in CEF cellen wordt in de geïnfecteerde+getransfecteerde cel de regio tussen

Nadere informatie

Bloedplaatjes (over) belicht

Bloedplaatjes (over) belicht Bloedplaatjes (over) belicht Jean-Louis Kerkhoffs Er is een leven na HOVON 82 Sanquin Bloodbank, Dept. of Research & Development, The Netherlands 1 Pathogeen reductie van bloedplaatjes Algemene introductie

Nadere informatie