NIEUWE INZICHTEN IN DE GENETISCHE DIAGNOSTIEK VAN (NIER)AANDOENINGEN

Transcriptie

1 NIEUWE INZICHTEN IN DE GENETISCHE DIAGNOSTIEK VAN (NIER)AANDOENINGEN Plaats en beperkingen van next generation sequencing Anniek Corveleyn - CME

2 Etiology of Genetic Disorders achondroplasia cystic fibrosis Rasopathy deafness LQTS intellectual disability 1 mutation 1 gene 10 genes 50 genes 75 genes >500 genes 1 disease 1 (single) mutation 1 disease 1 gene 1 disease few genes different diseases 1 (single) gene different diseases many genes

3 Classical molecular diagnostics Clinical investigation NMR scan Eye investigation Array-CGH COL4A3 Kidney biopsy COL4A5 COL4A4 nephropathy ACTN4 LMX1B LAMB2 Sanger sequencing Causal INF2 mutation INF2 CLCN5

4 Massive parallel sequencing Illumina Pacific Biosciences Oxford Nanopore

5 Massive parallel sequencing (MPS) Gene panel target => specific clinical diseases, limited genes Mendeliome target => exons of all genes for known (mono)genic diseases ~5000 Whole exome target => coding sequences of all genes (exons) ~ Whole genome complete genome, coding (exons) and non-coding sequences (introns)

6 MPS workflow: targeted capture nephropathy genes : coding regions (exons)

7 NGS workflow: targeted capture Capture probes Patiënt DNA hybridisation washing steps

8 MPS workflow: targeted capture Captering DNA of selected genes Massive parallel sequencing millions of reads = short reads for selected genes

9 MPS workflow: targeted capture millions of reads = short reads for selected genes INF2 Mapping LMX1B COL4A3 Etc. UMOD

10 Limitations of targeted capture INF2 ATG TAA No single or multiple exon deletions No reads for part of exon: (fixed) GAP No reads for introns: GAP No reads for 3 UTR: GAP MLPA / array / better algorithms Sanger sequencing

11 Limitations SUMMARY Nephropathy - Limited to genes present in the panel/mendeliome No access to novel genes No re-analysis in targeted panels - Limited Clinicaltoexome exons = mendeliome and flanking intron regions No deep intronic variants No variants in promotor or UTR - GAPS WGS> sequencing on request / core genes - No quantitative CNV results MLPA / array in addition

12 WES versus WGS + - Mendeliome - WES - cheaper - interpretation - higher depth - enrichment steps - limited to coding regions - incomplete capture of target region - bias towards certain regions - short reads WGS - complete sequence (coding/non coding) - more uniform coverage of genome - longer reads > better determination of CNVs, rearrangements, - IT issues / storage - expensive - troughput - challenging data management and analysis

13 Strategy for genetic heterogeneous disorders Number of genes TAT Number of patients pooling COST coverage SNV and/or CNV Re-analysis research Single Trio

14 Etiology of Genetic disorders achondroplasia cystic fibrosis Rasopathy deafness LQTS intellectual disability 1 mutation 1 gene 10 genes 50 genes 75 genes >500 genes one or a few genes (1-5) panel of genes (5-100) > 100 genes PCR + Sanger sequencing Lightcycler, fragment analysis, amplicon based NGS, targeted capture - gene panels amplicon based NGS, mendeliome, mendeliome (exome) Remgeld voor de patiënt = 8,68 Euro

15 Strategy for genetic heterogeneous disorders cardiogenetics capture oncogenetics Amplicon based nephrogenetics immunogenetics thrombogenetics neurogenetics Others: metabolic, MCA, developmental Others: disorders metabolic, MCA, developmental disorders targeted panels mendeliome ( exome / WGS ) AD AR Single Case - Large gene Single Case - Gene panel Trio - Gene panel Trio - De Novo/AR De novo X- linked

16 Strategy for genetic heterogeneous disorders cardiogenetics capture oncogenetics Amplicon based nephrogenetics immunogenetics thrombogenetics neurogenetics metabolic, MCA, developmental Others: disorders metabolic, MCA, developmental disorders targeted panels mendeliome ( exome / WGS ) Ease of interpretation Number of genes / variants Targeted panel Mendeliome WES WGS

17 Strategy for genetic heterogeneous disorders Diagnosis Technology Sequencer Number of genes Number of patients Cardiogenetics Targeted capture Hiseq /month CDG Targeted capture Hiseq /months Rasopathy Haloplex Miseq /month Hypercholesterolemia Agilent Miseq 4 120/month Nephrogenetics PID Neurogenetics MCA- ID Mendeliome Hiseq 2500 > /month

18 Workflow in the laboratory Extraction facility Laboratory wet work Molecular Diagnostics Registration blood sample NGS gene panel DNA extraction NGS wet work Preparation for sequencing - Library preparation - Capture en amplification ± 2µg DNA HiSeq 2500 Bio-informatics Variant Calling File (VCF) + Manuel Classification Discussion with our clinical geneticists and medical experts Lab geneticist Collection of Samples / batch 1. quality control: % CS1 calls 2. Sample tracking: SNP check 3. Excel file with gaps Medical specialist Protocol Clinical geneticist QC - VALIDATION - SOPs

19 NIEUWE INZICHTEN IN DE GENETISCHE DIAGNOSTIEK VAN (NIER)AANDOENINGEN Variantinterpretatie: in silico, in vivo en in vitro Koenraad Devriendt CME, Leuven

20 Next generation sequencing : van variant detectie naar variant interpretatie

21 Juist Fout

22 DNA sequentie patient normale DNA sequentie ATTGTACGTGATGACCAGTGGAAT ACCGTAAGGTAAAGTACCGTGTAC TTGGTTGGAACGTAGACTGAATGC CAACCCTGGTATTGGTGTCCCGTG TACAAGGTTAGTAATGTACCATTG TTCCGTAATACGTGTGGCGCGTGC GTAACACACTGACTGACCATCCTG GTAGCTAGTCAAGTCGTAGCTGTC GTGACGTAACCTATATGACACACG TCAGTACGGTCAGTACACACATGC TGTGGTGCAGTACAGATACAGTAC AGATTAGCAGAAATGCAGATTTAG TTCCGTAATACGTGTGGCGCGTGC GTAACACACTGACTGACCATCCTG GTAGCTAGTCAAGTCGTAGCTGTC GTGACGTAACGTATATGACACACG TCAGTACGGTCAGTACACACATGC TTCCGTAATACGTGTGGCGCGTGC GTAACACACTGACTGACCATCCTG GTAGCTAGTCAAGTCGTAGCTGTC GTGACGTAACGTATATGACACACG TCAGTACGGTCAGTACACACATGC TTCCGTAATACGTGTGGCGCGTGC GTAACACACTGACTGACCATCCTG ATTGTACGTGATGACCAGTGGAAT ACCGTAAGGTAAAGTACCGTGTAC TTGGTTGGAACGTAGACTGAATGC CAACCCTGGTATTGGTGTCCCGTG TACAAGGTTAGTAATGTACCATTG TTCCGTAATACGTGTGGCGCGTGC GTAACACACTGACTGACCATCCTG GTAGCTAGTCAAGTCGTAGCTGTC GTGACGTAACTTATATGACACACG TCAGTACGGTCAGTACACACATGC TGTGGTGCAGTACAGATACAGTAC AGATTAGCAGAAATGCAGATTTAG TTCCGTAATACGTGTGGCGCGTGC GTAACACACTGACTGACCATCCTG GTAGCTAGTCAAGTCGTAGCTGTC GTGACGTAACGTATATGACACACG TCAGTACGGTCAGTACACACATGC TTCCGTAATACGTGTGGCGCGTGC GTAACACACTGACTGACCATCCTG GTAGCTAGTCAAGTCGTAGCTGTC GTGACGTAACGTATATGACACACG TCAGTACGGTCAGTACACACATGC TTCCGTAATACGTGTGGCGCGTGC GTAACACACTGACTGACCATCCTG FOUT? JUIST

23 genetische verschillen? 3 miljard nucleotiden hoofdstukken (CNV s): 150 verschillen letters (SNV s): +/- 3 miljoen (1/1000) A A T G A T C T A T C G G T A G C T gen 1 gen 2 gen 3 gen 1 gen 2 gen 3 gen 1 gen 2 gen 3 A A T G A T C T C T C G G T A G C T à in exons 400 potentieel pathogene varianten 2-5 ziekte-veroorzakende mutaties

24 Wanneer is een variant de pathogene mutatie? dé normale DNA sequentie bestaat niet REFERENTIE sequentie Hoe het koren van het kaf scheiden?

25 classificatie en interpretatie van genetische varianten In silico In vivo In vitro pathogeen?? benign + verklaart de variant het fenotype?

26 Genetische Variatie classificatie in 5 klasses CLASS Pathogenic 5 ACMG Likely pathogenic VOUS Likely benign Benign 1

27 In silico DATABANKEN * Normale varianten : variant is te frequent aanwezig in de normale populatie Africa 13,539 Europa 7,215 - elk nieuw gesequeneerd genoom: gemiddeld 8,579 nieuwe varianten - elk genoom : gemiddeld bp afwezig in het referentie genoom Telenti et al. PNAS, 2016;113:

28 In silico DATABANKEN * Gekende pathogene mutaties : beschreven bij personen met de aandoening

29 In silico PREDICTIETOOLS Lading aminozuur Bewaring aminozuur Eiwit domeinstructuur Effect op splicing proteine interacties?

30 In silico PREDICTIETOOLS missense varianten in CLINVAR BENIGN n = 7346 PATHOGEEN n = 7473 CORRECTE CONCORDANTIE? 18/18 3/3 tools freq. tools* 5,2% 46,2% 39,2% 84,9% VALSE CONCORDANTIE? 18/18 3/3 tools freq. tools* 0,8% 18,2% 0,003% 2,1% *3 frequente gebruikte tools : Polyphen, SIFT,CADD Ghosh et al., Genome Biology, 2017

31 Beperken van aantal varianten te classificeren? Gouden regel : Zo veel mogelijk klinische gegevens nefrologische diagnose prioritisering van welke genen geanalyseerd worden welk subpanel? zo minder vals positieve resultaten

32 Genomic Variation filtering gene panels 304 genen > verschillende nefropathieën 14 subpanels gedefinieerd, prioritisering welke genen voor analyse geen incidental findings Proteinurie Congenital Anomalies of the Kidney and Urinary Tract (CAKUT) Nefronofthise Renale cysten en ciliopathieën, incl. Bardet-Biedl en nefronofthise (excl. PKD1 en PKD2) Renale Cysten op volwassen leeftijd en autosomaal dominante tubulointerstitiële nierziekte (ADTKD) (excl. PKD1, PKD2, VHL, TSC1, TSC2 en MUC1) Jong Nierfalen, CKD-Y Ziekte van Dent Elektrolytenstoornis - Renaal Fanconi syndroom Hyperuricemie - uricosurie Nefrocalcinosis - Nefrolithiasis Renale fosfaat handling Renale Tubulaire Acidose Renale tubulaire dysgenesie Renale amyloïdosis

33 Familie onderzoek en variant interpretatie genotype-fenotype correlaties in de familie

34

35 Klasse 3 variant variant of unknown significance

36 WT/WT WT/WT In vivo WT/WT MT/WT WT/WT WT = wild-type = normaal MT = mutant de novo mutatie in een gen gelinkt aan de aandoening bij sporadische patiënt (dwz familiaal negatief) +/- zeker pathogeen Maar de novo SNPs : * exoom : 1 à 2 * genoom : +/- 60

37 In vivo * MT/WT WT/WT WT = wild-type = normaal MT = mutant 50% 50% * MT/WT enkel nuttig in grote families met meerdere aangedane personen Segregeert met de ziekte in de familie MAAR : elke variant heeft 50% kans om overgeërfd te worden van de aangedane ouder door toeval

38 MT/WT WT/WT In vivo MT/WT WT/WT WT = wild-type = normaal MT = mutant MT/WT MT/WT Segregeert niet (volledig) met de aandoening in de familie maar: - verminderde penetrantie - late onset

39 MT/WT WT/WT MT/WT MT/WT WT/WT In vivo WT = wild-type = normaal MT = mutant > segregeert niet met de ziekte in de familie NIET de pathogene mutatie ER MOET EEN ANDERE MUTATIE ZIJN VERMOEDELIJK IN EEN ANDER GEN

40 GOUDEN REGEL Variant analyse is gemakkelijker als er klinische en genetische informatie is van de familie REEDS VOOR DE DNA TEST! welk overervingsmechanisme? parallele analyse van meerdere aangedane familieleden vergelijking maakt analyse véél gemakkelijker GOUDEN REGEL Segregatie analyse is zinloos indien géén goede klinische gegevens ZILVEREN REGEL Segregatie analyse : vaak veel moeite voor niets

41 In vitro MEESTAL RESEARCH!

42 SYNTHESE VAN CLASSIFICATIE? In silico In vivo In vitro

43 nefroloog Expertise team Tijd: veel hersenen-werk laboratorium geneticus patient klinisch geneticus

44 I have a dream. artificial intelligence genoom sequentie en fenotype informatie variant classificatie

45 Genetisch rapport CLASS ACMG Pathogenic Likely pathogenic VOUS Likely benign in het laboratorium rapport, actionable naar clinicus Benign 1 NIET gerapporteerd

46 Genetisch rapport CLASS Pathogenic 5 N variants > curation ~ ACMG Likely pathogenic VOUS Likely benign Benign Meestal NIET gerapporteerd unclassified variants Soms toch RESEARCH SEGREGATION Class 5: pathogeen > 99% Class 4: waarschijnlijk pathogeen 95 tot 99% Class 3: unclassified variant % Class 2: waarschijnlijk niet pathogeen % Class 1: geen functionele effecten <1% probabiliteit

47 Gouden regel : Genetische diagnostiek Nog steeds tijdrovend en arbeidsintensief