HERKANSINGSTENTAMEN Moleculaire Biologie deel 2, 5 Jan 2007

Save this PDF as:
 WORD  PNG  TXT  JPG

Maat: px
Weergave met pagina beginnen:

Download "HERKANSINGSTENTAMEN Moleculaire Biologie deel 2, 5 Jan 2007"

Transcriptie

1 HERKANSINGSTENTAMEN Moleculaire Biologie deel 2, 5 Jan 2007 NAAM: STUDENTNUMMER: CONTROLEER OF DIT TENTAMEN 14 PAGINA S BEVAT. Veel succes! o Je mag de achterkant van het papier ook zo nodig gebruiken, maar beantwoord vragen 1-7 niet op blaadjes van vraag 8 en de daarop volgende. o Zet VOORDAT JE BEGINT MET ANTWOORDEN je naam en studentnummer op bladzijden 1 en Vul het juiste antwoord in op de stippellijn. -Hoe noemt men planten met verschillende allelen van één gen? zygoot -Genen kunnen meerdere hebben. -Eén gen kan vele allelen hebben. Hoeveel allelen van één gen heeft ieder individu?... -Bij welk type overerving ligt de eigenschap van de heterozygoot tussen die van de homozygote vormen in? Bij welk type overerving komen in de heterozygoot beide eigenschappen tot expressie? Hoe noemt men het uiterlijk van een individu? Hoe noemt men de erfelijke eigenschappen van een individu? De overerving hangt soms af van het geslacht van het individu. Bij welk type overerving komt een erfelijke eigenschap bij mannen en vrouwen even vaak voor? Zegt het fenotype precies wat het genotype is? Leg uit Valt bij co-dominante overerving het genotype uit het fenotype af te leiden? Leg uit Tentamen toets 2 Mol Biologie Januari

2 2a. De onderstaande genen liggen op 1 chromosoom. Gebruik de volgende recombinatie data bij het maken van een genetische kaart. Geef de volgorde aan van de genen aan de hand van de kleinste intervals. Gen locus Recombinatie (%) Gen (locus) Recombinatie (%) a,b 50 b,d 13 a,c 15 b,e 50 a,d 38 c,d 50 a,e 8 c,e 7 b,c 50 c,e 45 b. Wanneer je kijkt naar de afstanden in je genetische kaart zijn deze niet strikt additief (optelbaar). Wat is de oorzaak van dit verschil? c. De recombinatie frequentie kan niet groter zijn dan 50%, maar een genetische kaart kan langer zijn dan 50 cm. Leg uit hoe dat kan. Tentamen toets 2 Mol Biologie Januari

3 3. I a, I b, I o zijn allelen van een gen dat voor een enzym codeert dat suikerketens aan het membraanoppervlak van rode bloedcellen kan koppelen. a. Welke fenotypes (dus welke suikergroepen verwacht je op het membraan) en welke ratio s verwacht je bij de kinderen van de volgende ouders: 1. I a I a x I b I b 2. I a I b x I o I o 3. I a I o x I b I o 4. I a I o x I o I o b. Hoe heet dit principe van overerving? Tentamen toets 2 Mol Biologie Januari

4 4. Bij tomaten is het recessieve allel d verantwoordelijk voor dwerggroei en het recessieve p allel zorgt voor de vorming van peervormige in plaats van de normale ronde tomaten. Tussen beide loci treedt 30% recombinatie op. Plant I van normaal postuur en met ronde vruchten wordt gekruist met een dwerg die peervormige vruchten draagt. Dit levert de volgende nakomelingen: 81 normale planten; 79 dwergen met peren; 22 normale planten met peervruchten; 17 dwergen met normale vruchten. Plant II, fenotypisch gelijk aan plant I, werd aan dezelfde proefkruising onderworpen en leverde: 21 normale planten met peervormige vruchten; 18 dwergen met ronde tomaten; 5 volkomen normale planten; 4 dwergen met peren. a. Geef de positie van de betrokken allelen op de chromosomen van plant I en II aan. b. Welke nakomelingen en in welke verhoudingen verwacht je uit een kruising tussen plant I en plant II? Tentamen toets 2 Mol Biologie Januari

5 5. Een lineair stuk DNA van 5000 bp lang is geknipt met restrictie enzym A en met B, beide apart in een enkel digest (twee linker kolommen hieronder), en met A en B samen in een dubbel-digest (rechterkolom). De volgende DNA fragmenten zijn gevonden aan de hand van gelelektroforese: A B A+B 2100 bp 2500 bp 1900 bp 1400 bp 1300 bp 1000 bp 1000 bp 1200 bp 800 bp 500 bp 600 bp 500 bp 200 bp Vervolgens zijn de fragmenten van A (individueel) uit gel geïsoleerd en vervolgens geknipt met enzym B; elk fragment van B is ook geïsoleerd en geknipt met enzym A. De volgende banden zijn gevonden fragmenten met behulp van gel-elektroforese: Fragment A Fragment A geknipt met B Fragment B Fragment B geknipt met A , , , , , Teken de restrictiekaart van dit 5000 bp DNA fragment: Tentamen toets 2 Mol Biologie Januari

6 6a. Beschrijf de werking van telomerase. 6b. In welke cellen is telomerase actief? Tentamen toets 2 Mol Biologie Januari

7 7. Teken de replicatievork en geef de verschillende moleculen/enzymen weer. Tentamen toets 2 Mol Biologie Januari

8 NAAM: STUDENTNUMMER: 8a. In eukaryoten zoals de mens heeft elk gen gemiddeld drie enhancers. Wat is een enhancer? 8b. Wat is de functie van een enhancer? 8c. Gegeven is dat de mens ongeveer genen heeft (en dus enhancers). Hoeveel genen zullen ongeveer coderen voor een transcriptiefactor? Leg je antwoord uit. 9a. Wat is de functie van een poly(a)-staart aan het einde van een eukaryotisch mrna? 9b. Wat is een cap-structuur? (Als je het makkelijker vindt, mag je een schets maken) 9c. Wat is de functie van een cap-structuur? Tentamen toets 2 Mol Biologie Januari

9 GCCGTAATGCTGACTGACTGCAGTGAACGTGATGCCGTTGCCCT CGGCATTACGACTGACTGACGTCACTTGCACTACGGCAACGGGA Als gegeven is dat de bovenste streng in het hierboven gegeven dubbelstrengs DNA molecuul de matrijs ( template ) is, hoe ziet het mrna er dan uit? Begin aan het uiteinde en niet midden in de streng. Geef de polariteit aan in je antwoord. Je hoeft alleen de eerste 10 nucleotiden te geven. 11. Welke elementen bepalen of RNA polymerase op het DNA de ene of de andere kant opgaat ( links- of rechtsaf )? 12. Teken (a) het proces van splicing en geef (b) in je tekening de namen van betrokken moleculen. Tentamen toets 2 Mol Biologie Januari

10 13. Wat betekent Ala-tRNA Cys? (Verklaar de toevoegingen Ala en Cys en verklaar hoe dit molecuul zal functioneren.) 14. Hoe verloopt de initiatie van de eiwitsynthese in eukaryoten? Je moet ook een tekening maken. Tentamen toets 2 Mol Biologie Januari

11 15. Gegeven de sequentie van de stopcodons: UAG, UAA, en UGA, en de volgende sequentie van een denkbeeldig eukaryotisch mrna: 5...AAC UCC GGU AUC UAC UAA UAG AUG CCG GCC AUU CAA ACA UGA GGA UUA CCC AUG UCG AAG...3. Voor het gemak is de mrna sequentie gegeven per drietal nucleotiden. Het eiwit dat gecodeerd wordt door dit mrna start bij de dikgedrukte en onderlijnde AUG. a. Hoe wordt de sequentie 5 van de AUG genoemd? b. Wat valt je op aan de mrna sequentie? c. Welke conclusie trek je uit je antwoord van b? 16. Teken de HIV replicatie cyclus. Geef in je tekening essentiële namen en toevoegingen aan. Benoem getekende moleculen. Tentamen toets 2 Mol Biologie Januari

12 17a. Wat wordt bedoeld met negatief-strengig RNA? 17b. Waar vinden we dat RNA? 18a. De activiteit van het tryptofaan-operon wordt gereguleerd door tryptofaan. Wat is een operon? 18b. Wat is het eindproduct van transcriptie en translatie van het tryptofaan-operon? 18c. Beschrijf en teken de regulatie door tryptofaan van het trp-operon. Tentamen toets 2 Mol Biologie Januari

13 19. Waarom zijn niet alle genen in een eukaryotische cel cel aktief? Licht je antwoord kort toe. 20. Waarom word je ziek van een virus? Geef zoveel mogelijk redenen en licht ze heel kort toe. 21. Bacteriën kennen geen meiose, en toch kan hun DNA veranderen. Geef zoveel mogelijk manieren hoe het bacteriële DNA kan veranderen. Je hoeft ze niet toe te lichten. Mutatie is één manier en hoef je niet meer te noemen! Tentamen toets 2 Mol Biologie Januari

14 22. Wat voor nucleotiden worden gebruikt bij DNA sequentiebepaling volgens de Sanger methode? Leg de werking van die nucleotiden uit. (Je hoeft dus niet de hele DNA sequentie bepaling te beschrijven!) 23. BONUSVRAAG. Waarom bestaat DNA uit nucleotiden, terwijl eiwitten uit een andere monomeer bestaan, namelijk aminozuren? Het was toch economischer geweest als ook eiwitten uit nucleotiden hadden bestaan? (Het antwoord staat niet in Campbell!) Tentamen toets 2 Mol Biologie Januari

Tentamen Genetica 22-10-2004 Studentnr:

Tentamen Genetica 22-10-2004 Studentnr: CONTROLEER OF DIT TENTAMEN 11 PAGINA S BEVAT. Veel succes! Je mag de achterkant van het papier ook zo nodig gebruiken, maar beantwoord vragen 1-6 niet op blaadjes van vraag 7 en de daarop volgende. 1.

Nadere informatie

ANTWOORDEN HOOFDSTUK 6 VAN GEN TOT EIWIT

ANTWOORDEN HOOFDSTUK 6 VAN GEN TOT EIWIT ANTWOORDEN HOOFDSTUK 6 VAN GEN TOT EIWIT ANTWOORDEN 6.5 /TM 6.8 Codering 1.een juiste aanvulling van het schema : nucleotiden in mrna juist nucleotiden in DNA juist 3 kant en 5 kant bij mrna en DNA juist

Nadere informatie

28 Testkruising testkruising = een kruising om te achterhalen of een organisme homozygoot of heterozygoot is. Voorbeeld van een testkruising om te bepalen of een organisme homozygoot of heterozygoot is

Nadere informatie

94 Transcriptie en vorming van mrna bij prokaryoten en eukaryoten

94 Transcriptie en vorming van mrna bij prokaryoten en eukaryoten 94 Transcriptie en vorming van mrna bij prokaryoten en eukaryoten Transcriptie bij prokaryoten: Prokaryoten hebben geen celkern, waardoor het DNA los in het cytoplasma ligt. Hier vindt de transcriptie

Nadere informatie

vwo eiwitsynthese 2010

vwo eiwitsynthese 2010 vwo eiwitsynthese 2010 Aan- en uitzetten van genen Escherichia coli leeft in de dikke darm van onder andere de mens. Deze bacterie heeft vijf structurele genen die coderen voor enzymen die betrokken zijn

Nadere informatie

DNA & eiwitsynthese Oefen- en zelftoetsmodule behorende bij hoofdstuk 16 en 17 van Campbell, 7 e druk December 2008

DNA & eiwitsynthese Oefen- en zelftoetsmodule behorende bij hoofdstuk 16 en 17 van Campbell, 7 e druk December 2008 DNA & eiwitsynthese Oefen- en zelftoetsmodule behorende bij hoofdstuk 16 en 17 van Campbell, 7 e druk December 2008 DNA 1. Hieronder zie je de schematische weergave van een dubbelstrengs DNA-keten. Een

Nadere informatie

Biotechnologie deel I

Biotechnologie deel I Biotechnologie deel I Hand-out bij de eerste oefen- en zelftoetsmodule van Biotechnologie & maatschappij behorende bij hoofdstuk 2,3, 4 en 5 van Introduction to Biotechnology, Thieman & Palladino, 3 e

Nadere informatie

Hetzelfde DNA in elke cel

Hetzelfde DNA in elke cel EIWITSYNTHESE (H18) Hetzelfde DNA in elke cel 2 Structuur en functie van DNA (1) Genen bestaan uit DNA Genen worden gedragen door chromosomen Chromosomen bestaan uit DNAmoleculen samengepakt met eiwitten

Nadere informatie

Genetica & Evolutie Deeltentamen 1

Genetica & Evolutie Deeltentamen 1 Vraag 1. Iemands genotype is AaBb voor twee genen die gekoppeld op een chromosoom liggen. Als de beide dominante allelen op één chromosoom liggen, en de beide recessieve allelen op het andere homologe

Nadere informatie

BIOLOGIE MOLECULAIRE GENETICA EIWITSYNTHESE VWO KLASSE 6

BIOLOGIE MOLECULAIRE GENETICA EIWITSYNTHESE VWO KLASSE 6 BIOLOGIE MOLECULAIRE GENETICA EIWITSYNTHESE VWO KLASSE 6 Henry N. Hassankhan Scholengemeenschap Lelydorp [HHS-SGL] ARTHUR A. HOOGENDOORN ATHENEUM - VRIJE ATHENEUM - AAHA Docent: A. Sewsahai DOELSTELLINGEN:

Nadere informatie

Genetica & Evolutie Deeltentamen 1 Versie 1 2007

Genetica & Evolutie Deeltentamen 1 Versie 1 2007 Vraag 1. Het kleur patroon van de vacht van een hertensoort wordt bepaald door één gen met drie allelen. De allelen D en F erven co- dominant over; allel f erft recessies over t.o.v. zowel D als F. Hoeveel

Nadere informatie

DNA & eiwitsynthese Vragen bij COO-programma bij hoofdstuk 11 en 12 Life

DNA & eiwitsynthese Vragen bij COO-programma bij hoofdstuk 11 en 12 Life DNA & eiwitsynthese Vragen bij COO-programma bij hoofdstuk 11 en 12 Life De vragen die voorkomen in het COO-programma DNA & eiwitsynthese zijn op dit formulier weergegeven. Het is de bedoeling dat je,

Nadere informatie

Hand-out bij de oefen- en zelftoets-module bij hoofdstuk 7 van 'The Molecular Biology of the Cell', Alberts et al.

Hand-out bij de oefen- en zelftoets-module bij hoofdstuk 7 van 'The Molecular Biology of the Cell', Alberts et al. Centraal Dogma Hand-out bij de oefen- en zelftoets-module bij hoofdstuk 7 van 'The Molecular Biology of the Cell', Alberts et al., 6e druk Mei 2016 Van DNA naar mrna Hier zie je een deel van de sequentie

Nadere informatie

Level 1. Vul het juiste woord in

Level 1. Vul het juiste woord in Level 1 Vul het juiste woord in Keuze uit: Gen, Allel, Locus, Dominant, Recessief, Co-dominantie, Monohybride kruising, Dihybride kruising, Autosoom, Autosomale overerving, X-chromosomale overerving, Intermediair

Nadere informatie

Biologie 1997 Augustus

Biologie 1997 Augustus www. Biologie 1997 Augustus Vraag 1 In de onderstaande tekening is de elektronenmicroscopische afbeelding van een cel van een traanklier van een mens weergegeven. Het afgescheiden traanvocht bevat een

Nadere informatie

Welke combinatie van twee celorganellen en hun respectievelijke functies is correct?

Welke combinatie van twee celorganellen en hun respectievelijke functies is correct? Biologie Vraag 1 Welke combinatie van twee celorganellen en hun respectievelijke functies is correct? ribosoom en synthese van eiwitten kern en fotosynthese mitochondrion en fotosynthese ribosoom

Nadere informatie

Genetica & Evoltie Deeltentamen 1 2008. a. X- chromosoom gebonden recessief. b. Autosomaal recessief. c. X- chromosoom gebonden dominant.

Genetica & Evoltie Deeltentamen 1 2008. a. X- chromosoom gebonden recessief. b. Autosomaal recessief. c. X- chromosoom gebonden dominant. Vraag 1. Een fruitvliegje met het genotype AABBCC wordt gekruist met een aabbcc vlieg. De drie kenmerken erven onafhankelijk van elkaar over en A, B en C zijn volledig dominant over respectievelijk a,

Nadere informatie

Tentamen Van Mens tot Cel

Tentamen Van Mens tot Cel Tentamen Van Mens tot Cel 1. Hans en Tineke willen graag een kindje. Zowel de ouders van Hans als de ouders van Tineke zijn beide drager van een autosomaal recessieve ziekte. Wat is de kans dat Hans en

Nadere informatie

4 VWO thema 4 Genetica EXAMENTRAINER OEFENVRAGEN

4 VWO thema 4 Genetica EXAMENTRAINER OEFENVRAGEN Examentrainer Vragen Erfelijke kaalheid De aanwezigheid of het geheel of gedeeltelijk ontbreken van hoofdhaar (kaalheid) berust op de allelen H n k (niet kaal) en H (kaal). In aanwezigheid van hoge concentraties

Nadere informatie

TENTAMEN BIOCHEMIE (8S135) Prof. Dr. Ir. L. Brunsveld :00 17:00 (totaal 100 punten) 6 opgaven in totaal (aangegeven tijd is indicatie)

TENTAMEN BIOCHEMIE (8S135) Prof. Dr. Ir. L. Brunsveld :00 17:00 (totaal 100 punten) 6 opgaven in totaal (aangegeven tijd is indicatie) TENTAMEN BIOCHEMIE (8S135) Prof. Dr. Ir. L. Brunsveld 25-01-2010 14:00 17:00 (totaal 100 punten) 6 opgaven in totaal (aangegeven tijd is indicatie) 1 (~30 minuten; 20 punten) Onderstaand is een stukje

Nadere informatie

Copyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

Copyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings De meeste organismen hebben een twee sets chromosomen, met daarop informatie voor alle eigenschappen van dat organisme (diploid) Deze erfelijke informatie noemen we het genotype Hoe deze erfelijke informatie

Nadere informatie

Juli blauw Biologie Vraag 1

Juli blauw Biologie Vraag 1 Biologie Vraag 1 Bij bijen komt parthenogenese voor. Dit is de ontwikkeling van een individu uit een onbevruchte eicel. Bij bijen ontstaan de darren (mannelijke bijen) parthenogenetisch. De koningin en

Nadere informatie

Juli geel Biologie Vraag 1

Juli geel Biologie Vraag 1 Biologie Vraag 1 Bij bijen komt parthenogenese voor. Dit is de ontwikkeling van een individu uit een onbevruchte eicel. Bij bijen ontstaan de darren (mannelijke bijen) parthenogenetisch. De koningin en

Nadere informatie

STEMPEL DE WEG VAN GEN NAAR EIWIT

STEMPEL DE WEG VAN GEN NAAR EIWIT A LIFE TYPEFACE STEMPEL DE WEG VAN GEN NAAR EIWIT De eiwitsynthese is één van de belangrijkste processen die zich in de cel afspelen. Eiwitten staan aan de basis van het functioneren van de cel. Wat een

Nadere informatie

Thymine is een pyrimidinebase en vormt 3 waterstofbruggen met adenine. Adenine is een purinebase en vormt 2 waterstofbruggen met thymine.

<A> Thymine is een pyrimidinebase en vormt 3 waterstofbruggen met adenine. <B> Adenine is een purinebase en vormt 2 waterstofbruggen met thymine. Biologie Vraag 1 Welke uitspraak is correct? Thymine is een pyrimidinebase en vormt 3 waterstofbruggen met adenine. Adenine is een purinebase en vormt 2 waterstofbruggen met thymine. Cytosine

Nadere informatie

Adenine is een purinebase en vormt 2 waterstofbruggen met thymine. Guanine is een pyrimidinebase en vormt 2 waterstofbruggen met cytosine.

<A> Adenine is een purinebase en vormt 2 waterstofbruggen met thymine. <B> Guanine is een pyrimidinebase en vormt 2 waterstofbruggen met cytosine. Biologie Vraag 1 Welke uitspraak is correct? Adenine is een purinebase en vormt 2 waterstofbruggen met thymine. Guanine is een pyrimidinebase en vormt 2 waterstofbruggen met cytosine. Thymine

Nadere informatie

Welke van de bovenstaande celorganellen of levensprocessen kunnen zowel in prokaryote, als in eukaryote cellen voorkomen?

Welke van de bovenstaande celorganellen of levensprocessen kunnen zowel in prokaryote, als in eukaryote cellen voorkomen? Biologie Vraag 1 Celorganellen en levensprocessen bij levende cellen zijn: 1. Ribosomen 2. ATP synthese 5. DNA polymerase 3. Celmembranen 6. Fotosynthese 4. Kernmembraan 7. Mitochondria Welke van de bovenstaande

Nadere informatie

Van mens tot Cel oefenvragen 1. De celdeling bestaat uit verschillende fasen. Hoe heten de G1, S en de G2 fase samen?

Van mens tot Cel oefenvragen 1. De celdeling bestaat uit verschillende fasen. Hoe heten de G1, S en de G2 fase samen? Van mens tot Cel oefenvragen 1. De celdeling bestaat uit verschillende fasen. Hoe heten de G1, S en de G2 fase samen? A: interfase B: profase C: anafase D: cytokinese 2. Een SNP (single nucleotide polymorphism)

Nadere informatie

Level 1. Vul het juiste woord in

Level 1. Vul het juiste woord in Level 1 Vul het juiste woord in Keuze uit: Gen, Allel, Locus, Dominant, Recessief, Co-dominantie, Monohybride kruising, Dihybride kruising, Autosoom, Autosomale overerving, X-chromosomale overerving, Intermediair

Nadere informatie

Welke van de bovenstaande celorganellen of levensprocessen kunnen zowel in prokaryote, als in eukaryote cellen voorkomen?

Welke van de bovenstaande celorganellen of levensprocessen kunnen zowel in prokaryote, als in eukaryote cellen voorkomen? Biologie Vraag 1 Celorganellen en levensprocessen bij levende cellen zijn: 1. Ribosomen 2. ATP synthese 5. DNA polymerase 3. Celmembranen 6. Fotosynthese 4. Kernmembraan 7. Mitochondria Welke van de bovenstaande

Nadere informatie

1 (~20 minuten; 20 punten)

1 (~20 minuten; 20 punten) TENTAMEN Moleculaire Cel Biologie (8A840) Prof. Dr. Ir. L. Brunsveld & Dr. M. Merkx 27-01-2012 14:00 17:00 (totaal 100 punten) 6 opgaven in totaal + 1 bonusvraag! (aangegeven tijd is indicatie) Gebruik

Nadere informatie

Proteomics. Waarom DNA alleen niet genoeg is

Proteomics. Waarom DNA alleen niet genoeg is Proteomics Waarom DNA alleen niet genoeg is Reinout Raijmakers Netherlands Proteomics Centre Universiteit Utrecht, Biomolecular Mass Spectrometry and Proteomics Group Van DNA naar organisme Eiwitten zijn

Nadere informatie

3. Eén gen kan vele allelen hebben. Hoeveel allelen van één gen heeft ieder individu?

3. Eén gen kan vele allelen hebben. Hoeveel allelen van één gen heeft ieder individu? Genetica Vragen bij hoofdstuk 13, 14 en 15 van 'Biology', Campbell, 7e druk Versie 2006 2007 Theorie 1. Hoe noemt men een plant die raszuiver is voor een bepaalde eigenschap? 2. Hoe noemt men planten met

Nadere informatie

Voorbereiding toelatingsexamen arts/tandarts. Biologie: Erfelijke informatie in de cel 6/29/2013. dr. Brenda Casteleyn

Voorbereiding toelatingsexamen arts/tandarts. Biologie: Erfelijke informatie in de cel 6/29/2013. dr. Brenda Casteleyn Voorbereiding toelatingsexamen arts/tandarts Biologie: Erfelijke informatie in de cel 6/29/2013 dr. Brenda Casteleyn Met dank aan: Leen Goyens (http://users.telenet.be/toelating) en studenten van forum

Nadere informatie

Humane levenscyclus 1

Humane levenscyclus 1 Humane levenscyclus 1 Genexpressie 2 8 september 2011 Doel: Genexpressie (via welke stappen de informatie die in het DNA is opgeslagen gebruikt kan worden om eiwitten te vormen. Differentiële genexpressie

Nadere informatie

Examen Voorbereiding DNA. Teylingen College Leeuwenhorst 2015/2016. 2016 JasperOut.nl. Thema 2 DNA

Examen Voorbereiding DNA. Teylingen College Leeuwenhorst 2015/2016. 2016 JasperOut.nl. Thema 2 DNA Examen Voorbereiding DNA Teylingen College Leeuwenhorst 2015/2016 Thema 2 DNA Begrippenlijst: Begrip mtdna kerndna Plasmiden Genoom DNA-replicatie DNA-polymerase Eiwitsynthese RNA-molecuul Codon Genregulatie

Nadere informatie

DNA van mitochondriën, chloroplasten en in bacteriën Enkele gegevens over het DNA van de mens Ontdekking van DNA structuur door Watson en Crick

DNA van mitochondriën, chloroplasten en in bacteriën Enkele gegevens over het DNA van de mens Ontdekking van DNA structuur door Watson en Crick Hoofdstuk1: Erfelijke informatie in de cel... 2 1. Bouw van de kern tijdens de interfase... 2 2. Nucleïnezuren... 2 2.1. Primaire structuur van nucleïnezuren... 3 2.1.1. Bouwstenen... 3 2.2. De ruimtelijke

Nadere informatie

De volgende vragen testen je kennis van de meest voorkomende vaktermen in de klassieke genetica. Welk woord ontbreekt in de volgende zinnen?

De volgende vragen testen je kennis van de meest voorkomende vaktermen in de klassieke genetica. Welk woord ontbreekt in de volgende zinnen? Populatiegenetica Versie 2006-2007 Vragen bij COO Belangrijke begrippen De volgende vragen testen je kennis van de meest voorkomende vaktermen in de klassieke genetica. Welk woord ontbreekt in de volgende

Nadere informatie

DNA & eiwitsynthese (Junior College Utrecht) Vragen bij COO-programma

DNA & eiwitsynthese (Junior College Utrecht) Vragen bij COO-programma DNA & eiwitsynthese (Junior College Utrecht) Vragen bij COO-programma De vragen die voorkomen in het COO-programma DNA & eiwitsynthese zijn op dit formulier weergegeven. Het is de bedoeling dat je, als

Nadere informatie

Computer Ondersteund Onderwijs (COO).

Computer Ondersteund Onderwijs (COO). Computer Ondersteund Onderwijs (COO). Over DNA en eiwit is er een computer praktikum. Bij dit COO leer je via een interactieve manier omgaan met de stof. Opstarten COO. Ga naar de site van het departement

Nadere informatie

www. Biologie 2001 Vraag 1 Dit zijn een aantal gegevens over een nucleïnezuur. 1. Het is een enkelvoudige keten. 2. Het bevat als basen: G - A - C - T. 3. Het varieert naargelang de soort cel binnen één

Nadere informatie

HAVO 5 Begrippenlijst Erfelijkheid allel Allelen zijn verschillende vormen van een gen. Zij liggen in homologe chromosomen op precies dezelfde

HAVO 5 Begrippenlijst Erfelijkheid allel Allelen zijn verschillende vormen van een gen. Zij liggen in homologe chromosomen op precies dezelfde HAVO 5 Begrippenlijst Erfelijkheid allel Allelen zijn verschillende vormen van een gen. Zij liggen in homologe chromosomen op precies dezelfde plaats. Allelen coderen voor dezelfde eigenschap bijvoorbeeld

Nadere informatie

biologie vwo 2017-I Gespierder door gendoping

biologie vwo 2017-I Gespierder door gendoping Gespierder door gendoping Het overdragen van genetisch materiaal naar menselijke cellen voor de behandeling van ziektes bevindt zich nog in een experimenteel stadium. Deze techniek zou ook gebruikt kunnen

Nadere informatie

Biologie Vraag 1 Vraag 1. Dit zijn een aantal gegevens over een nucleïnezuur.

Biologie Vraag 1 <A> <B> <C> <D> Vraag 1. Dit zijn een aantal gegevens over een nucleïnezuur. Biologie Vraag 1 Dit zijn een aantal gegevens over een nucleïnezuur. 1. Het is een enkelvoudige keten. 2. Het bevat als basen: G A C T. 3. Het varieert naargelang de soort cel binnen één organisme. 4.

Nadere informatie

1 (~20 minuten; 15 punten)

1 (~20 minuten; 15 punten) HERTENTAMEN Moleculaire Cel Biologie (8A840) Prof. Dr. Ir. L. Brunsveld & Dr. M. Merkx 20-04-2012 14:00 17:00 (totaal 100 punten) 6 opgaven in totaal + 1 bonusvraag! (aangegeven tijd is indicatie) Gebruik

Nadere informatie

AAbb of Aabb = normaal zicht aabb of aabb = retinitis pigmentosa AABB of AABb = retinitis pigmentosa

AAbb of Aabb = normaal zicht aabb of aabb = retinitis pigmentosa AABB of AABb = retinitis pigmentosa 13. (MC) Retinitis pigmentosa is een erfelijke vorm van blindheid, die kan veroorzaakt worden door een recessief allel (a) op een locus alfa, of door een dominant allel (B) op een andere locus, bèta. Onderstaande

Nadere informatie

a. Geef de 1-lettercode van de aminozuren in het peptide in de corresponderende volgorde. (4P)

a. Geef de 1-lettercode van de aminozuren in het peptide in de corresponderende volgorde. (4P) HERTENTAMEN Eindtoets BIOCHEMIE (8RA00) Prof. Dr. Ir. L. Brunsveld 16-08-2013 09:00 12:00 (totaal 100 punten) 6 opgaven in totaal! (aangegeven tijd is indicatie) Gebruik geen rode pen! 1 Peptiden en eiwitten

Nadere informatie

Newsletter April 2013

Newsletter April 2013 1. Inleiding Met het thema van deze nieuwsbrief willen we ons richten op de fundamenten van het fokken: de basisgenetica. Want of je het nu wil of niet. dit is ook de basis voor een succesvolle fok! Misschien

Nadere informatie

Examen Voorbereiding Erfelijkheid

Examen Voorbereiding Erfelijkheid Examen Voorbereiding Erfelijkheid Teylingen College Leeuwenhorst 2015/2016 Thema 4 Erfelijkheid Begrippenlijst: Begrip DNA-sequentie Genexpressie Epigenetica Homozygoot Heterozygoot Intermediair Monohybride

Nadere informatie

1. Mendeliaanse overerving - koppelingsanalyse

1. Mendeliaanse overerving - koppelingsanalyse 1. Mendeliaanse overerving - koppelingsanalyse 1.1 Inleiding Genetische kenmerken die afhangen van één enkel gen (meer precies : locus) noemen wij mendeliaans. Mendeliaanse kenmerken segregeren in families

Nadere informatie

KaHo Sint-Lieven. Departement Gent Campus Gildestraat. Examenperiode: juni 2006 (maand/jaar)

KaHo Sint-Lieven. Departement Gent Campus Gildestraat. Examenperiode: juni 2006 (maand/jaar) KaH Sint-Lieven Departement Gent Campus Gildestraat Examenvragen Opleiding: Bimedische labratriumtechnlgie Afstudeerrichting: OO: Mleculaire bilgie OA: - Examenperide: juni 2006 (maand/jaar) Type examen:

Nadere informatie

Leerlingenhandleiding

Leerlingenhandleiding Leerlingenhandleiding Niveau: basis Bioinformatica: leven in de computer Ontwikkeld door het Netherlands Bioinformatics Centre in samenwerking met het Centre for Molecular and Biomolecular Informatics

Nadere informatie

Welke van de bovenstaande celorganellen of levensprocessen kunnen zowel in prokaryote, als in eukaryote cellen voorkomen?

Welke van de bovenstaande celorganellen of levensprocessen kunnen zowel in prokaryote, als in eukaryote cellen voorkomen? Biologie Vraag 1 Celorganellen en levensprocessen bij levende cellen zijn: 1. Ribosomen 2. ATP synthese 5. DNA polymerase 3. Celmembranen 6. Fotosynthese 4. Kernmembraan 7. Mitochondria Welke van de bovenstaande

Nadere informatie

Vragenlijst Module cellen

Vragenlijst Module cellen De uitwerking van de vragen zet je in de verslagen van je practica! (LEES LAATSTE BLADZIJDE!) Cursief gedrukte blauwe vragen alleen voor bio-mensen!! Vragenlijst Module cellen 1. Noem drie verschillen

Nadere informatie

Oefenvragen Mens tot Cel

Oefenvragen Mens tot Cel Oefenvragen Mens tot Cel 1. In de familie van Tineke komt sma type 1 voor. Sma type 1 staat voor spinale spier atrofie type 1. De oom van Tineke heeft sma type 1 (zie de stamboom hieronder). Hoe groot

Nadere informatie

Paragraaf Homologe chromosomen

Paragraaf Homologe chromosomen Paragraaf Homologe chromosomen Opbouw: Lees de les op biologielessn.nl over homologe chromosomen goed door. Maak de onderstaande vragen van deze bladzijde. Reproductie vragen: 1. Wat zijn homologe chromosomen?

Nadere informatie

Begrippenlijst DNA adenine Eén van de nucelotidebasen die in DNA en RNA voorkomen. Adenine (A) vormt een basenpaar met thymine (T) in het DNA en met

Begrippenlijst DNA adenine Eén van de nucelotidebasen die in DNA en RNA voorkomen. Adenine (A) vormt een basenpaar met thymine (T) in het DNA en met Begrippenlijst DNA adenine Eén van de nucelotidebasen die in DNA en RNA voorkomen. Adenine (A) vormt een basenpaar met thymine (T) in het DNA en met uracil (U) in RNA. Adenine komt ook voor in AMP, ADP,

Nadere informatie

Copyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

Copyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings De meeste organismen hebben een twee sets chromosomen, met daarop informatie voor alle eigenschappen van dat organisme (diploid) Deze erfelijke informatie noemen we het genotype Hoe deze erfelijke informatie

Nadere informatie

Let er op dat je voor iedere vraag een uitwerking maakt met kruisingsschema en/of berekening.

Let er op dat je voor iedere vraag een uitwerking maakt met kruisingsschema en/of berekening. Week Thema Onderwerp Datum 43 3 Basisstof 1 t/m 4 23/10 28/10 44 3 Basisstof 1 t/m 4 31/10 4/11 45 7/11 11/11 Basisstof 5 t/m 7 bespreken 3 Basisstof 5 t/m 7 bespreken Verrijkingsstof 1 Herhalen en bespreken

Nadere informatie

V6 Oefenopgaven oktober 2009

V6 Oefenopgaven oktober 2009 V6 Oefenopgaven oktober 2009 Fitness Met fitness wordt in de biologie bedoeld het vermogen van genotypen om hun allelen naar de volgende generatie over te dragen. De fitness wordt uitgedrukt in een getal

Nadere informatie

STEMPEL DE WEG VAN GEN NAAR EIWIT

STEMPEL DE WEG VAN GEN NAAR EIWIT A LIFE TYPEFACE STEMPEL DE WEG VAN GEN NAAR EIWIT De eiwitsynthese is één van de belangrijkste processen die zich in de cel afspelen. Eiwitten staan aan de basis van het functioneren van de cel. Wat een

Nadere informatie

Biotechnologie deel II

Biotechnologie deel II Biotechnologie deel II Hand-out bij de tweede oefen- en zelftoetsmodule van Biotechnologie & maatschappij behorende bij hoofdstuk 6, 7, 8 en 11 van Introduction to Biotechnology, Thieman & Palladino, 3

Nadere informatie

Grootste examentrainer en huiswerkbegeleider van Nederland. Biologie. Trainingsmateriaal. De slimste bijbaan van Nederland! lyceo.

Grootste examentrainer en huiswerkbegeleider van Nederland. Biologie. Trainingsmateriaal. De slimste bijbaan van Nederland! lyceo. Grootste examentrainer en huiswerkbegeleider van Nederland Biologie Trainingsmateriaal De slimste bijbaan van Nederland! lyceo.nl Traininingsmateriaal Biologie Lyceo-trainingsdag 2015 Jij staat op het

Nadere informatie

Docentenhandleiding. Afsluitende module. Op zoek naar een gen in een databank

Docentenhandleiding. Afsluitende module. Op zoek naar een gen in een databank Docentenhandleiding Afsluitende module Op zoek naar een gen in een databank Ontwikkeld door het Cancer Genomics Centre in samenwerking met het Freudenthal Instituut voor Didactiek van Wiskunde en Natuurwetenschappen

Nadere informatie

Biologie 2000 Vraag 1 De plaats waar de chromatiden van een chromosoom tijdens de eerste fasen van een cel/kerndeling aan mekaar vastzitten noemt men: A. Centriool B. Centromeer C. Centrosoom D. Chromomeer

Nadere informatie

1. Welk(e) van de volgende baseparen komt(en) van nature voor in een DNA dubbele helix. Omcirkel deze. C-G

1. Welk(e) van de volgende baseparen komt(en) van nature voor in een DNA dubbele helix. Omcirkel deze. C-G Tentamen Biochemie MST. Deel 2 29 oktober 201 1:0-1:0u (17:00u met handicap) Antwoorden invullen op dit vel. 90 punten is een Den, 0 punten is een 1 Naam: Studentnr: 1. Welk(e) van de volgende baseparen

Nadere informatie

Een rondleiding door de cel (COO 2)

Een rondleiding door de cel (COO 2) Een rondleiding door de cel (COO 2) Vragen bij de oefen- en zelftoets-module behorende bij hoofdstuk 7 en 8 van Biology, Campbell, 9 e druk Versie 2012-2013 De vragen die voorkomen in het COO-programma

Nadere informatie

Samenvattingen. Samenvatting Thema 4: Erfelijkheid. Basisstof 1. Basisstof 2. Erfelijke eigenschappen:

Samenvattingen. Samenvatting Thema 4: Erfelijkheid. Basisstof 1. Basisstof 2. Erfelijke eigenschappen: Samenvatting Thema 4: Erfelijkheid Basisstof 1 Erfelijke eigenschappen: - Genotype: o genen liggen op de chromosomen in kernen van alle cellen o wordt bepaald op moment van de bevruchting - Fenotype: o

Nadere informatie

Gentechnologie & moleculaire analysetechnieken Godelieve Gheysen 1999-2000 eerste zit

Gentechnologie & moleculaire analysetechnieken Godelieve Gheysen 1999-2000 eerste zit Gentechnologie en moleculaire analysetechnieken Godelieve Gheysen 1 Gentechnologie & moleculaire analysetechnieken Godelieve Gheysen 1999-2000 eerste zit Gentechnologie en moleculaire analysetechnieken

Nadere informatie

Transcriptie en de Genetische code

Transcriptie en de Genetische code Transcriptie en de Genetische code DNA getranscripteerd tot RNA, 3 grote groepen mrna: codeert voor proteïnen rrna: onderdeel van de Ribosomen trna: koppeling tussen AZ en het mrna De informatieflow gaat

Nadere informatie

Examentraining onderwerp: diagrammen Lees eerst de vraag. ga dan naar de tekst! onderwerp: Bloedsomloop Lees eerst de vraag. ga dan naar de tekst!

Examentraining onderwerp: diagrammen Lees eerst de vraag. ga dan naar de tekst! onderwerp: Bloedsomloop Lees eerst de vraag. ga dan naar de tekst! Examentraining onderwerp: diagrammen Moet er een diagram getekend worden? Bedenk: Welk type grafiek is er nodig. Is het een Lijndiagram? bedenk dan: wat komt er op de X-as? (de onafhankelijke variabele,

Nadere informatie

Vragen bij paragraaf 5.1 en 5.2

Vragen bij paragraaf 5.1 en 5.2 Vragen bij paragraaf 5.1 en 5.2 1. Geef van onderstaande begrippen een omschrijving. celdifferentiatie overgang van stamcellen in specifieke cellen (specialisatie) katalysator een stof die een bepaalde

Nadere informatie

Tentamen Celbiologie. DATUM TIJD 14 tot 17 uur ZAAL N109 Wentgebouw. Beantwoord elk onderdeel op een apart vel. Veel succes!

Tentamen Celbiologie. DATUM TIJD 14 tot 17 uur ZAAL N109 Wentgebouw. Beantwoord elk onderdeel op een apart vel. Veel succes! Tentamen Celbiologie DATUM 19-11-2004 TIJD 14 tot 17 uur ZAAL N109 Wentgebouw. Dit tentamen bestaat uit onderdelen: - Onderdeel 1 bestaat uit twee vragen (vraag 1-2) 20 punten - Onderdeel 2 bestaat uit

Nadere informatie

Mogelijke combinaties van genotypen. Mogelijke combinaties van fenotypen. Deze kruising levert 2 X 2 = 4 fenotypen.

Mogelijke combinaties van genotypen. Mogelijke combinaties van fenotypen. Deze kruising levert 2 X 2 = 4 fenotypen. Leertaak 8A 1. Bij de mens berust een bruine oogkleur op het dominante allel B. Een blauwe oogkleur berust op het recessieve alle b. Rechtshandigheid berust op het dominante allel H en linkshandigheid

Nadere informatie

3 Rundveefokkerij Melkproductiecontrole Selectie Fokwaardeschatting Inseminatieplannnen 69 3.

3 Rundveefokkerij Melkproductiecontrole Selectie Fokwaardeschatting Inseminatieplannnen 69 3. Inhoud Voorwoord 5 Inleiding 6 1 Veiligheidsvoorschriften 9 1.1 Genen en hun vererving 9 1.2 Genotype en fenotype 14 1.3 Erfelijke gebreken 18 1.4 Genfrequenties 25 1.5 Afsluiting 27 2 Fokmethoden 28 2.1

Nadere informatie

De antwoorden op vragen 1 en 2, 3 en 4, en 5 t/m 8 graag op verschillende vellen schrijven. Vergeet ook niet op de 3 vellen je naam en studentnr.

De antwoorden op vragen 1 en 2, 3 en 4, en 5 t/m 8 graag op verschillende vellen schrijven. Vergeet ook niet op de 3 vellen je naam en studentnr. Tentamen Genoombiologie, 28 Oktober 2009, 9.00-11.45 h De antwoorden op vragen 1 en 2, 3 en 4, en 5 t/m 8 graag op verschillende vellen schrijven. Vergeet ook niet op de 3 vellen je naam en studentnr.

Nadere informatie

2 Leg uit hoe de verschillende subtypes van Chlamydia trachomatis zijn ontstaan. Beschrijf de rol van antibioticagebruik hierin.

2 Leg uit hoe de verschillende subtypes van Chlamydia trachomatis zijn ontstaan. Beschrijf de rol van antibioticagebruik hierin. Examentrainer Vragen Nieuwe DNA-test voor chlamydia Chlamydia is de meest voorkomende seksueel overdraagbare aandoening (soa) en kan onder meer leiden tot onvruchtbaarheid. In Nederland worden jaarlijks

Nadere informatie

ERFELIJKHEID. 1 N i e t a l l e m a a l h e t z e l f d e Afbeelding 17-2

ERFELIJKHEID. 1 N i e t a l l e m a a l h e t z e l f d e Afbeelding 17-2 ERFELIJKHEID 1 N i e t a l l e m a a l h e t z e l f d e Afbeelding 17-2 Afbeelding 17-1 Mensen uit elkaar houden vind je vast makkelijker. Toch hebben ook mensen veel meer overeenkomsten dan verschillen.

Nadere informatie

1. Welk van de onderstaande DNA sequenties zijn mogelijke herkenning-sites voor restrictie-enzymen? c 5' GAATTC 3' c 5' GGGGCCCC 3' c 5' CTGCAG 3' 5'

1. Welk van de onderstaande DNA sequenties zijn mogelijke herkenning-sites voor restrictie-enzymen? c 5' GAATTC 3' c 5' GGGGCCCC 3' c 5' CTGCAG 3' 5' proefexamen 1. Welk van de onderstaande DNA sequenties zijn mogelijke herkenning-sites voor restrictie-enzymen? c 5' GAATTC 3' c 5' GGGGCCCC 3' c 5' CTGCAG 3' 5' CTAAATC 3' 5' GGAACC 3' Restriction Endonucleases

Nadere informatie

1 Peptiden en eiwitten (~20 minuten; 20 punten)

1 Peptiden en eiwitten (~20 minuten; 20 punten) 1 Peptiden en eiwitten (~20 minuten; 20 punten) a. Beschouw bovenstaand synthetisch peptide. Het bevat het aminozuur ornithine, een intermediair in de biosynthese van arginine, welke normaal gesproken

Nadere informatie

2 Voortplanten met organen Bouw en werking van geslachtsorganen Werking van geslachtshormonen Afsluiting 31

2 Voortplanten met organen Bouw en werking van geslachtsorganen Werking van geslachtshormonen Afsluiting 31 Inhoud Voorwoord 5 Inleiding 6 1 Voortplanten van genen 9 1.1 Genetica 9 1.2 Kruisingen 13 1.3 Crossing-over en mutatie 16 1.4 Erfelijkheid en praktijk 17 1.5 Inteelt en inteeltdepressie 21 1.6 Afsluiting

Nadere informatie

Welke van de onderstaande structuren maakt spiercontractie mogelijk?

Welke van de onderstaande structuren maakt spiercontractie mogelijk? Biologie Vraag 1 Welke van de onderstaande structuren maakt spiercontractie mogelijk? Microtubuli Microfilamenten Intermediaire filamenten Microvilli Biologie: vraag 1 Biologie Vraag 2

Nadere informatie

1 Antwoorden Monohybride Kruisingen

1 Antwoorden Monohybride Kruisingen 1 Antwoorden Monohybride Kruisingen 1) A = zwart haar, a = wit haar P: Aa x Aa F1: A a A AA Aa Alleen genotype aa geeft wit haar, dus 25 % 2) a) Eigenschap C (= A) b) Aa c) Aa d) AA of Aa 3) zwart : wit

Nadere informatie

a. Geef de 1-lettercode van de aminozuren in het peptide in de corresponderende volgorde. (4P) LLORETDEMAR (iedere fout -1P)

a. Geef de 1-lettercode van de aminozuren in het peptide in de corresponderende volgorde. (4P) LLORETDEMAR (iedere fout -1P) TENTAMEN BIOCHEMIE (8RA00) Prof. Dr. Ir. L. Brunsveld 28-06-2013 09:00 12:00 (totaal 100 punten) 6 opgaven in totaal! (aangegeven tijd is indicatie) Gebruik geen rode pen! 1 Peptiden en eiwitten (~15 minuten;

Nadere informatie

Rondleiding door de cel

Rondleiding door de cel Rondleiding door de cel Interactieve opgaven bij de hoofdstukken 5 t/m 8 van Biology, Campbell Deze module behandelt de volgende delen van hoofdstukken van Campbell s Biology : Hoofdstuk 5.4, pagina 77-86:

Nadere informatie

Oplossingen Biologie van 2000

Oplossingen Biologie van 2000 www. Oplossingen Biologie van 2000 Disclaimer: Alle uitwerkingen zijn onder voorbehoud van eventuele fouten. Er is geen enkele aansprakelijkheid bij de auteur van deze documenten. Vraag 1 Om deze vraag

Nadere informatie

2. Erfelijkheid en de ziekte van Huntington

2. Erfelijkheid en de ziekte van Huntington 2. Erfelijkheid en de ziekte van Huntington Erfelijkheid Erfelijk materiaal in de 46 chromosomen De mens heeft in de kern van elke lichaamscel 46 chromosomen: het gaat om 22 paar lichaamsbepalende chromosomen

Nadere informatie

Fenotype nakomelingen. donker kort 29 donker lang 9 wit kort 31 wit- lang 11

Fenotype nakomelingen. donker kort 29 donker lang 9 wit kort 31 wit- lang 11 1. Bij honden is het allel voor donkerbruine haarkleur (E) dominant over het allel voor witte haarkleur (e). Het allel voor kort haar (F) is dominant over het allel voor lang haar (f). Een aantal malen

Nadere informatie

Erfelijkheidsschema's deel 1.

Erfelijkheidsschema's deel 1. Erfelijkheidsschema's deel 1. Theorie: o Elke cel bevat 2n chromosomen. n = aantal verschillende chromosomen. Bij mensen is n=23 en dus zitten in elke lichaamscel 23 paar (46) chromosomen. Eén deel kreeg

Nadere informatie

Vraag /144. Vraag 14

Vraag /144. Vraag 14 Vraag 13 107/144 De kinderen van Romeo en Julia kunnen de ziekte enkel hebben indien hun beide ouders heterozygoot zijn. Hoe groot is die kans? Julia's broer Augusto heeft de ziekte, dus moeten zowel Laura

Nadere informatie

Nederlandse samenvatting

Nederlandse samenvatting Nederlandse samenvatting 111 Dit proefschrift behandelt de diagnose van epidermolysis bullosa simplex (EBS) op DNA niveau en een eerste aanzet tot het ontwikkelen van gentherapie voor deze ziekte. Een

Nadere informatie

Basisstof 7 Genetische variatie

Basisstof 7 Genetische variatie Afbeelding 33. RNA-interferentie.1 RNA bevat 2 complementaire sequenties die aan elkaar plakken, zodat er een haarspeld structuur ontstaat (1 van afbeelding 33). Het enzym Dicer knipt het dubbele RNA in

Nadere informatie

Examen VWO. Biologie. Voorbereidend Wetenschappelijk Onderwijs Tijdvak 1 Woensdag 19 mei 13.30 16.30 uur. Boekje met informatie.

Examen VWO. Biologie. Voorbereidend Wetenschappelijk Onderwijs Tijdvak 1 Woensdag 19 mei 13.30 16.30 uur. Boekje met informatie. Biologie Examen VWO Voorbereidend Wetenschappelijk Onderwijs Tijdvak 1 Woensdag 19 mei 13.30 16.30 uur 19 99 Boekje met informatie 900006 18B Begin informatie 1 Indicatorsoorten van de macrofauna voor

Nadere informatie

4 HAVO thema 4 Erfelijkheid EXAMENTRAINER OEFENVRAGEN

4 HAVO thema 4 Erfelijkheid EXAMENTRAINER OEFENVRAGEN Examentrainer Vragen Karyogrammen In afbeelding 1 zijn twee karyogrammen weergegeven. Deze karyogrammen zijn afkomstig van een eeneiige tweeling. Het ene kind is van het mannelijk geslacht zonder duidelijke

Nadere informatie

Diagnostische toets Van HIV tot AIDS?

Diagnostische toets Van HIV tot AIDS? Diagnostische toets Van HIV tot AIDS? Moleculen 1. Basenparing In het DNA vindt basenparing plaats. Welke verbinding brengt een basenpaar tot stand? A. Peptidebinding B. Covalente binding C. Zwavelbrug

Nadere informatie

Genetica. Marvin Tersluijsen. CC Naamsvermelding-GelijkDelen 3.0 Nederland licentie.

Genetica. Marvin Tersluijsen. CC Naamsvermelding-GelijkDelen 3.0 Nederland licentie. Auteur Laatst gewijzigd Licentie Webadres Marvin Tersluijsen 08 April 2016 CC Naamsvermelding-GelijkDelen 3.0 Nederland licentie http://maken.wikiwijs.nl/74428 Dit lesmateriaal is gemaakt met Wikiwijsleermiddelenplein.

Nadere informatie

Het enzym dat verantwoordelijk is voor het vastleggen van de imprint na de DNA-replicatie is een DNA-methyltransferase.

Het enzym dat verantwoordelijk is voor het vastleggen van de imprint na de DNA-replicatie is een DNA-methyltransferase. Examentrainer Vragen Hongerwinterkinderen Gedurende de laatste winter van de Tweede Wereldoorlog stierven veel Nederlanders door barre omstandigheden: koude en voedselgebrek. Tijdens deze hongerwinter

Nadere informatie

Genetische Selectie. Eindwerk: hondenfokker 2 de jaar. Sabine Spiltijns

Genetische Selectie. Eindwerk: hondenfokker 2 de jaar. Sabine Spiltijns Genetische Selectie Eindwerk: hondenfokker 2 de jaar Sabine Spiltijns 2010-2011 0 We kunnen aan de hand van een genetische selectie ongeveer voorspellen hoe de puppy s van onze hondjes er gaan uitzien.

Nadere informatie

Erfelijkheid. Examen VMBO-GL en TL. biologie CSE GL en TL. Bij dit examen hoort een bijlage.

Erfelijkheid. Examen VMBO-GL en TL. biologie CSE GL en TL. Bij dit examen hoort een bijlage. Examen VMBO-GL en TL Erfelijkheid biologie CSE GL en TL Bij dit examen hoort een bijlage. Dit examen bestaat uit 26 vragen. Voor dit examen zijn maximaal 30 punten te behalen. Voor elk vraagnummer staat

Nadere informatie

Van Nico van Hove en Niek Spronsen. Begeleider: Dhr. Van Piekeren

Van Nico van Hove en Niek Spronsen. Begeleider: Dhr. Van Piekeren Van Nico van Hove en Niek Spronsen. Begeleider: Dhr. Van Piekeren Inhoudsopgave: Uitleg begrippen Inleiding Plan van aanpak Werkwijze Het onderzoek De resultaten Conclusie/discussie Uitleg begrippen, termen

Nadere informatie