EuroClonality Kwaliteitsrondzendingen via het web: Voor interpretatie van B- en T-cel clonaliteits analyse

Transcriptie

1 EuroClonality Kwaliteitsrondzendingen via het web: Voor interpretatie van B- en T-cel clonaliteits analyse Dr. Patricia Groenen Moleculaire Pathologie Radboud University Nijmegen Medical Centre (RUNMC) Moleculaire Diagnostiek in de Pathologie, Utrecht,

2 Te bespreken: EuroClonality/BIOMED-2, B-/T-cel clonaliteitsanalyse in de lymfoomdiagnostiek en pittfalls Aanpak: Kwaliteits rondzending via het web Aandachtspunten clonality analyse en uniforme scoring (workshops, website) Toekomst web-based kwaliteits-rondzendingen via EuroClonality

3 European Study Group on PCR-based clonality Assessment in lymphoproliferative disorders 19 th meeting: Belfast, March 18-20, 2010 Focus of the EuroClonality group: Educational activities for Ig/TCR clonality testing. Quality control and development of guidelines for performance and evaluation of diagnostic clonality testing. Application of new developments/methodologies in heamato-oncology and clonality assessment.

4 BIOMED-2 Concerted Action: BMH4-CT Complementarity of Ig targets for clonality detection in B-cell malignancies IGH IGK all IGH DH-JH VH-JH DH-JH VH-JH V -J Kde V -J + IGK + Kde * +DH-JH + Kde MCL (n=54) 100% 11% 100% 94% 75% 100% 100% 78% B-CLL/SLL (n=56) 100% 43% 100% 96% 61% 100% 100% 73% FL (n=109) 84% 19% 86% 63% 59% 84% 100% 64% MZL (n=41) 88% 51% 95% 68% 54% 83% 100% 68% DLBCL (n=109) 79% 30% 85% 61% 58% 80% 98% 72% TOTAL (n=369) 88% 28% 91% 73% 60% 88% 99% 70% PAS Evans et al, Leukemia 2007;21:

5 BIOMED-2 Concerted Action: BMH4-CT IGH Framework- Clonality detection in B-cell malignancies IGH FR1 FR2 FR3 all FR MCL (n=54) 100% 98% 93% 100% B-CLL/SLL (n=56) 95% 91% 93% 100% FL (n=109) 73% 76% 52% 84% MZL (n=41) 73% 85% 68% 88% DLBCL (n=109) 68% 61% 50% 79% TOTAL (n=369) 79% 78% 66% 88% PAS Evans et al, Leukemia 2007;21:

6 BIOMED-2 Concerted Action: BMH4-CT Complementarity of TCR targets for clonality detection in T-cell malignancies TCRB TCRG TCRB V -J D -J V -J V -J + TCRG + D -J T-PLL (n=33) 94% 47% 100% 94% 100% T-LGL (n=28) 86% 62% 96% 96% 100% PTCL-U (n=47) 85% 67% 98% 94% 100% AILT (n=37) 70% 61% 89% 92% 95% ALCL (n=43) 70% 48% 74% 74% 79%* TOTAL (n=188) 80% 58% 91% 89% 94%* (99%) * 20% to 25 % of anaplastic large cell lymphomas do not have TCR gene rearrangements (null-alcl) M. Brüggemann et al, Leukemia 2007;21:

7 Doel van EuroClonality Kwaliteitsrondzendingen Komen tot aanbevelingen voor interpretatie van Ig/TCRclonaliteits data via Uniforme scoring van clonaliteitsprofielen en de uniforme beschrijving van de interpretatie van die clonaliteitsprofielen.

8 Clonality : Uniforme scoring & Interpretatie Meerdere niveau s: - Technische beschrijving van resultaat per PCR tube - Overall interpretatie vh moleculair gen-herschikkingsprofiel (% B/T-cellen en & verdachte cellen, gevoeligheid van de test readout, kwaliteit van het DNA) - Betekenis clonaliteit voor de diagnostisch aanvraag

9 Moeilijkheden wb moleculaire Clonaliteitsanalyse zoals blijkt uit: Euroclonality workshops & online support Bij GeneScan evaluatie blijkt moeilijk: Clonale producten in polyclonale achtergrond Bij PCR targets zonder duidelijke Gausse curve Interpretatie meerdere clonale signalen Lage signalen Isolated clonal target: dwz: 1 target clonaal, rest van de PCR targets polyclonaal Pseudoclonaliteit Overall interpretatie vh moleculair gen-herschikkingsprofiel Betekenis clonaliteit voor de diagnostisch aanvraag

10 Clonality : Uniforme scoring & Interpretatie Meerdere niveau s: - Technische beschrijving van resultaat per PCR tube - Overall interpretatie vh moleculair gen-herschikkingsprofiel (% B/T-cellen en & verdachte cellen, gevoeligheid van de test readout, kwaliteit van het DNA) - Betekenis clonaliteit voor de diagnostisch aanvraag Doel: aanbevelingen interpretatie clonaliteitsanalyse

11 Kwaliteitsrondzendingen via het web Paper-based kwaliteitscontrole rondzendingen Beschrijving van de cases, histologie/immunostainings en de moleculaire data via (member part) Downloads van de resultaten: zowel Heteroduplex (HDA) gel resultaten als GeneScan (GS) profielen als de Ruwe GeneScan data files via de website PCRs in duplo met bijbehorende controles

12 QC4 rondzending

13 Readouts clonality BIOMED-2 Concerted Action BMH4-CT : PCR-based clonality studies PCR GeneScan analysis of IGH tube A: VH-J Hrearrangements 6 VH-FR1 primers (V H family primers) VH DH JH J H primer * Heteroduplex PCR analysis 2 C P CTGTGCAAGAGCGGGCTATGGTTCAGGGAGTTATGGCTACTACGGTATGGACGTCTGG CTGTGCAAGAGGACGAAACAGTAACTGCCTACTACTACTACGGTATGGACGTCTGG CTGTGCAAGAGAGATAGTATAGCAGCTCGTACAACTGGTTCGACTCCTGG CTGTGCAAGAGATCCGGGCAGCTCGTTTTGCTTTTGATATCTGG CTGTGCAAGAGCCTCTCTCCACTGGGATGGGGGGCTACTGG CTGTGCAAGAGCAGCAGCTCGGCCCCCTTTGACTACTGG CTGTGCAAGAGGACTTTGGATGCTTTTGATATCTGG CTGTGCAAGAGGGTGGGAGCTACTAGACTACTGG CTGTGCAAGGGTAGCTAAACCTTTGACTACTGG CTGTGCAATATCTACTTTGACTACTGG IGH VJ FR3 FR2 FR1

14 QC: Voorbeeld informatie diagnostische aanvragen Case 1 DD : Morphologically unusual Hodgkin lymphoma or T-cell lymphoma Lymph node biopsy, female 33 years old Tumor cells positive for CD30, CD45 and CD4, negative for CD2, CD3, CD5, CD20, CD79a Stainings provided: HE, pax5 Assessment of Ig and TCR PCR targets Case 2 DD: CD8-positive T-cell proliferation in the context of an EBV infection or T-cell lymphoma Lymph node biopsy, male 67 years old There are EBER-positive B-cells and CD8-positive T-cells Stainings provided: HE, CD3 Assessment of Ig and TCR PCR targets Totaal 5 vraagstellingen in QC4

15

16

17

18

19

20 IGHVJ tube A Case 3 QC4 IGHVJ tube B GS clonal, concordance IGHVJ tube C Concordance: p 50 ng 50 ng 50ng 200ng 200ng 200ng Clonal Clonal Clonal Polyclonal Polyclonal Polyclonal 3 C P 3 C P 3 C P

21 Case 3 QC4 TCRB tubes Concordance: polyclonal TCRB tube A TCRB tube B TCRB tube C 50ng 50ng 50ng 200ng 200ng 200ng Clonal Clonal Clonal Polyclonal Polyclonal Polyclonal 3 C P 3 C P 3 C P

22 Kwaliteitsrondzendingen via het web (vervolg) Downloads van de resultaten: zowel Heteroduplex (HDA) gel resultaten als GeneScan (GS) profielen als de Ruwe GeneScan data files via de website PCRs in duplo met bijbehorende controles Interpretatie volgens het EuroClonality scoring systeem, via drop down menus : Scoring van de afzonderlijke PCRs Volgens uniform scoring systematiek door EuroClonality groep ontworpen Geintegreerde scoring van GS en HDA) Interpretatie van het totale genherschikkingsprofiel eveneens gebruik makend van uniforme (standaard) zinnen / opmerkingen Resultaten automatisch naar QC-organizer (Nijmegen) voor algehele dataanalyse

23 Analyse EuroClonality QC4 Concordantie in scoring is redelijk hoog dankzij: Uniforme scorings systematiek PCRs (technisch) Interpretatie genherschikkingsprofiel Nog een testfase te gaan; zien of scoringssystematiek nog verbetering behoeft Enkele aandachtspunten

24 Aandachtspunten (1) Detectie clonaal door minimaal 1 readout, of GeneScanning of heteroduplex (of beide)

25 Case 4 QC4 IGK tube A 50ng 200ng Clonal Polyclonal 4 C P HDA meerwaarde bij scoring lichte keten PCRs en TCR

26 TCRB tube A Case 2 QC4 100ng 100ng Clonal Polyclonal 2 C P HDA meerwaarde bij scoring lichte keten PCRs en TCR

27 TCRG tube A 50ng Case 4 QC4 IGK tube B 50ng Case 2 QC4 Low intensity signals 200ng 200ng Clonal Clonal Polyclonal Polyclonal 4 C P 4 C P Echter gevoeligheid HDA<GS

28 Aandachtspunten (1) Detectie clonaal door minimaal 1 readout, of GeneScanning of heteroduplex (of beide) Herkenning van non-specific products

29 Case 1 QC4 Case 5 QC4 IGHDJ tube D IGHVJ tube C 100ng 100ng A 100ng A 100ng 100ng B Clonal 100ng B Polyclonal Clonal 1 C P Polyclonal A B C P

30 Non-specific products BIOMED-2 Ig/TCR PCRs Multiplex PCR Size range (bp) Non-specific bands (bp) Preferred method of analysis IGH tube A: tube A: ~85 GS and HD both suitable VH-JH tube B: tube B: ~228 a IGH DH-JH tube C: tube D: (D H 1/2/4/5/6-J H ) (D H 3-J H ) tube E: HD slightly preferred over GS tube C: ~211 a tube D: ~350 b tube E: 211 c (amplicon variation hampers GS) IGK tube A: (V 1f/6/V 7-J ) (V 3f-J ) (V 2f/V 4/V 5-J ) tube A: ~217 a tube B: ~404 a HD slightly preferred over GS (small CDR3 + amplicon variation hamper GS) tube B: V 1f/6/V 7-Kde (V 3f/intron-Kde) (V 2f/V 4/V 5-Kde) IGL tube A: tube A: - HD preferred over GS (small CDR3 hampers GS) GS and HD both suitable TCRB tube A: tube B: tube C: (D 2) (D 1) tube A: ~213 a,d, ~273 a,d tube B: ~93, ~126, ~221 a,d tube C: ~128, ~337 a,d TCRG tube A: tube A: - GS and HD both suitable tube B: tube B: - TCRD tube A: tube A: ~90, ~123 HD slightly preferred over GS (low amount of template + amplicon variation hamper GS) Leukemia 2003; 17: Table 25 (page 2306) (updated in EuroClonality consortium in Dec. 2009)

31 Aandachtspunten (1) Detectie clonaal door minimaal 1 readout, of GeneScanning of heteroduplex (of beide) Herkenning van non-specific products Over / Onder interpretatie IGK-VJ

32 IGK tube A 50ng 200ng Case 3 QC4 Clonaal IGK tube A 100ng 100ng Case 5 QC4 Polyclonaal A A Clonal 100ng 100ng B Polyclonaal B Polyclonal Clonal 3 C P Polyclonal AA BB CC PP

33 Aandachtspunten (1) Detectie clonaal door minimaal 1 readout, of GeneScanning of heteroduplex (of beide) Herkenning van non-specific products Over / Onder interpretatie IGK-VJ > Kennis van normaal polyclonaal patroon > Meerwaarde HDA

34 Aandachtspunten (2) Clonal + polyclonal background: Duplo is van essentieel belang geen kwantitatieve benadering maar 1) match tumorload 2) meerdere PCR- targets Lage signalen: bij suboptimaal DNA, of bij hoge tumorload (andere target duidelijk clonaal)

35 Clonality : Uniforme scoring & Interpretatie Meerdere niveau s: - Technische beschrijving van resultaat per PCR tube - Overall interpretatie vh moleculair gen-herschikkingsprofiel % B/T-cellen en & verdachte cellen, gevoeligheid van de test readout kwaliteit van het DNA Kennis van de gen-loci/pcr design (meerdere clonal products toch 1 clone, target afhankelijk) - Betekenis clonaliteit voor de diagnostisch aanvraag

36 EuroClonality Full Workshops Clonality assessment in Pathology in Nijmegen, The Netherlands, yearly since 2006 On site workshops: Barcelona November 3, 2006 Istanbul September 17, 2007 Grapevine TX USA September 29, 2008 San Jose, CA, USA November 19, 2010 St Petersburg September 2, 2011 Sessions on clonality testing Bordeaux (EAHP) September 23, 2008 Copenhagen (by AMP ) October 1, 2009

37 Educational activities Workshop: Clonality assessment in pathology Participants EuroClonality/BIOMED2 Workshops Nijmegen

38

39 E Difficult cases EuroClonality webmaster : Paul Rombout

40 Kwaliteitsrondzendingen via het web in NL / EU? EuroClonality benadering: Hoge detectie van clonaliteit middels EuroClonality/BIOMED-2 PCRs Op termijn mogelijk optie voor laboratoria die EuroClonality/BIOMED-2-PCRs standaard in de diagnostiek gebruiken (via EuroClonality bestuur) Vraagt een geintegreerde benadering van mol. diagnostiek in de pathologie, multidisciplinair overleg patholoog - klinisch mol bioloog (-medisch immunoloog).

41

42 Heteroduplex PCR analysis of Ig / TCR genes monoclonal cells monoclonal cells in polyclonal background polyclonal cells denaturation / renaturation heteroduplexes homoduplex