Pitfalls bij B / T-cel clonaliteits analyse. Patholoog Moleculair bioloog. Patricia Groenen Moleculair bioloog in de Pathologie UMC Nijmegen
|
|
|
- Esmée Bogaert
- 5 jaren geleden
- Aantal bezoeken:
Transcriptie
1 Pitfalls bij B / T-cel clonaliteits analyse Patricia Groenen Moleculair bioloog in de Pathologie UMC Nijmegen Moleculaire Diagnostiek in de Pathologie Patholoog Moleculair bioloog Clonaliteitsanalyse UMCN HE Aanvraag door UMCN- haemato-patholoog (ook bij consulten) Afstemming patholoog moleculair bioloog - Vraagstelling - Weefsel representatief? inschatten van % B / T cellen % verdachte cellen (>5-10%) Weefsel: Vers ingevroren weefsel Paraffine-ingebed weefsel CD79a MUM-1 Terugkoppeling naar aanvragend patholoog Integratie: resultaat en interpretatie moleculaire analyse in PALGA
2 Moleculaire Clonaliteits analyse Wanneer? In verdacht lymfoide weefsels: reactief? versus maligne? 2006: Bone marrow IGH DJ Clonaal proces? IGH-VJ: FR 3, Niet bij alle lymfomen, maar bij specifieke vraagstellingen: Ongewone B/T-cel proliferaties bepaalde localisatie Verdachte B/T-cel proliferaties bij immuundeficiëntie Bcl2-negatief FL Recidief / Clonale verwantschap (andere morfologie / lang tijdsinterval) Genherschikkingen van identieke amplicon grootte B/T-cell lineage determination Gededifferentieerde tumorcellen met afwijkend marker expressie patroon Niet voor: Hodgkin NHL T (2104) -Polyclonale / e control in elk experiment -Bevestiging PCR / primer kwaliteit DNA-quality 2104: 300 bp (paraffin) 25% B-cells, 80% suspect malignant Belang e controle Geen clonaal signaal / geen polyclonaal signaal IGH DJ T (1351) = case 1 workshop T DNA Herkenning aspecifieke produkten - Goede signalen e /e controles Nonspecific peak at 345 bp as the result of crossannaeling DH2 in the region upstream of JH4
3 T DNA 2699 Geen clonaal signaal / geen polyclonaal signaal BIOMED-2 Control Gene tube AF4/X3U (+157) 5' 3' GGAGCAGCATTCCATCCAGC AF4 exon bp AF4 exon 11 AATACAGGCCGGGTACCTAC (+756) AF4/X3L bp MwM Frozen material NL-4 GBS-4 (50 ng) GBS-4 (500ng) PT-4 Tonsil bp AF4/X11U (+445) 5' 3' CCGCAGCAAGCAACGAACC 400 bp PLZF exon 1 CCTCGGCGGTCTCCTTTCG (+844) AF4/X11L DNA kwaliteit? - Voldoende DNA in PCR tube? PLZF/X1U RAG1/X2U TBXAS1/X9U (+189) 5' 3' TGCGATGTGGTCATCATGGTG (+511) 5' 3' TGTTGACTCGATCCACCCCA (+34) 300 bp RAG1 exon bp TBXAS1 exon 9 CGGAGTCTGCTGTTACTGTGC (+488) AAGTCGGTTTGAACGTCGAGT (+710) PLZF/X1L RAG1/X2L 100 bp 5' 3' GCCCGACATTCTGCAAGTCC TTGGGAAGGGCCGTTGTGG (+133) TBXAS1/X9L Control genes BIOMED-2 report, Leukemia 2003; 17: QC extracted DNA Standardisatie DNA imput / PCR Kwaliteits controle (size ladder Biomed) Bij voorkeur vries materiaal > gefixeerd en paraffine ingebed weefsel Voldoende DNA imput / PCR target 1 µg DNA 1x10 5 cellen Vries weefsel: DNA-imput cellen Gefixeerd + paraffin: 50 and 200 ng 400 bp 300 bp 200 bp 100 bp Protocol paraffin : Prot K / P-buffer (Tris-HCl, NaCl, EDTA, Tween-20, NP-40, DTT), hoog zout precipitatie en Zuiveringsstap (Qiagen) accurate DNA-concentratie meting Evt. Aanpassen DNA / PCR bij lage tumorload DNA amplify ability < 200bp: geen volledige analyse alle targets mogelijk Melding DNA-kwaliteit in pathologie verslag Bevestiging van clonaliteit & Uitsluiten van pseudoclonaliteit: Clonaal resultaat als gevolg van te weinig B/T-cellen in het weefsel
4 Voorbeeld DNA-imput Geen clonaal signaal / geen polyclonaal signaal DNA2959 GS tray78241 TCRB-DJ? T DNA / 200ng DNA2959 GS tray78429 Repeat PCR, Imput 200 / 200ng Monoclonal control Polyclonal control - DNA kwaliteit? - Voldoende DNA in PCR tube? - Weefsel representatief? - Pitfall pseudoclonaliteit inschatten van % B / T cellen % verdachte cellen (>5-10%) op VOOR / NA HE-coupe Somatische Hypermutatie primer binding Detectie clonaliteit mbv IGH FR PCRs VH-JH VH-JH FR2 VH-JH VH-JH ALL FR2 B-CLL/SLL 95% 91% 93% 100% (n=56) 53/56 51/56 52/56 56/56 DNA 1695; T MCL 100% 98% 96% 100% (n=54) 54/54 53/54 52/54 54/54 FCL 73% 76% 52% 84% (n=109) 80/109 83/109 57/109 92/109 MZL(extranodal) 68% 81% 61% 84% (n=31) 21/31 25/31 19/31 26/31 DNA 1742; T MZL (nodal) 90% 100% 90% 100% (n=10) 9/10 10/10 9/10 10/10 MZL (total) 73% 85% 68% 88% (n=41) 30/41 35/41 28/41 36/41 DLBCL 68% 61% 50% 79% polyclonaal (n=109) 74/109 66/109 55/109 86/109 TOTAL 79% 78% 66% 88% (n=369) 291/ / / /369
5 Complementariteit Human TCRB gene complex (#7q34) 67 Vβ, 2 Dβ, and 13 Jβ rearrangeable gene segments - Multiple PCR targets - Multiple PCRs per target cen 5 27S1 ( 1 ) 22S1 ( 2 ) 9S1 ( 3-1 ) 7S1 ( 4-1 ) 5S1 ( 5-1 ) 13S3 ( 6-1 ) 6S7 (7-1) 7S3 ( 4-2 ) 13S2a ( 6-2 ) 9S2 ( 3-2 ) 7S2 ( 4-3 ) 13S2b ( 6-3 ) 6S5 ( 7-2 ) 30S1 ( 8-1 ) 31S1 ( 5-2 ) 13S5 ( 6-4 ) 6S1 ( 7-3 ) 32S1 ( 8-2 ) 5S5 ( 5-3 ) 1S1 ( 9 ) 12S2 ( 10-1 ) 21S1 ( 11-1 ) 8S4 ( 12-1 ) 12S3 ( 10-2 ) 21S3 ( 11-2 ) 8S5 ( 12-2 ) 13S1 ( 6-5 ) - Inclusie unmutated targets: IGH-DJ en IGK-DE 6S8 ( 7-4 ) 5S6 ( 5-4 ) 13S6 ( 6-6 ) 6S9 ( 7-5 ) 5S3 ( 5-5 ) 13S8 ( 6-7 ) 6S3 ( 7-6 ) 5S2 ( 5-6 ) 13S7 ( 6-8 ) 6S6 ( 7-7 ) 5S7 ( 5-7 ) 13S4 ( 6-9 ) 6S2 ( 7-8 ) 5S4 ( 5-8 ) 6S4 ( 7-9 ) 23S1 ( 13 ) 12S1 ( 10-3 ) 21S2 ( 11-3 ) 8S1 ( 12-3 ) 8S2 ( 12-4 ) 8S3 ( 12-5 ) 16S1 ( 14 ) 24S1 ( 15 ) 25S1 ( 16 ) 26S1 ( 17 ) 18S1 ( 18 ) 17S1 ( 19 ) 2S1 ( 20-1 ) 10S1 ( 21-1 ) 29S1 ( 22-1 ) 19S1 ( 23-1 ) 15S1 ( 24-1 ) 11S1 ( 25-1 ) 33S1 ( A ) 28S1 ( 26 ) 34S1 ( B ) 14S1 ( 27 ) 3S1 ( 28 ) 4S1 ( 29-1 ) 10 kb β1 β2 D J C D J C tel 20S1 ( 30 ) 3 Dβ1 Jβ Cβ1 Dβ2 Jβ kb Cβ2 enhancer Adapted from IMGT database, M.P. Lefranc, Leukemia 2003; 17: Analysis of TCRB gene rearrangements Vβ Dβ Jβ Kennis van type gen herschikkingen TCRB tubes A and B Vβ2 Vβ4 Vβ5/1 Vβ6a/11 Vβ6b/25 Vβ6c Vβ7 Vβ8a Vβ9 Vβ10 Vβ11 Vβ12a/3/13a/15 Vβ13b Vβ13c/12b/14 Vβ16 Vβ17 Vβ18 Vβ19 Vβ20 Vβ21 Vβ22 Vβ23/8b Vβ24 V β family primers 5' 3 (-204) AACTATGTTTTGGTATCGTCA (-201) CACGATGTTCTGGTACCGTCAGCA (-197) CAGTGTGTCCTGGTACCAACAG (-201) AACCCTTTATTGGTACCGACA (-201) ATCCCTTTTTTGGTACCAACAG (-201) AACCCTTTATTGGTATCAACAG (-198) CGCTATGTATTGGTACAAGCA (-201) CTCCCGTTTTCTGGTACAGACAGAC (-198) CGCTATGTATTGGTATAAACAG (-201) TTATGTTTACTGGTATCGTAAGAAGC (-198) CAAAATGTACTGGTATCAACAA (-198) ATACATGTACTGGTATCGACAAGAC (-198) GGCCATGTACTGGTATAGACAAG (-198) GTATATGTCCTGGTATCGACAAGA (-201) TAACCTTTATTGGTATCGACGTGT (-198) GGCCATGTACTGGTACCGACA (-201) TCATGTTTACTGGTATCGGCAG (-201) TTATGTTTATTGGTATCAACAGAATCA (-193, inv) CAACCTATACTGGTACCGACA (-201) TACCCTTTACTGGTACCGGCAG (-201) ATACTTCTATTGGTACAGACAAATCT (-201) CACGGTCTACTGGTACCAGCA (-197) CGTCATGTACTGGTACCAGCA GTGGTCTAAGTGTCAACATCCATTC CTGGTCCAATTGGCAACATCCATTC TTCAACCGAGTGACAACATCCATTC CTTGGGTCGAGAGACAGAACCCATAC CTGAGCTGAGAGGTAGGATCCATTC GTCCGAGTGACACTGTCCATAC TCCGACTGGCATGACCCATTC TCCGACTGGCACGACCCGCTC GTCCGAGTGCCAATGTCCATTC (+53) (+53) (+55) (+56) (+55) (+58) (+56) (+58) (+52) J β primers TCRB tubes A and C: J β A primers AGTGGCACGATCCATTCTTCC ACTGTCACGAGCCATTCGCCC AGAGTCACGACCCATTCGACC CACGAGCCACACGCGC Jβ1.1 Jβ1.2 Jβ1.3 Jβ1.4 Jβ1.5 Jβ1.6 Jβ2.2 Jβ2.6 Jβ2.7 TCRB tubes B and C: J β B primers Dβ Jβ (+59) (+58) (+59) (+57) Jβ2.1 Jβ2.3 Jβ2.4 Jβ2.5 C C Multiple TCRB-rearrangements: Multiple T-cell clones? Biallelic rearrangements and/or Multiple rearrangements / allele TCRB-VJ tube A TCRB-VJ tube B TCRB-DJ tube C TCRB tube C Dβ1 (-252) Dβ1 primer 5' 3' GCCAAACAGCCTTACAAAGAC Dβ2 primer 5' 3' Dβ 2 (-137) TTTCCAAGCCCCACACAGTC J β primers BIOMED-2 report: Leukemia 2003; 17: Dβ2 -J Dβ1 -J C (1748) Agar-Cyto; 300bp: 80%T, 80% suspect T-cell lymphoma, mediastinum
6 Verwantschap lymfomen? 2 biopten van een patient: Hodgkin en DLBCL Identieke clonale IGH genherschikkingen (Hodgkin /DLBCL) FR 3 FR 2 FR 1 Beide weefsels: VH D3-3 - JH6 VH D3-3 - JH4 lymphnode T DNA 1294 (Hodgkin) DNA 1290 (DLBCL) lung T DNA 1290 (DLBCL) bp DNA 1294 (Hodgkin) Clonale bi-allelische IGH-genherschikkingen in beide weefsels Identieke amplicon grootte van IGH (VJ- en VJ-) and IGL genherschikkingen: clonale verwantschap V5 N1 D3 J4 Junctional region VH5 Morbus Hodgin / T-cel lymphoma? (T ) Morbus Hodgin / T-cel lymphoma? (T ) T (1696) DNA-quality 1696: 400 bp (frozen) 20% B-cells,? % suspect malignant T (1696) FR2
7 BIOMED-2 clonality strategy Case T Suspected B-cell lymphoma Suspected lymphoma Of unknown origin Suspected T-cell lymphoma Mol diagn: B-cell clone (IGH) IGH V(D)J, FR2, TCRG VJ (A and B) Suspect immature T γδ Polyclonal T-cells (excluding T-cell lymphoma) IGH DJ (A) TCRB V(D)J (A and B) IGK VJ and DE TCRB GJ (tube C) + TCRD Clonality generally multiple clonal results Not discriminate Hodgkin / NonHodgkin lymphoma using clonality No evidence of clonality Probably Polyclonality (Gaussian curves using GeneScan Analysis, of smears in Heteroduplex Analysis Samenvattend: Oorzaken voor negatief PCR resultaat: DNA-afbraak of onvoldoende imput Somatische hypermutatie Vreemde genherschikkingen via deleties Chromosomale afwijkingen Pseudoclonaliteit Aanwezigheid van enkele verdacht maligne B / T-cellen Grote Kiemcentra aanwezigheid dominante clone(s) inschatten % B/T cellen, en verdacht maligne % B/T op HE-coupe voor / na Multiple genherschikkingen Afwijkende grootte amplicon Vb: vanaf meer downstream J-segments Sequentie analyse? References: 1) Design and standardization of PCR primers and protocols for detection of clonal immunoglobulin and T-cell receptor gene recombinations in suspect lymphoproliferations. J.J.M van Dongen et al. Report of Biomed-2 Concerted Action BMH4 CT Leukemia2003; 17: ) Lack of Bcl-2 expression in follicular lymphoma may be caused by mutations in the BCL2 gene or by absence of the t(14;18) translocation. M. Schraders et al. J. of Pathol. 2005; 205: ) Van Krieken JH, Langerak AW, Macintyre EA, Kneba M, Hodges E, Sanz RG, MorganGJ, Parreira A, Molina TJ, Cabecadas J, Gaulard P, Jasani B, Garcia JF, Ott M,Hannsmann ML, Berger F, Hummel M, Davi F, Bruggemann M, Lavender FL, Schuuring E, Evans PA, White H, Salles G, Groenen PJ, Gameiro P, Pott Ch, Dongen JJ. Improved reliability of lymphoma diagnostics via PCRbased clonality testing:report of the BIOMED-2 Concerted Action BHM4-CT Leukemia Feb;21(2): ) Evans PA, Pott Ch, Groenen PJ, Salles G, Davi F, Berger F, Garcia JF, vankrieken JH, Pals S, Kluin P, Schuuring E, Spaargaren M, Boone E, Gonzalez D, Martinez B, Villuendas R, Gameiro P, Diss TC, Mills K, Morgan GJ, Carter GI, Milner BJ, Pearson D, Hummel M, Jung W, Ott M, Canioni D, Beldjord K, Bastard C, Delfau-Larue MH, van Dongen JJ, Molina TJ, Cabecadas J. Significantly improved PCR-based clonality testing in B-cell malignancies by use of multiple immunoglobulin gene targets. Report of the BIOMED-2 Concerted Action BHM4-CT Leukemia Feb;21(2): ) Brüggemann M, White H, Gaulard P, Garcia-Sanz R, Gameiro P, Oeschger S, Jasani B,Ott M, Delsol G, Orfao A, Tiemann M, Herbst H, Langerak AW, Spaargaren M, Moreau E, Groenen PJ, Sambade C, Foroni L, Carter GI, Hummel M, Bastard C, Davi F, Delfau-Larue MH, Kneba M, van Dongen JJ, Beldjord K, Molina TJ. Powerful strategy for polymerase chain reaction-based clonality assessment in T-cell malignancies Report of the BIOMED-2 Concerted Action BHM4 CT Leukemia Feb;21(2): ) Langerak AW, Molina TJ, Lavender FL, Pearson D, Flohr T, Sambade C, Schuuring E, Al Saati T, van Dongen JJ, van Krieken JH. Polymerase chain reaction-based clonality testing in tissue samples with reactive lymphoproliferations: usefulness and pitfalls. A report of the BIOMED-2 Concerted Action BMH4-CT Leukemia Feb;21(2):222-9.
EuroClonality Kwaliteitsrondzendingen via het web: Voor interpretatie van B- en T-cel clonaliteits analyse
EuroClonality Kwaliteitsrondzendingen via het web: Voor interpretatie van B- en T-cel clonaliteits analyse Dr. Patricia Groenen Moleculaire Pathologie Radboud University Nijmegen Medical Centre (RUNMC)
Werkgroep Moleculaire Diagnostiek in de Pathologie (NVVP) Werkgroep Moleculaire Diagnostiek in de Pathologie (NVVP)
1 15 februari 2008 3de Moleculaire Dag Ed Schuuring Doel: stimuleren moleculaire diagnostiek binnen pathologie in NL borging en verbetering van kwaliteit vernieuwing moleculaire diagnostiek inventarisatie
De moleculaire diagnostiek van B-NHL: detectie van breuken met behulp van FISH
De moleculaire diagnostiek van B-NHL: detectie van breuken met behulp van FISH Philip Kluin, UMCG, Daphne de Jong, VUMC Yvonne van Norden, HOVON en Alle deelnemers HOVON kwaliteitsronde De oorsprong en
26-2-2009. Chromosomale translocatie detectie in sarcomen d.m.v. reverse-transcriptase PCR (RT-PCR) Marjolijn Ligtenberg
Aanvraag voor Moleculaire Diagnostiek Door patholoog Chromosomale translocatie detectie in sarcomen d.m.v. reverse-transcriptase PCR (RT-PCR) Marjolijn Ligtenberg Uitgangsmateriaal: Paraffineweefsel Vriesweefsel
Zin of onzin van moleculaire onco-hematologie in een perifeer labo
Zin of onzin van moleculaire onco-hematologie in een perifeer labo een kwestie van service! 06 januari 2004 Pieter De Schouwer 1 periferie??? Waar is het centrum? 06 januari 2004 Pieter De Schouwer 2 Leuven?
CAT: Flowcytometrische analyse van het TCR-Vβ repertoire. Apr. Annelies Brouwers 6 december 2005
CAT: Flowcytometrische analyse van het TCR-Vβ repertoire Apr. Annelies Brouwers 6 december 2005 Klinisch/diagnostisch scenario Vraagstelling Critical appraisal Analytische performantie Diagnostische performantie
Next Generation Sequencing: meer met minder
Next Generation Sequencing: meer met minder Robert van der Geize Klinisch Moleculair Bioloog in de Pathologie (KMBP) Xs2HiTek-workshop 'Diagnostiek in de Pathologie' 2015 www.labpon.nl Boerhaavelaan 59
HLA-B*27 diagnostiek: is sequentie analyse the way to go?
HLA-B*27 diagnostiek: is sequentie analyse the way to go? 14 juni 2011 Bouke Hepkema Transplantatie-Immunologie Laboratoriumgeneeskunde UMCG Kwaliteit in Harmonisatie of Harmonisatie in Kwaliteit UMCG
Han van Krieken Nijmegen The Netherlands
Pathologie vandaag: progressie, differentiatie en transformatie Voorspellen is moeilijk, Vooral als het over de toekomst gaat Han van Krieken Nijmegen The Netherlands PubMed Hits pathology AND prognosis:
SKML rondzending FISH MYC, BCL2 en BCL6 translocatie detectie (2016.2)
SKML rondzending FISH MYC, BCL2 en BCL6 translocatie detectie (2016.2) Elise van der Logt Week van de pathologie Workshop Hematologie 28-03-2017 Disclosure belangen spreker (potentiële) belangenverstrengeling
Een patiënte met ongebruikelijke blasten. Dr. Kirsten van Lom, afd. Hematologie Dr. King H. Lam, afd. Pathologie
Een patiënte met ongebruikelijke blasten Dr. Kirsten van Lom, afd. Hematologie Dr. King H. Lam, afd. Pathologie Patiënte, 64 jr. Uitstrijk perifeer bloed, beenmergaspiratie en beenmergbiopt bij verdenking
Translocatie Detectie Met Behulp Van Targeted Next Generation Sequencing In FFPE Weefsels. Tom van Wezel Pathologie LUMC
Translocatie Detectie Met Behulp Van Targeted Next Generation Sequencing In FFPE Weefsels Tom van Wezel Pathologie LUMC Tom van Wezel 14-Mar-16 Gene fusions in cancer The emerging complexity of gene fusions
SaMeNVattING Joost Kluiver
SaMeNVattING Joost Kluiver Nederlandse samenvatting Hodgkin lymfoom (HL) (ook wel de ziekte van Hodgkin) is een vorm van lymfeklier kanker die wordt gekenmerkt door een minderheid aan tumorcellen gelegen
In Situ Hybridisatie in de routine pathologie diagnostiek
In Situ Hybridisatie in de routine pathologie diagnostiek Winand Dinjens Afdeling Pathologie Josephine Nefkens Instituut (JNI) Erasmus MC, Rotterdam Pathologendagen; 11 april 2007, Ede In Situ Hybridisatie
CAT Critically Appraised Topic
CAT Critically Appraised Topic Flowcytometrische analyse van het TCR-Vβ repertoire. Author: Supervisor: Dr. Nancy Boeckx Search/methodology verified by: Dr. Johan Frans Date: 6 december 2005 Expiry date:
Gastro-intestinale stromacel tumor: Risico classificatie en mutatie analyse door de patholoog. Dr. Judith V.M.G. Bovee Patholoog LUMC
Gastro-intestinale stromacel tumor: Risico classificatie en mutatie analyse door de patholoog Dr. Judith V.M.G. Bovee Patholoog LUMC GastroIntestinale Stromacel Tumor 11-15 GISTen per 100.000 mensen (Scandinavië)
T-cel lymfomen diagnostische dilemma's, klinische consequenties en moleculaire oplossingen
T-cel lymfomen diagnostische dilemma's, klinische consequenties en moleculaire oplossingen Daphne de Jong, NKI-AVL Amsterdam Werkgroep Moleculaire Diagnostiek in de Pathologie 28-01-1011 WHO classificatie
Folliculair Lymfoom graad 3B (FL3B)
Nederlandse samenvatting Folliculair Lymfoom graad 3B (FL3B) Inleiding Een maligne lymfoom is een kwaadaardige woekering van witte bloedcellen die zich meestal manifesteert in lymfeklieren en zich verspreidt
Pathologie: herkennen van kanker. Han van Krieken, patholoog Universitair Medisch Centrum St. Radboud Nijmegen
Pathologie: herkennen van kanker Han van Krieken, patholoog Universitair Medisch Centrum St. Radboud Nijmegen Pathologie: herkennen van kanker Definitie Moleculaire basis Morfologie en aanvullende technieken
Minimal Residual Disease (MRD)) onderzoek. bij hematologische maligniteiten
Minimal Residual Disease (MRD)) onderzoek bij hematologische maligniteiten MRD Principe, doel en eigenschappen Technieken voor MRD analyse Klinische toepassingen Minimal Residual Disease Bij diagnose:
Detectie van chromosomale imbalances mbv Next Generation Sequencing (NGS)
Detectie van chromosomale imbalances mbv Next Generation Sequencing (NGS) Winand Dinjens, KMBP Afdeling Pathologie Laboratorium voor Moleculaire Diagnostiek w.dinjens@erasmusmc.nl Week van de Pathologie
Moleculaire Diagnostiek binnen een routine Pathologie Laboratorium
Moleculaire Diagnostiek binnen een routine Pathologie Laboratorium Winand N.M. Dinjens Laboratorium voor Moleculaire Diagnostiek Afdeling Pathologie Josephine Nefkens Instituut (JNI) Erasmus MC, Universitair
Dysplasie in AML en (cyto)genetische. afwijkingen: Chromosoom 3q26 afwijkingen en EVI1
Dysplasie in AML en (cyto)genetische afwijkingen: Chromosoom 3q26 afwijkingen en EVI1 patient 0390606 BM H11-172 8-2-2011 patient 0390606 dag 24 kuur I H11-428 4-4-2011 patient 0390606 dag 24 kuur I H11-428
What to include in an array report?
What to include in an array report? December 17-19, 2007 Nicole de Leeuw, PhD Department of Human Genetics Radboud University Nijmegen Medical Centre The Netherlands Array analyse criteria a) SNP call
Werkgroep Moleculaire Diagnostiek in de Pathologie (NVVP)
Werkgroep Moleculaire Diagnostiek in de Pathologie (NVVP) 31 januari 2012 SKML deelnemersbijeenkomst SKML-Sectie Pathologie -QC-commissie Ed Schuuring Werkgroep Moleculaire Diagnostiek in de Pathologie
Mobiele qpcr aan de waterkant
Mobiele qpcr aan de waterkant Voortgaande innovaties in DNA monitoring voor (zwem)waterkwaliteit Bas van der Zaan Monitoring kwaliteit zwemwater Zwemwater Zwemwaterrichtlijn Intestinale Enteroccocen E.coli
De differentiaal diagnose tussen diffuus grootcellig B-cel lymfoom en Burkitt lymfoom. Dr. King H. Lam Afd. Pathologie
De differentiaal diagnose tussen diffuus grootcellig B-cel lymfoom en Burkitt lymfoom Dr. King H. Lam Afd. Pathologie Overzicht Inleiding in Burkitt lymfoom (BL) en diffuus grootcellig B-cel lymfoom (DLBCL)
Non-Hodgkin Lymfomen: naar therapie op maat?
Non-Hodgkin Lymfomen: naar therapie op maat? LYMMCARE Patiëntensymposium 13 november 2014 Rien van Oers non-hodgkin lymfomen Inleiding: indeling non-hodgkin lymfomen Behandeling anno 2014 Nieuwe ontwikkelingen
Ontwikkelingen in de moleculaire pathologie. Werkgroep Moleculaire Diagnostiek in de Pathologie. Morfologisch. Functioneel
Ontwikkelingen in de moleculaire pathologie Moleculaire dag WMDP Carel van Noesel Utrecht, 29 januari 2010 Morfologisch Functioneel Werkgroep Moleculaire Diagnostiek in de Pathologie Opleiding tot klinisch
DNA/RNA extracties uit FFPE weefsel Dr. Sc. Elke Boone, H.-Hartziekenhuis Roeselare-Menen
H.-Hartziekenhuis Roeselare - Menen vzw Wilgenstraat 2-8800 Roeselare DNA/RNA extracties uit FFPE weefsel Dr. Sc. Elke Boone, H.-Hartziekenhuis Roeselare-Menen Belang van intacte DNA/RNA moleculen voor
University of Groningen
University of Groningen Dysregulation of transcription and cytokine networks in Hodgkin lymphomas with a focus on nodular lymphocyte predominance type of Hodgkin lymphoma Atayar, Cigdem IMPORTANT NOTE:
PD-L1 staining: een echte biomarker?
PD-L1 staining: een echte biomarker? 10e NVMO Nascholing Targeted Therapy Donderdag 21 april 2016 Antropia, Driebergen Stefan M. Willems MD PhD Dept Pathology UMC Utrecht, Utrecht, The Netherlands Dept
BRAF rondzending SKML 2012
BRAF rondzending SKML 2012 Presentatie van de resultaten op de deelnemersbijeenkomst 5 februari 2013 Riki Willems Patricia Groenen Willeke Blokx Adriaan van den Brule Casus 1 Langerhanscel histiocytose
2 februari de Moleculaire Dag
2 februari 2007 2de Moleculaire Dag Doel: stimuleren moleculaire diagnostiek binnen pathologie in NL borging en verbetering van kwaliteit vernieuwing moleculaire diagnostiek inventarisatie en afstemming
SKML-parasitologie rondzendingen; tijd voor moleculaire diagnostiek?
SKML-parasitologie rondzendingen; tijd voor moleculaire diagnostiek? Theo Schuurs, moleculair bioloog Lid namens WMDI / NVMM Izore, Centrum Infectieziekten Friesland, Leeuwarden Huidige rondzendingen SKML-parasitologie:
SKML rondzending PATHO Vakinhoudelijke bespreking
SKML rondzending PATHO 2014.5 Vakinhoudelijke bespreking King H. Lam Afd. Pathologie Amersfoort, 16-06-2015 Indeling Rondgestuurd materiaal en kleuringen Resultaten Conclusies Antilichamen: CD15, CD30,
Ontwikkelingen binnen de moleculaire pathologie. Bastiaan Tops Klinisch moleculair bioloog i.o. UMC St Radboud
Ontwikkelingen binnen de moleculaire pathologie Bastiaan Tops Klinisch moleculair bioloog i.o. UMC St Radboud Binnen het UMC St Radboud: - Stroomlijnen van de diagnostiek (automatiseren) - Zoveel mogelijk
MVA Flu. Figuur 1: A: Middels homologe recombinatie (op basis van de homologie van de Del III flanks in het MVA
Figuur 1: A: Middels homologe recombinatie (op basis van de homologie van de Del III flanks in het MVA genoom en het plasmide) in CEF cellen wordt in de geïnfecteerde+getransfecteerde cel de regio tussen
Detectie van pneumocystis in broncheoalveolaire lavage. Rafke Schoffelen 15-12-2015 IC Radboudumc
Detectie van pneumocystis in broncheoalveolaire lavage Rafke Schoffelen 15-12-2015 IC Radboudumc Casus Man, 78 jaar Behandeld met rituximab en prednison Verdenking pneumocystis pneumonie(pcp) Start cotrimoxazol
Disclosure belangen spreker
Disclosure belangen spreker (potentiële) belangenverstrengeling Voor bijeenkomst mogelijk relevante relaties met bedrijven Sponsoring of onderzoeksgeld Honorarium of andere (financiële) vergoeding Aandeelhouder
Moleculaire markers en prognosticering van het DLBCL, M. Chamuleau
Moleculaire markers en prognosticering van het DLBCL, consequenties voor het beleid? M. Chamuleau Belangenverklaring In overeenstemming met de regels van de Inspectie van de Gezondheidszorg (IGZ) Naam:
Therapie op maat voor patiënt met Acute lymfatische Leukemie. Dr V. de Haas Kinderarts-oncoloog/hematoloog Hoofd SKION laboratorium
Therapie op maat voor patiënt met Acute lymfatische Leukemie Dr V. de Haas Kinderarts-oncoloog/hematoloog Hoofd SKION laboratorium Casus 8-jarig meisje wordt gezien door huisarts - Sinds een week bleek
Arash Bordbar, Patholoog, Symbiant, Alkmaar.
Arash Bordbar, Patholoog, Symbiant, Alkmaar. CK7, CK20, CDX2 en TTF-1 Aantal deelnemende laboratoria: 39. Aantal inzendingen 38. CK7 is door 38 deelnemers ingestuurd. CK20 is door 38 deelnemers ingestuurd.
Pathologie panels voor maligne lymfomen: nut en noodzaak Rapport van project in het kader van SKMS. Han van Krieken, patholoog Radboud UMC, Nijmegen
Pathologie panels voor maligne lymfomen: nut en noodzaak Rapport van project in het kader van SKMS Han van Krieken, patholoog Radboud UMC, Nijmegen Samenvatting De diagnostiek van maligne lymfomen wordt
Patient tailored medicine: moleculaire biologie onontbeerlijk Moleculaire Pathologie in een veranderende wereld
Patient tailored medicine: moleculaire biologie onontbeerlijk Moleculaire Pathologie in een veranderende wereld Dr. Judith Jeuken Klinisch moleculair bioloog in de pathologie (KMBP) Moleculaire Diagnostiek
Moleculaire pathologie van B-cel lymfomen classificatie als basis voor behandelingskeuzes
Moleculaire pathologie van B-cel lymfomen classificatie als basis voor behandelingskeuzes Daphne de Jong MD PhD Dept. of Pathology VU University Medical Center Amsterdam The Netherlands daphne.dejong@vumc.nl
Richtlijn verslaglegging moleculaire diagnostiek
Richtlijn verslaglegging moleculaire diagnostiek Juni 2012 Werkgroep Moleculaire Diagnostiek in de Pathologie Dr. Ir. Saskia van den Berg van Erp De Toren van Babel- Pieter Bruegel de Oudere (ca. 1560)
Ranglijst woongebied land van matena 1 januari 2019
Toelichting Ranglijst woongebied land van matena 1 januari 2019 Hieronder treft u de geanonimiseerde ranglijst per 1 januari 2019 aan voor het woongebied van Land van Matena. Het betreft een momentopname.
Basisbegrippen Oncologie
Basisbegrippen Oncologie Tumor afmeting Diagnose periode Behandel periode Preventie/interventie periode Invasie interventie Tijd Detectie drempel Van normale naar kankercel Normale cel Van celkern naar
Moleculaire diagnostiek intestinale parasieten -rondzendingen ten behoeve van Mdx-
Moleculaire diagnostiek intestinale parasieten -rondzendingen ten behoeve van Mdx- Theo Schuurs, moleculair bioloog Lid namens WMDI / NVMM Izore, Centrum Infectieziekten Friesland, Leeuwarden Huidige rondzendingen
Diagnostiek van het Non-Hodgkin Lymfoom (NHL)
Diagnostiek van het Non-Hodgkin Lymfoom (NHL) 5 L.M. Faber, J.M.G. Bonfrer, J.J.M. van Dongen, N.J.M. Freling, O.S. Hoekstra, D. de Jong, R.E. Kibbelaar, Ph. M. Kluin, C.J.L.M. Meijer, T.H. Que, W.L.E.
Pathologie: herkennen van kanker. Han van Krieken, patholoog Universitair Medisch Centrum St. Radboud Nijmegen
Pathologie: herkennen van kanker Han van Krieken, patholoog Universitair Medisch Centrum St. Radboud Nijmegen Pathologie: herkennen van kanker Definitie Moleculaire basis Morfologie en aanvullende technieken
Pitfalls in de diagnostiek van het Hodgkin Lymfoom
Pitfalls in de diagnostiek van het Hodgkin Lymfoom Arjan Diepstra, patholoog UMC Groningen 73 e NVvO Oncologiedag 30 sept. 2015 Pathology & Medical Biology UNIVERSITY MEDICAL CENTER GRONINGEN Disclosure
Kim Monkhorst Antoni van Leeuwenhoek Thoraxpatholoog
Kim Monkhorst Antoni van Leeuwenhoek Thoraxpatholoog Outline Geschiedenis biomarkers in longkanker Richtlijnen Uitvoering Vergoeding What happened in lung cancer? First description activating EGFR mutation
INSTRUCTIES VOOR STAALAFNAME Centrum voor Menselijke Erfelijkheid Erk. nr 8/24990/92/000 Tel fax
I. Toelichting bij het indienen van aanvragen voor genetisch onderzoek 1. Aanvragen Het voorziet in verschillende aanvraagformulieren voor de verschillende diagnostische testen. Om eventuele fouten en
9.2. Nederlandse samenvatting
.2. Nederlandse samenvatting Het immuunsysteem is een natuurlijk afweersysteem dat beschermt tegen virussen en bacteriën. Er zijn twee soorten afweer: de natuurlijke afweer, die altijd aanwezig is, en
Themaweek dikke darmkanker
Themaweek dikke darmkanker AZ Sint-Lucas Gent Workshop 4 De artsen van AZ Sint-Lucas hebben deze presentatie met zorg opgemaakt. De inhoud ervan is echter algemeen en indicatief. AZ Sint-Lucas en de artsen
Toepassing van circulerend, cel-vrij DNA in plasma als liquid biopsy voor solide tumoren
Toepassing van circulerend, cel-vrij DNA in plasma als liquid biopsy voor solide tumoren PAUL-EMILE CLAUS ASO KLINISCHE BIOLOGIE, AZ DELTA PROF. DR. GEERT MARTENS DR. DIETER DE SMET Questions 1. De rol
Literatuuropdracht kostenberekening en kostenvergelijking synthetisch DNA versus PCR producten
Literatuuropdracht kostenberekening en kostenvergelijking synthetisch DNA versus PCR producten Mark van der Lee, Stanley van Herk en Otto Bachaus. Met een naschrift van Eric Kamst (begeleidend docent).
SKML-sectie Pathologie CD15 CD30 CD79a PAX5
SKML-sectie Pathologie 2013.4 CD15 CD30 CD79a PAX5 Robert Hoedemaeker Pathan, Rotterdam A Lever B Tonsil C Tumor I D Tumor II E Tumor III Weefsels op het glaasje Weefsels op het glaasje A Lever B Tonsil
Moleculaire Diagnostiek in de Pathologie
Moleculaire Diagnostiek in de Pathologie Informatiebrochure Afdeling Pathologie VU medisch centrum Amsterdam Inhoudsopgave Pagina Inleiding 3 Indicatiegebieden en bijbehorende Moleculaire Diagnostiek:
HEMOPATHOLOGIE HFDST 1: NORMALE ARCHITECTUUR EN IMMUUNRESPONS IN HET LYMFOÏDE WEEFSEL 3
HEMOPATHOLOGIE Geen histologische foto's op examen! Prof. van den Oord INHOUDSOPGAVE HFDST 1: NORMALE ARCHITECTUUR EN IMMUUNRESPONS IN HET LYMFOÏDE WEEFSEL 3 1. INLEIDING 3 1.1. AFWIJKINGEN IN BLOED IN
De rol van de pathologie en genetica bij de herkenning van Lynch syndroom
De rol van de pathologie en genetica bij de herkenning van Lynch syndroom Marjolijn Ligtenberg Laboratorium specialist klinische genetica Klinisch moleculair bioloog in de Pathologie VAP dag 28-3-2017
2 e SMT Workshop Moleculaire Typeringen spa typering en MLST
2 e SMT Workshop Moleculaire Typeringen spa typering en MLST 28 30 Januari, 2013 UMC Utrecht en RIVM Leo M Schouls Laboratorium voor Infectieziekten en Screening (LIS) Centrum voor Infectieziektebestrijding
Moleculaire revolutie in de pathologie: next generation sequencing
Moleculaire revolutie in de pathologie: next generation sequencing John Hinrichs, klinisch moleculair bioloog in de pathologie UMC Utrecht, afdeling pathologie De (moleculaire) pathologie maakt op dit
Pharmacogenomics: een uitdaging voor de Moleculaire Diagnostiek in de Pathologie
Pharmacogenomics: een uitdaging voor de Moleculaire Diagnostiek in de Pathologie Winand Dinjens Afdeling Pathologie Josephine Nefkens Instituut Erasmus MC, Rotterdam w.dinjens@erasmusmc.nl Werkgroep Moleculaire
Cover Page. The handle http://hdl.handle.net/1887/18632 holds various files of this Leiden University dissertation.
Cover Page The handle http://hdl.handle.net/1887/18632 holds various files of this Leiden University dissertation. Author: Joosse, Simon Andreas Title: Prediction of "BRCAness" in breast cancer by array
Wait and See. Hematon, 29 maart 2014 Nieuwegein. Rien van Oers. Afdeling Hematologie AMC Amsterdam
Wait and See Hematon, 29 maart 2014 Nieuwegein Rien van Oers Afdeling Hematologie AMC Amsterdam Keuze menu voor uw vragen Wait and See beleid Algemene aspecten non-hodgkin lymfomen Indeling lymfomen Klachten
Moleculaire biologische kwaliteits rondzendingen: Harmonisatie via netwerken. 14 juni 2011 Dr. R. Maatman
Moleculaire biologische kwaliteits rondzendingen: Harmonisatie via netwerken 14 juni 2011 Dr. R. Maatman Overzicht Nationale QCs Europese projecten EQUAL Spidia Biobanken Kwaliteit in harmonisatie 2 SKML
Digitale pathologie. Henk-Jan van Slooten patholoog 19-12-2011. founding fathers: Medisch Centrum Alkmaar Zaans medisch centrum Westfriesgasthuis
Digitale pathologie Henk-Jan van Slooten patholoog 19-12-2011 founding fathers: Medisch Centrum Alkmaar Zaans medisch centrum Westfriesgasthuis Disclosure Nothing to disclose Digitale pathologie? Wat is
INSTRUCTIES VOOR STAALAFNAME Centrum voor Menselijke Erfelijkheid Erk. nr 8/24990/92/000 Tel fax
I. Toelichting bij het indienen van aanvragen voor genetisch onderzoek 1. Aanvragen Het voorziet in verschillende aanvraagformulieren voor de verschillende diagnostische testen. Om eventuele fouten en
Functionele analyse van BRCAness in borst- en ovariumtumoren
Functionele analyse van BRCAness in borst- en ovariumtumoren Maaike Vreeswijk Humane Genetica, LUMC Moleculaire diagnostiek in de pathologie, 17 Januari 2016 Disclosure GEEN Major challenges in cancer
Ontwikkelingen in de behandeling van het indolente non-hodgkin lymfoom Hematon/LVN Patiëntensymposium
Ontwikkelingen in de behandeling van het indolente non-hodgkin lymfoom Hematon/LVN Patiëntensymposium 13 september 2014 Marie José Kersten non-hodgkin lymfomen Inleiding: indeling non-hodgkin lymfomen
Synergie: cytologie+immunologie+histologie
Synergie: cytologie+immunologie+histologie Grieks: synergia,samenwerking De meeropbrengst die ontstaat bij het samengaan van delen ten opzichte van de som van die delen. Wikepedia Wat is de meeropbrengst
Immunoglobulin gene alterations in the progression of B cell lymphomas Smit, L.A.
UvA-DARE (Digital Academic Repository) Immunoglobulin gene alterations in the progression of B cell lymphomas Smit, L.A. Link to publication Citation for published version (APA): Smit, L. A. (2008). Immunoglobulin
WETENSCHAPPELIJK INSTITUUT VOLKSGEZONDHEID COMMISSIE VOOR KLINISCHE BIOLOGIE DIENST VOOR LABORATORIA VAN KLINISCHE BIOLOGIE COMITE VAN DESKUNDIGEN
WETENSCHAPPELIJK INSTITUUT VOLKSGEZONDHEID COMMISSIE VOOR KLINISCHE BIOLOGIE DIENST VOOR LABORATORIA VAN KLINISCHE BIOLOGIE COMITE VAN DESKUNDIGEN JAARRAPPORT 2010 EXTERNE KWALITEITSEVALUATIE VOOR ANALYSEN
Molecular Pathology for Pathologists. Pr P. Pauwels
Molecular Pathology for Pathologists Pr P. Pauwels NGS moleculair pathologie rapport ontcijferen Nomenclatuur waarin gerapporteerd wordt: EGFR c.2573t>g, p.(leu858arg) Coderende sequentie Eiwit/proteïne
Reeks 13: Vergeten organen Avond
Reeks 13: Vergeten organen Avond Zeldzame Thoracale Tumoren tumor voorste mediastinum / Thymoom Dr. Monique Hochstenbag Longarts MUMC kalfszwezerik No Disclosures Mediastinum Voorste mediastinum Thymus
Diagnostiek in de Pathologie' B.J. Leenders Sales Manager Sanbio B.V.
Diagnostiek in de Pathologie' B.J. Leenders Sales Manager Sanbio B.V. Diagnostiek in de Pathologie Binnen het vakgebied van de (moleculaire) diagnostiek in de pathologie laboratoria hebben zich de laatste
NGS testen in de neuro-oncologie uitdagingen en (on)mogelijkheden
NGS testen in de neuro-oncologie uitdagingen en (on)mogelijkheden Erik Jan Dubbink Klinisch Moleculair Bioloog in de Pathologie Department of Pathology Erasmus MC, Rotterdam h.dubbink@erasmusmc.nl 9e Bijeenkomst
MRD als prognostische merker in CLL
MRD als prognostische merker in CLL Jan Philippé 2011 Universitair Ziekenhuis Gent 1 Behandelingsstrategieën bij CLL Cramer & Hallek Nat Rev Clin Oncol 2010 2 2 Hoe kan men CLL opvolgen? Watch and wait
Whole genome sequencing op direct materiaal voor virus detectie en typering. Janette Rahamat-Langendoen, arts-microbioloog
Whole genome sequencing op direct materiaal voor virus detectie en typering Janette Rahamat-Langendoen, arts-microbioloog Acute luchtweginfecties Belangrijke oorzaak van ziekenhuis opnames bij kinderen
Praktijkvariatie in het graderen van colorectale adenomen
Praktijkvariatie in het graderen van colorectale adenomen Kwaliteitssymposium pathologie dagen Nijmegen, 20 november 2015 Chantal Kuijpers c.c.h.kuijpers@umcutrecht.nl Disclosure belangen Geen belangenverstrengeling
Nederlandse samenvatting
Nederlandse samenvatting nederlandse samenvatting Algemene inleiding Primair bot lymfoom is een zeldzame aandoening. Het is een extranodaal subtype van het grootcellig B non Hodgkin lymfoom, dat zich
Moleculaire Diagnostiek binnen de Pathologie in Nederland
Moleculaire Diagnostiek binnen de Pathologie in Nederland Ed Schuuring Moleculair bioloog Hoofd moleculair diagnostisch lab van Pathologie UMCG Voorzitter van de landelijke werkgroep Moleculaire Diagnostiek
Symposium Lymfklierkanker Vereniging Vlaanderen vzw
Symposium Lymfklierkanker Vereniging Vlaanderen vzw 14-10-2017 T cel lymfomen: zeldzamere types van lymfomen en hun behandeling Dr. Snauwaert Sylvia AZ Sint-Jan Brugge Wat is een T cel lymfoom? 10-15%
HER2-status bepaling in borstcarcinoma met FISH: wetgeving, richtlijnen en resultaten van de provincie Limburg
HER2-status bepaling in borstcarcinoma met FISH: wetgeving, richtlijnen en resultaten van de provincie Limburg Brigitte Maes Laboratorium voor Moleculaire Diagnostiek VJZ FISH voor HER2 gen amplificatie
Acute Lymfatische Leukemie bij kinderen
Acute Lymfatische Leukemie bij kinderen 6 e symposium hematomorfologie, Rotterdam op 31 maart 2016 Auke Beishuizen Kinderarts oncoloog/ hematoloog Erasmus MC Sophia Kinderziekenhuis Inhoud - Inleiding/
Dankwoord. Lucas Mevius bedank ik voor zijn inspirerende tips bij het schrijven van de samenvatting.
Dankwoord 113 Dankwoord De geboorte van dit proefschrift is niet alleen te danken aan alle co auteurs. Er is een groot aantal mensen achter de schermen aan wie ik veel erkenning schuldig ben. Allereerst
ADAS3 - Vragenlijst 6: Diagnostiek Vragenlijst voorbeeld
Vragenlijst voorbeeld Nederlandse Vereniging Voor Pathologie ADAS Visitatie B.V. ADAS Visitatie B.V.Vragenlijst voorbeeld Pagina 1 ADAS3 - Vragenlijst 6: Diagnostiek Vrije vragenlijst 1 - Cytohistodiagnostiek
c-met amplificatie/ exon14 skippingpatiënt L. Hijmering/Harry J M Groen Longarts UMCG
c-met amplificatie/ exon14 skippingpatiënt L. Hijmering/Harry J M Groen Longarts UMCG Voorgeschiedenis 2000 Femoralis stent. 2016 ct2bn3m1b adenocarcinoom van de long uitgaande van de LBK met o.a. hersenmetastasen
Versnelling verzending pathologisch materiaal bij een verwijzing
Versnelling verzending pathologisch materiaal bij een verwijzing 1. Huidige situatie Beschrijving pathologische revisie Procesbeschrijving Digitale uitwisseling 2. Knelpunten pathologische verwijzing Procesverbetering
Infiltratie Hodgkin en Non-Hodgkin cellen in het beenmerg. King H. Lam Afd. Pathologie
Infiltratie Hodgkin en Non-Hodgkin cellen in het beenmerg King H. Lam Afd. Pathologie Overzicht Inleiding en microanatomie van de lymfklier B- en T-cel ontwikkeling en relatie met maligne lymfomen Indeling
5.2.1.3 Restrisico na laboratoriumtesten (tekst 2008, update in 2014)
53 54 55 56 57 58 59 530 53 53 533 534 535 536 537 538 539 540 54 54 543 544 545 546 547 548 549 550 55 55 553 554 555 556 557 558 559 560 56 56 563 564 565 566 567 568 569 570 57 57 573 574 575 5...3
Q-koorts, een complexe diagnostiek! (the JBZ experience!)
Q-koorts, een complexe diagnostiek! (the JBZ experience!) De microbiologen zagen zieke mensen. In hun ogen waren dat er veel meer dan normaal en zij spraken van een epidemie. ( ) We hebben de epidemie
University of Groningen Educational value of digital examination
University of Groningen Educational value of digital examination Benefits Digital Examination HANDWRITING CORRECTING 1 2 3 Do you remember the Correcting the essay exams in handwriting from your students
2. AFWIJKINGEN IN BLOED EN BEENMERG WORDEN BESPROKEN IN DE LESSEN HEMATOLOGIE
HEMATOPATHOLOGIE 1. INLEIDING DEEL VAN DE PATHOLOGISCHE ONTLEEDKUNDE DAT GERICHT IS OP DE IDENTIFICATIE VAN PATHOLOGISCHE VERANDERINGEN IN HET BLOED HET BEENMERG DE LYMFOIDE WEEFSELS MET ALS DOEL HET ZIEKTEPROCES
Stand van zaken zomer 2013: CCKL accreditatie: 29/65 labs
Stand van zaken zomer 2013: CCKL accreditatie: 29/65 labs ISO15189: stand van zaken 2013 2013 taakgroep NVVP (Amélie Dendooven, Mieke Jonker, Hilda Keuning, Philip Kluin (vz), Joost Oudejans): Participatie
Gebruik van nieuwe technieken in de moleculaire pathologie. John Hinrichs, klinisch moleculair bioloog
Gebruik van nieuwe technieken in de moleculaire pathologie John Hinrichs, klinisch moleculair bioloog Gebruik van nieuwe technieken in de moleculaire pathologie 1. Introductie moleculaire pathologie 2.