HERKANSINGSTENTAMEN Moleculaire Biologie deel 2, 5 Jan 2007

Maat: px
Weergave met pagina beginnen:

Download "HERKANSINGSTENTAMEN Moleculaire Biologie deel 2, 5 Jan 2007"

Transcriptie

1 HERKANSINGSTENTAMEN Moleculaire Biologie deel 2, 5 Jan 2007 NAAM: STUDENTNUMMER: CONTROLEER OF DIT TENTAMEN 14 PAGINA S BEVAT. Veel succes! o Je mag de achterkant van het papier ook zo nodig gebruiken, maar beantwoord vragen 1-7 niet op blaadjes van vraag 8 en de daarop volgende. o Zet VOORDAT JE BEGINT MET ANTWOORDEN je naam en studentnummer op bladzijden 1 en Vul het juiste antwoord in op de stippellijn. -Hoe noemt men planten met verschillende allelen van één gen? zygoot -Genen kunnen meerdere hebben. -Eén gen kan vele allelen hebben. Hoeveel allelen van één gen heeft ieder individu?... -Bij welk type overerving ligt de eigenschap van de heterozygoot tussen die van de homozygote vormen in? Bij welk type overerving komen in de heterozygoot beide eigenschappen tot expressie? Hoe noemt men het uiterlijk van een individu? Hoe noemt men de erfelijke eigenschappen van een individu? De overerving hangt soms af van het geslacht van het individu. Bij welk type overerving komt een erfelijke eigenschap bij mannen en vrouwen even vaak voor? Zegt het fenotype precies wat het genotype is? Leg uit Valt bij co-dominante overerving het genotype uit het fenotype af te leiden? Leg uit Tentamen toets 2 Mol Biologie Januari

2 2a. De onderstaande genen liggen op 1 chromosoom. Gebruik de volgende recombinatie data bij het maken van een genetische kaart. Geef de volgorde aan van de genen aan de hand van de kleinste intervals. Gen locus Recombinatie (%) Gen (locus) Recombinatie (%) a,b 50 b,d 13 a,c 15 b,e 50 a,d 38 c,d 50 a,e 8 c,e 7 b,c 50 c,e 45 b. Wanneer je kijkt naar de afstanden in je genetische kaart zijn deze niet strikt additief (optelbaar). Wat is de oorzaak van dit verschil? c. De recombinatie frequentie kan niet groter zijn dan 50%, maar een genetische kaart kan langer zijn dan 50 cm. Leg uit hoe dat kan. Tentamen toets 2 Mol Biologie Januari

3 3. I a, I b, I o zijn allelen van een gen dat voor een enzym codeert dat suikerketens aan het membraanoppervlak van rode bloedcellen kan koppelen. a. Welke fenotypes (dus welke suikergroepen verwacht je op het membraan) en welke ratio s verwacht je bij de kinderen van de volgende ouders: 1. I a I a x I b I b 2. I a I b x I o I o 3. I a I o x I b I o 4. I a I o x I o I o b. Hoe heet dit principe van overerving? Tentamen toets 2 Mol Biologie Januari

4 4. Bij tomaten is het recessieve allel d verantwoordelijk voor dwerggroei en het recessieve p allel zorgt voor de vorming van peervormige in plaats van de normale ronde tomaten. Tussen beide loci treedt 30% recombinatie op. Plant I van normaal postuur en met ronde vruchten wordt gekruist met een dwerg die peervormige vruchten draagt. Dit levert de volgende nakomelingen: 81 normale planten; 79 dwergen met peren; 22 normale planten met peervruchten; 17 dwergen met normale vruchten. Plant II, fenotypisch gelijk aan plant I, werd aan dezelfde proefkruising onderworpen en leverde: 21 normale planten met peervormige vruchten; 18 dwergen met ronde tomaten; 5 volkomen normale planten; 4 dwergen met peren. a. Geef de positie van de betrokken allelen op de chromosomen van plant I en II aan. b. Welke nakomelingen en in welke verhoudingen verwacht je uit een kruising tussen plant I en plant II? Tentamen toets 2 Mol Biologie Januari

5 5. Een lineair stuk DNA van 5000 bp lang is geknipt met restrictie enzym A en met B, beide apart in een enkel digest (twee linker kolommen hieronder), en met A en B samen in een dubbel-digest (rechterkolom). De volgende DNA fragmenten zijn gevonden aan de hand van gelelektroforese: A B A+B 2100 bp 2500 bp 1900 bp 1400 bp 1300 bp 1000 bp 1000 bp 1200 bp 800 bp 500 bp 600 bp 500 bp 200 bp Vervolgens zijn de fragmenten van A (individueel) uit gel geïsoleerd en vervolgens geknipt met enzym B; elk fragment van B is ook geïsoleerd en geknipt met enzym A. De volgende banden zijn gevonden fragmenten met behulp van gel-elektroforese: Fragment A Fragment A geknipt met B Fragment B Fragment B geknipt met A , , , , , Teken de restrictiekaart van dit 5000 bp DNA fragment: Tentamen toets 2 Mol Biologie Januari

6 6a. Beschrijf de werking van telomerase. 6b. In welke cellen is telomerase actief? Tentamen toets 2 Mol Biologie Januari

7 7. Teken de replicatievork en geef de verschillende moleculen/enzymen weer. Tentamen toets 2 Mol Biologie Januari

8 NAAM: STUDENTNUMMER: 8a. In eukaryoten zoals de mens heeft elk gen gemiddeld drie enhancers. Wat is een enhancer? 8b. Wat is de functie van een enhancer? 8c. Gegeven is dat de mens ongeveer genen heeft (en dus enhancers). Hoeveel genen zullen ongeveer coderen voor een transcriptiefactor? Leg je antwoord uit. 9a. Wat is de functie van een poly(a)-staart aan het einde van een eukaryotisch mrna? 9b. Wat is een cap-structuur? (Als je het makkelijker vindt, mag je een schets maken) 9c. Wat is de functie van een cap-structuur? Tentamen toets 2 Mol Biologie Januari

9 GCCGTAATGCTGACTGACTGCAGTGAACGTGATGCCGTTGCCCT CGGCATTACGACTGACTGACGTCACTTGCACTACGGCAACGGGA Als gegeven is dat de bovenste streng in het hierboven gegeven dubbelstrengs DNA molecuul de matrijs ( template ) is, hoe ziet het mrna er dan uit? Begin aan het uiteinde en niet midden in de streng. Geef de polariteit aan in je antwoord. Je hoeft alleen de eerste 10 nucleotiden te geven. 11. Welke elementen bepalen of RNA polymerase op het DNA de ene of de andere kant opgaat ( links- of rechtsaf )? 12. Teken (a) het proces van splicing en geef (b) in je tekening de namen van betrokken moleculen. Tentamen toets 2 Mol Biologie Januari

10 13. Wat betekent Ala-tRNA Cys? (Verklaar de toevoegingen Ala en Cys en verklaar hoe dit molecuul zal functioneren.) 14. Hoe verloopt de initiatie van de eiwitsynthese in eukaryoten? Je moet ook een tekening maken. Tentamen toets 2 Mol Biologie Januari

11 15. Gegeven de sequentie van de stopcodons: UAG, UAA, en UGA, en de volgende sequentie van een denkbeeldig eukaryotisch mrna: 5...AAC UCC GGU AUC UAC UAA UAG AUG CCG GCC AUU CAA ACA UGA GGA UUA CCC AUG UCG AAG...3. Voor het gemak is de mrna sequentie gegeven per drietal nucleotiden. Het eiwit dat gecodeerd wordt door dit mrna start bij de dikgedrukte en onderlijnde AUG. a. Hoe wordt de sequentie 5 van de AUG genoemd? b. Wat valt je op aan de mrna sequentie? c. Welke conclusie trek je uit je antwoord van b? 16. Teken de HIV replicatie cyclus. Geef in je tekening essentiële namen en toevoegingen aan. Benoem getekende moleculen. Tentamen toets 2 Mol Biologie Januari

12 17a. Wat wordt bedoeld met negatief-strengig RNA? 17b. Waar vinden we dat RNA? 18a. De activiteit van het tryptofaan-operon wordt gereguleerd door tryptofaan. Wat is een operon? 18b. Wat is het eindproduct van transcriptie en translatie van het tryptofaan-operon? 18c. Beschrijf en teken de regulatie door tryptofaan van het trp-operon. Tentamen toets 2 Mol Biologie Januari

13 19. Waarom zijn niet alle genen in een eukaryotische cel cel aktief? Licht je antwoord kort toe. 20. Waarom word je ziek van een virus? Geef zoveel mogelijk redenen en licht ze heel kort toe. 21. Bacteriën kennen geen meiose, en toch kan hun DNA veranderen. Geef zoveel mogelijk manieren hoe het bacteriële DNA kan veranderen. Je hoeft ze niet toe te lichten. Mutatie is één manier en hoef je niet meer te noemen! Tentamen toets 2 Mol Biologie Januari

14 22. Wat voor nucleotiden worden gebruikt bij DNA sequentiebepaling volgens de Sanger methode? Leg de werking van die nucleotiden uit. (Je hoeft dus niet de hele DNA sequentie bepaling te beschrijven!) 23. BONUSVRAAG. Waarom bestaat DNA uit nucleotiden, terwijl eiwitten uit een andere monomeer bestaan, namelijk aminozuren? Het was toch economischer geweest als ook eiwitten uit nucleotiden hadden bestaan? (Het antwoord staat niet in Campbell!) Tentamen toets 2 Mol Biologie Januari

Tentamen Genetica 22-10-2004 Studentnr:

Tentamen Genetica 22-10-2004 Studentnr: CONTROLEER OF DIT TENTAMEN 11 PAGINA S BEVAT. Veel succes! Je mag de achterkant van het papier ook zo nodig gebruiken, maar beantwoord vragen 1-6 niet op blaadjes van vraag 7 en de daarop volgende. 1.

Nadere informatie

ANTWOORDEN HOOFDSTUK 6 VAN GEN TOT EIWIT

ANTWOORDEN HOOFDSTUK 6 VAN GEN TOT EIWIT ANTWOORDEN HOOFDSTUK 6 VAN GEN TOT EIWIT ANTWOORDEN 6.5 /TM 6.8 Codering 1.een juiste aanvulling van het schema : nucleotiden in mrna juist nucleotiden in DNA juist 3 kant en 5 kant bij mrna en DNA juist

Nadere informatie

28 Testkruising testkruising = een kruising om te achterhalen of een organisme homozygoot of heterozygoot is. Voorbeeld van een testkruising om te bepalen of een organisme homozygoot of heterozygoot is

Nadere informatie

DNA & eiwitsynthese Oefen- en zelftoetsmodule behorende bij hoofdstuk 16 en 17 van Campbell, 7 e druk December 2008

DNA & eiwitsynthese Oefen- en zelftoetsmodule behorende bij hoofdstuk 16 en 17 van Campbell, 7 e druk December 2008 DNA & eiwitsynthese Oefen- en zelftoetsmodule behorende bij hoofdstuk 16 en 17 van Campbell, 7 e druk December 2008 DNA 1. Hieronder zie je de schematische weergave van een dubbelstrengs DNA-keten. Een

Nadere informatie

Hetzelfde DNA in elke cel

Hetzelfde DNA in elke cel EIWITSYNTHESE (H18) Hetzelfde DNA in elke cel 2 Structuur en functie van DNA (1) Genen bestaan uit DNA Genen worden gedragen door chromosomen Chromosomen bestaan uit DNAmoleculen samengepakt met eiwitten

Nadere informatie

BIOLOGIE MOLECULAIRE GENETICA EIWITSYNTHESE VWO KLASSE 6

BIOLOGIE MOLECULAIRE GENETICA EIWITSYNTHESE VWO KLASSE 6 BIOLOGIE MOLECULAIRE GENETICA EIWITSYNTHESE VWO KLASSE 6 Henry N. Hassankhan Scholengemeenschap Lelydorp [HHS-SGL] ARTHUR A. HOOGENDOORN ATHENEUM - VRIJE ATHENEUM - AAHA Docent: A. Sewsahai DOELSTELLINGEN:

Nadere informatie

Genetica & Evolutie Deeltentamen 1

Genetica & Evolutie Deeltentamen 1 Vraag 1. Iemands genotype is AaBb voor twee genen die gekoppeld op een chromosoom liggen. Als de beide dominante allelen op één chromosoom liggen, en de beide recessieve allelen op het andere homologe

Nadere informatie

Genetica & Evolutie Deeltentamen 1 Versie 1 2007

Genetica & Evolutie Deeltentamen 1 Versie 1 2007 Vraag 1. Het kleur patroon van de vacht van een hertensoort wordt bepaald door één gen met drie allelen. De allelen D en F erven co- dominant over; allel f erft recessies over t.o.v. zowel D als F. Hoeveel

Nadere informatie

Level 1. Vul het juiste woord in

Level 1. Vul het juiste woord in Level 1 Vul het juiste woord in Keuze uit: Gen, Allel, Locus, Dominant, Recessief, Co-dominantie, Monohybride kruising, Dihybride kruising, Autosoom, Autosomale overerving, X-chromosomale overerving, Intermediair

Nadere informatie

Welke combinatie van twee celorganellen en hun respectievelijke functies is correct?

Welke combinatie van twee celorganellen en hun respectievelijke functies is correct? Biologie Vraag 1 Welke combinatie van twee celorganellen en hun respectievelijke functies is correct? ribosoom en synthese van eiwitten kern en fotosynthese mitochondrion en fotosynthese ribosoom

Nadere informatie

4 VWO thema 4 Genetica EXAMENTRAINER OEFENVRAGEN

4 VWO thema 4 Genetica EXAMENTRAINER OEFENVRAGEN Examentrainer Vragen Erfelijke kaalheid De aanwezigheid of het geheel of gedeeltelijk ontbreken van hoofdhaar (kaalheid) berust op de allelen H n k (niet kaal) en H (kaal). In aanwezigheid van hoge concentraties

Nadere informatie

Tentamen Van Mens tot Cel

Tentamen Van Mens tot Cel Tentamen Van Mens tot Cel 1. Hans en Tineke willen graag een kindje. Zowel de ouders van Hans als de ouders van Tineke zijn beide drager van een autosomaal recessieve ziekte. Wat is de kans dat Hans en

Nadere informatie

Level 1. Vul het juiste woord in

Level 1. Vul het juiste woord in Level 1 Vul het juiste woord in Keuze uit: Gen, Allel, Locus, Dominant, Recessief, Co-dominantie, Monohybride kruising, Dihybride kruising, Autosoom, Autosomale overerving, X-chromosomale overerving, Intermediair

Nadere informatie

Van mens tot Cel oefenvragen 1. De celdeling bestaat uit verschillende fasen. Hoe heten de G1, S en de G2 fase samen?

Van mens tot Cel oefenvragen 1. De celdeling bestaat uit verschillende fasen. Hoe heten de G1, S en de G2 fase samen? Van mens tot Cel oefenvragen 1. De celdeling bestaat uit verschillende fasen. Hoe heten de G1, S en de G2 fase samen? A: interfase B: profase C: anafase D: cytokinese 2. Een SNP (single nucleotide polymorphism)

Nadere informatie

STEMPEL DE WEG VAN GEN NAAR EIWIT

STEMPEL DE WEG VAN GEN NAAR EIWIT A LIFE TYPEFACE STEMPEL DE WEG VAN GEN NAAR EIWIT De eiwitsynthese is één van de belangrijkste processen die zich in de cel afspelen. Eiwitten staan aan de basis van het functioneren van de cel. Wat een

Nadere informatie

Genetica & Evoltie Deeltentamen 1 2008. a. X- chromosoom gebonden recessief. b. Autosomaal recessief. c. X- chromosoom gebonden dominant.

Genetica & Evoltie Deeltentamen 1 2008. a. X- chromosoom gebonden recessief. b. Autosomaal recessief. c. X- chromosoom gebonden dominant. Vraag 1. Een fruitvliegje met het genotype AABBCC wordt gekruist met een aabbcc vlieg. De drie kenmerken erven onafhankelijk van elkaar over en A, B en C zijn volledig dominant over respectievelijk a,

Nadere informatie

Voorbereiding toelatingsexamen arts/tandarts. Biologie: Erfelijke informatie in de cel 6/29/2013. dr. Brenda Casteleyn

Voorbereiding toelatingsexamen arts/tandarts. Biologie: Erfelijke informatie in de cel 6/29/2013. dr. Brenda Casteleyn Voorbereiding toelatingsexamen arts/tandarts Biologie: Erfelijke informatie in de cel 6/29/2013 dr. Brenda Casteleyn Met dank aan: Leen Goyens (http://users.telenet.be/toelating) en studenten van forum

Nadere informatie

Examen Voorbereiding DNA. Teylingen College Leeuwenhorst 2015/2016. 2016 JasperOut.nl. Thema 2 DNA

Examen Voorbereiding DNA. Teylingen College Leeuwenhorst 2015/2016. 2016 JasperOut.nl. Thema 2 DNA Examen Voorbereiding DNA Teylingen College Leeuwenhorst 2015/2016 Thema 2 DNA Begrippenlijst: Begrip mtdna kerndna Plasmiden Genoom DNA-replicatie DNA-polymerase Eiwitsynthese RNA-molecuul Codon Genregulatie

Nadere informatie

Proteomics. Waarom DNA alleen niet genoeg is

Proteomics. Waarom DNA alleen niet genoeg is Proteomics Waarom DNA alleen niet genoeg is Reinout Raijmakers Netherlands Proteomics Centre Universiteit Utrecht, Biomolecular Mass Spectrometry and Proteomics Group Van DNA naar organisme Eiwitten zijn

Nadere informatie

1 (~20 minuten; 20 punten)

1 (~20 minuten; 20 punten) TENTAMEN Moleculaire Cel Biologie (8A840) Prof. Dr. Ir. L. Brunsveld & Dr. M. Merkx 27-01-2012 14:00 17:00 (totaal 100 punten) 6 opgaven in totaal + 1 bonusvraag! (aangegeven tijd is indicatie) Gebruik

Nadere informatie

3. Eén gen kan vele allelen hebben. Hoeveel allelen van één gen heeft ieder individu?

3. Eén gen kan vele allelen hebben. Hoeveel allelen van één gen heeft ieder individu? Genetica Vragen bij hoofdstuk 13, 14 en 15 van 'Biology', Campbell, 7e druk Versie 2006 2007 Theorie 1. Hoe noemt men een plant die raszuiver is voor een bepaalde eigenschap? 2. Hoe noemt men planten met

Nadere informatie

DNA & eiwitsynthese (Junior College Utrecht) Vragen bij COO-programma

DNA & eiwitsynthese (Junior College Utrecht) Vragen bij COO-programma DNA & eiwitsynthese (Junior College Utrecht) Vragen bij COO-programma De vragen die voorkomen in het COO-programma DNA & eiwitsynthese zijn op dit formulier weergegeven. Het is de bedoeling dat je, als

Nadere informatie

HAVO 5 Begrippenlijst Erfelijkheid allel Allelen zijn verschillende vormen van een gen. Zij liggen in homologe chromosomen op precies dezelfde

HAVO 5 Begrippenlijst Erfelijkheid allel Allelen zijn verschillende vormen van een gen. Zij liggen in homologe chromosomen op precies dezelfde HAVO 5 Begrippenlijst Erfelijkheid allel Allelen zijn verschillende vormen van een gen. Zij liggen in homologe chromosomen op precies dezelfde plaats. Allelen coderen voor dezelfde eigenschap bijvoorbeeld

Nadere informatie

Computer Ondersteund Onderwijs (COO).

Computer Ondersteund Onderwijs (COO). Computer Ondersteund Onderwijs (COO). Over DNA en eiwit is er een computer praktikum. Bij dit COO leer je via een interactieve manier omgaan met de stof. Opstarten COO. Ga naar de site van het departement

Nadere informatie

Biologie Vraag 1 Vraag 1. Dit zijn een aantal gegevens over een nucleïnezuur.

Biologie Vraag 1 <A> <B> <C> <D> Vraag 1. Dit zijn een aantal gegevens over een nucleïnezuur. Biologie Vraag 1 Dit zijn een aantal gegevens over een nucleïnezuur. 1. Het is een enkelvoudige keten. 2. Het bevat als basen: G A C T. 3. Het varieert naargelang de soort cel binnen één organisme. 4.

Nadere informatie

Examen Voorbereiding Erfelijkheid

Examen Voorbereiding Erfelijkheid Examen Voorbereiding Erfelijkheid Teylingen College Leeuwenhorst 2015/2016 Thema 4 Erfelijkheid Begrippenlijst: Begrip DNA-sequentie Genexpressie Epigenetica Homozygoot Heterozygoot Intermediair Monohybride

Nadere informatie

1. Mendeliaanse overerving - koppelingsanalyse

1. Mendeliaanse overerving - koppelingsanalyse 1. Mendeliaanse overerving - koppelingsanalyse 1.1 Inleiding Genetische kenmerken die afhangen van één enkel gen (meer precies : locus) noemen wij mendeliaans. Mendeliaanse kenmerken segregeren in families

Nadere informatie

Vragenlijst Module cellen

Vragenlijst Module cellen De uitwerking van de vragen zet je in de verslagen van je practica! (LEES LAATSTE BLADZIJDE!) Cursief gedrukte blauwe vragen alleen voor bio-mensen!! Vragenlijst Module cellen 1. Noem drie verschillen

Nadere informatie

Welke van de bovenstaande celorganellen of levensprocessen kunnen zowel in prokaryote, als in eukaryote cellen voorkomen?

Welke van de bovenstaande celorganellen of levensprocessen kunnen zowel in prokaryote, als in eukaryote cellen voorkomen? Biologie Vraag 1 Celorganellen en levensprocessen bij levende cellen zijn: 1. Ribosomen 2. ATP synthese 5. DNA polymerase 3. Celmembranen 6. Fotosynthese 4. Kernmembraan 7. Mitochondria Welke van de bovenstaande

Nadere informatie

Oefenvragen Mens tot Cel

Oefenvragen Mens tot Cel Oefenvragen Mens tot Cel 1. In de familie van Tineke komt sma type 1 voor. Sma type 1 staat voor spinale spier atrofie type 1. De oom van Tineke heeft sma type 1 (zie de stamboom hieronder). Hoe groot

Nadere informatie

Docentenhandleiding. Afsluitende module. Op zoek naar een gen in een databank

Docentenhandleiding. Afsluitende module. Op zoek naar een gen in een databank Docentenhandleiding Afsluitende module Op zoek naar een gen in een databank Ontwikkeld door het Cancer Genomics Centre in samenwerking met het Freudenthal Instituut voor Didactiek van Wiskunde en Natuurwetenschappen

Nadere informatie

Begrippenlijst DNA adenine Eén van de nucelotidebasen die in DNA en RNA voorkomen. Adenine (A) vormt een basenpaar met thymine (T) in het DNA en met

Begrippenlijst DNA adenine Eén van de nucelotidebasen die in DNA en RNA voorkomen. Adenine (A) vormt een basenpaar met thymine (T) in het DNA en met Begrippenlijst DNA adenine Eén van de nucelotidebasen die in DNA en RNA voorkomen. Adenine (A) vormt een basenpaar met thymine (T) in het DNA en met uracil (U) in RNA. Adenine komt ook voor in AMP, ADP,

Nadere informatie

Leerlingenhandleiding

Leerlingenhandleiding Leerlingenhandleiding Niveau: basis Bioinformatica: leven in de computer Ontwikkeld door het Netherlands Bioinformatics Centre in samenwerking met het Centre for Molecular and Biomolecular Informatics

Nadere informatie

Let er op dat je voor iedere vraag een uitwerking maakt met kruisingsschema en/of berekening.

Let er op dat je voor iedere vraag een uitwerking maakt met kruisingsschema en/of berekening. Week Thema Onderwerp Datum 43 3 Basisstof 1 t/m 4 23/10 28/10 44 3 Basisstof 1 t/m 4 31/10 4/11 45 7/11 11/11 Basisstof 5 t/m 7 bespreken 3 Basisstof 5 t/m 7 bespreken Verrijkingsstof 1 Herhalen en bespreken

Nadere informatie

V6 Oefenopgaven oktober 2009

V6 Oefenopgaven oktober 2009 V6 Oefenopgaven oktober 2009 Fitness Met fitness wordt in de biologie bedoeld het vermogen van genotypen om hun allelen naar de volgende generatie over te dragen. De fitness wordt uitgedrukt in een getal

Nadere informatie

1 (~20 minuten; 15 punten)

1 (~20 minuten; 15 punten) HERTENTAMEN Moleculaire Cel Biologie (8A840) Prof. Dr. Ir. L. Brunsveld & Dr. M. Merkx 20-04-2012 14:00 17:00 (totaal 100 punten) 6 opgaven in totaal + 1 bonusvraag! (aangegeven tijd is indicatie) Gebruik

Nadere informatie

a. Geef de 1-lettercode van de aminozuren in het peptide in de corresponderende volgorde. (4P)

a. Geef de 1-lettercode van de aminozuren in het peptide in de corresponderende volgorde. (4P) HERTENTAMEN Eindtoets BIOCHEMIE (8RA00) Prof. Dr. Ir. L. Brunsveld 16-08-2013 09:00 12:00 (totaal 100 punten) 6 opgaven in totaal! (aangegeven tijd is indicatie) Gebruik geen rode pen! 1 Peptiden en eiwitten

Nadere informatie

AAbb of Aabb = normaal zicht aabb of aabb = retinitis pigmentosa AABB of AABb = retinitis pigmentosa

AAbb of Aabb = normaal zicht aabb of aabb = retinitis pigmentosa AABB of AABb = retinitis pigmentosa 13. (MC) Retinitis pigmentosa is een erfelijke vorm van blindheid, die kan veroorzaakt worden door een recessief allel (a) op een locus alfa, of door een dominant allel (B) op een andere locus, bèta. Onderstaande

Nadere informatie

3 Rundveefokkerij Melkproductiecontrole Selectie Fokwaardeschatting Inseminatieplannnen 69 3.

3 Rundveefokkerij Melkproductiecontrole Selectie Fokwaardeschatting Inseminatieplannnen 69 3. Inhoud Voorwoord 5 Inleiding 6 1 Veiligheidsvoorschriften 9 1.1 Genen en hun vererving 9 1.2 Genotype en fenotype 14 1.3 Erfelijke gebreken 18 1.4 Genfrequenties 25 1.5 Afsluiting 27 2 Fokmethoden 28 2.1

Nadere informatie

Samenvattingen. Samenvatting Thema 4: Erfelijkheid. Basisstof 1. Basisstof 2. Erfelijke eigenschappen:

Samenvattingen. Samenvatting Thema 4: Erfelijkheid. Basisstof 1. Basisstof 2. Erfelijke eigenschappen: Samenvatting Thema 4: Erfelijkheid Basisstof 1 Erfelijke eigenschappen: - Genotype: o genen liggen op de chromosomen in kernen van alle cellen o wordt bepaald op moment van de bevruchting - Fenotype: o

Nadere informatie

Transcriptie en de Genetische code

Transcriptie en de Genetische code Transcriptie en de Genetische code DNA getranscripteerd tot RNA, 3 grote groepen mrna: codeert voor proteïnen rrna: onderdeel van de Ribosomen trna: koppeling tussen AZ en het mrna De informatieflow gaat

Nadere informatie

Vragen bij paragraaf 5.1 en 5.2

Vragen bij paragraaf 5.1 en 5.2 Vragen bij paragraaf 5.1 en 5.2 1. Geef van onderstaande begrippen een omschrijving. celdifferentiatie overgang van stamcellen in specifieke cellen (specialisatie) katalysator een stof die een bepaalde

Nadere informatie

Examentraining onderwerp: diagrammen Lees eerst de vraag. ga dan naar de tekst! onderwerp: Bloedsomloop Lees eerst de vraag. ga dan naar de tekst!

Examentraining onderwerp: diagrammen Lees eerst de vraag. ga dan naar de tekst! onderwerp: Bloedsomloop Lees eerst de vraag. ga dan naar de tekst! Examentraining onderwerp: diagrammen Moet er een diagram getekend worden? Bedenk: Welk type grafiek is er nodig. Is het een Lijndiagram? bedenk dan: wat komt er op de X-as? (de onafhankelijke variabele,

Nadere informatie

Paragraaf Homologe chromosomen

Paragraaf Homologe chromosomen Paragraaf Homologe chromosomen Opbouw: Lees de les op biologielessn.nl over homologe chromosomen goed door. Maak de onderstaande vragen van deze bladzijde. Reproductie vragen: 1. Wat zijn homologe chromosomen?

Nadere informatie

2. Erfelijkheid en de ziekte van Huntington

2. Erfelijkheid en de ziekte van Huntington 2. Erfelijkheid en de ziekte van Huntington Erfelijkheid Erfelijk materiaal in de 46 chromosomen De mens heeft in de kern van elke lichaamscel 46 chromosomen: het gaat om 22 paar lichaamsbepalende chromosomen

Nadere informatie

STEMPEL DE WEG VAN GEN NAAR EIWIT

STEMPEL DE WEG VAN GEN NAAR EIWIT A LIFE TYPEFACE STEMPEL DE WEG VAN GEN NAAR EIWIT De eiwitsynthese is één van de belangrijkste processen die zich in de cel afspelen. Eiwitten staan aan de basis van het functioneren van de cel. Wat een

Nadere informatie

Mogelijke combinaties van genotypen. Mogelijke combinaties van fenotypen. Deze kruising levert 2 X 2 = 4 fenotypen.

Mogelijke combinaties van genotypen. Mogelijke combinaties van fenotypen. Deze kruising levert 2 X 2 = 4 fenotypen. Leertaak 8A 1. Bij de mens berust een bruine oogkleur op het dominante allel B. Een blauwe oogkleur berust op het recessieve alle b. Rechtshandigheid berust op het dominante allel H en linkshandigheid

Nadere informatie

1. Welk van de onderstaande DNA sequenties zijn mogelijke herkenning-sites voor restrictie-enzymen? c 5' GAATTC 3' c 5' GGGGCCCC 3' c 5' CTGCAG 3' 5'

1. Welk van de onderstaande DNA sequenties zijn mogelijke herkenning-sites voor restrictie-enzymen? c 5' GAATTC 3' c 5' GGGGCCCC 3' c 5' CTGCAG 3' 5' proefexamen 1. Welk van de onderstaande DNA sequenties zijn mogelijke herkenning-sites voor restrictie-enzymen? c 5' GAATTC 3' c 5' GGGGCCCC 3' c 5' CTGCAG 3' 5' CTAAATC 3' 5' GGAACC 3' Restriction Endonucleases

Nadere informatie

Grootste examentrainer en huiswerkbegeleider van Nederland. Biologie. Trainingsmateriaal. De slimste bijbaan van Nederland! lyceo.

Grootste examentrainer en huiswerkbegeleider van Nederland. Biologie. Trainingsmateriaal. De slimste bijbaan van Nederland! lyceo. Grootste examentrainer en huiswerkbegeleider van Nederland Biologie Trainingsmateriaal De slimste bijbaan van Nederland! lyceo.nl Traininingsmateriaal Biologie Lyceo-trainingsdag 2015 Jij staat op het

Nadere informatie

1 Antwoorden Monohybride Kruisingen

1 Antwoorden Monohybride Kruisingen 1 Antwoorden Monohybride Kruisingen 1) A = zwart haar, a = wit haar P: Aa x Aa F1: A a A AA Aa Alleen genotype aa geeft wit haar, dus 25 % 2) a) Eigenschap C (= A) b) Aa c) Aa d) AA of Aa 3) zwart : wit

Nadere informatie

2 Leg uit hoe de verschillende subtypes van Chlamydia trachomatis zijn ontstaan. Beschrijf de rol van antibioticagebruik hierin.

2 Leg uit hoe de verschillende subtypes van Chlamydia trachomatis zijn ontstaan. Beschrijf de rol van antibioticagebruik hierin. Examentrainer Vragen Nieuwe DNA-test voor chlamydia Chlamydia is de meest voorkomende seksueel overdraagbare aandoening (soa) en kan onder meer leiden tot onvruchtbaarheid. In Nederland worden jaarlijks

Nadere informatie

Fenotype nakomelingen. donker kort 29 donker lang 9 wit kort 31 wit- lang 11

Fenotype nakomelingen. donker kort 29 donker lang 9 wit kort 31 wit- lang 11 1. Bij honden is het allel voor donkerbruine haarkleur (E) dominant over het allel voor witte haarkleur (e). Het allel voor kort haar (F) is dominant over het allel voor lang haar (f). Een aantal malen

Nadere informatie

Erfelijkheidsschema's deel 1.

Erfelijkheidsschema's deel 1. Erfelijkheidsschema's deel 1. Theorie: o Elke cel bevat 2n chromosomen. n = aantal verschillende chromosomen. Bij mensen is n=23 en dus zitten in elke lichaamscel 23 paar (46) chromosomen. Eén deel kreeg

Nadere informatie

Dialogen voor conceptcartoons. Verband genotype/fenotype, dominant/recessief

Dialogen voor conceptcartoons. Verband genotype/fenotype, dominant/recessief Dialogen voor conceptcartoons Verband genotype/fenotype, dominant/recessief 1 Is dit ons kind? (Zie conceptcartoon Horst Wolter op deze site.) Leermoeilijkheid (misconcept): Uiterlijke eigenschappen weerspiegelen

Nadere informatie

Gentechnologie & moleculaire analysetechnieken Godelieve Gheysen 1999-2000 eerste zit

Gentechnologie & moleculaire analysetechnieken Godelieve Gheysen 1999-2000 eerste zit Gentechnologie en moleculaire analysetechnieken Godelieve Gheysen 1 Gentechnologie & moleculaire analysetechnieken Godelieve Gheysen 1999-2000 eerste zit Gentechnologie en moleculaire analysetechnieken

Nadere informatie

Vraag /144. Vraag 14

Vraag /144. Vraag 14 Vraag 13 107/144 De kinderen van Romeo en Julia kunnen de ziekte enkel hebben indien hun beide ouders heterozygoot zijn. Hoe groot is die kans? Julia's broer Augusto heeft de ziekte, dus moeten zowel Laura

Nadere informatie

a. Geef de 1-lettercode van de aminozuren in het peptide in de corresponderende volgorde. (4P) LLORETDEMAR (iedere fout -1P)

a. Geef de 1-lettercode van de aminozuren in het peptide in de corresponderende volgorde. (4P) LLORETDEMAR (iedere fout -1P) TENTAMEN BIOCHEMIE (8RA00) Prof. Dr. Ir. L. Brunsveld 28-06-2013 09:00 12:00 (totaal 100 punten) 6 opgaven in totaal! (aangegeven tijd is indicatie) Gebruik geen rode pen! 1 Peptiden en eiwitten (~15 minuten;

Nadere informatie

ERFELIJKHEID. 1 N i e t a l l e m a a l h e t z e l f d e Afbeelding 17-2

ERFELIJKHEID. 1 N i e t a l l e m a a l h e t z e l f d e Afbeelding 17-2 ERFELIJKHEID 1 N i e t a l l e m a a l h e t z e l f d e Afbeelding 17-2 Afbeelding 17-1 Mensen uit elkaar houden vind je vast makkelijker. Toch hebben ook mensen veel meer overeenkomsten dan verschillen.

Nadere informatie

Nederlandse samenvatting

Nederlandse samenvatting Nederlandse samenvatting 111 Dit proefschrift behandelt de diagnose van epidermolysis bullosa simplex (EBS) op DNA niveau en een eerste aanzet tot het ontwikkelen van gentherapie voor deze ziekte. Een

Nadere informatie

Examen VWO. Biologie. Voorbereidend Wetenschappelijk Onderwijs Tijdvak 1 Woensdag 19 mei 13.30 16.30 uur. Boekje met informatie.

Examen VWO. Biologie. Voorbereidend Wetenschappelijk Onderwijs Tijdvak 1 Woensdag 19 mei 13.30 16.30 uur. Boekje met informatie. Biologie Examen VWO Voorbereidend Wetenschappelijk Onderwijs Tijdvak 1 Woensdag 19 mei 13.30 16.30 uur 19 99 Boekje met informatie 900006 18B Begin informatie 1 Indicatorsoorten van de macrofauna voor

Nadere informatie

Diagnostische toets Van HIV tot AIDS?

Diagnostische toets Van HIV tot AIDS? Diagnostische toets Van HIV tot AIDS? Moleculen 1. Basenparing In het DNA vindt basenparing plaats. Welke verbinding brengt een basenpaar tot stand? A. Peptidebinding B. Covalente binding C. Zwavelbrug

Nadere informatie

Het enzym dat verantwoordelijk is voor het vastleggen van de imprint na de DNA-replicatie is een DNA-methyltransferase.

Het enzym dat verantwoordelijk is voor het vastleggen van de imprint na de DNA-replicatie is een DNA-methyltransferase. Examentrainer Vragen Hongerwinterkinderen Gedurende de laatste winter van de Tweede Wereldoorlog stierven veel Nederlanders door barre omstandigheden: koude en voedselgebrek. Tijdens deze hongerwinter

Nadere informatie

Basisstof 7 Genetische variatie

Basisstof 7 Genetische variatie Afbeelding 33. RNA-interferentie.1 RNA bevat 2 complementaire sequenties die aan elkaar plakken, zodat er een haarspeld structuur ontstaat (1 van afbeelding 33). Het enzym Dicer knipt het dubbele RNA in

Nadere informatie

Genetica. Marvin Tersluijsen. CC Naamsvermelding-GelijkDelen 3.0 Nederland licentie.

Genetica. Marvin Tersluijsen. CC Naamsvermelding-GelijkDelen 3.0 Nederland licentie. Auteur Laatst gewijzigd Licentie Webadres Marvin Tersluijsen 08 April 2016 CC Naamsvermelding-GelijkDelen 3.0 Nederland licentie http://maken.wikiwijs.nl/74428 Dit lesmateriaal is gemaakt met Wikiwijsleermiddelenplein.

Nadere informatie

Genetische Selectie. Eindwerk: hondenfokker 2 de jaar. Sabine Spiltijns

Genetische Selectie. Eindwerk: hondenfokker 2 de jaar. Sabine Spiltijns Genetische Selectie Eindwerk: hondenfokker 2 de jaar Sabine Spiltijns 2010-2011 0 We kunnen aan de hand van een genetische selectie ongeveer voorspellen hoe de puppy s van onze hondjes er gaan uitzien.

Nadere informatie

4 HAVO thema 4 Erfelijkheid EXAMENTRAINER OEFENVRAGEN

4 HAVO thema 4 Erfelijkheid EXAMENTRAINER OEFENVRAGEN Examentrainer Vragen Karyogrammen In afbeelding 1 zijn twee karyogrammen weergegeven. Deze karyogrammen zijn afkomstig van een eeneiige tweeling. Het ene kind is van het mannelijk geslacht zonder duidelijke

Nadere informatie

van de cel Bioinformatica het probleem Inleiding Medisch Technische Wetenschappen Bioinformatica Deel 1 Celbiologie Elementaire celbiologie

van de cel Bioinformatica het probleem Inleiding Medisch Technische Wetenschappen Bioinformatica Deel 1 Celbiologie Elementaire celbiologie Bioinformatica het probleem Inleiding Medisch Technische Wetenschappen Bioinformatica Deel 1 Michael Egmont-Petersen Watisdebetekenis [in brede zin] van het menselijk genome? Welke structuur hebben de

Nadere informatie

Dit is het overzicht van de studiestof voor De ontwikkeling van blok 1.1.1. Het betreft hier een overzicht van de verplichte literatuur.

Dit is het overzicht van de studiestof voor De ontwikkeling van blok 1.1.1. Het betreft hier een overzicht van de verplichte literatuur. Voorwoord Dit is het overzicht van de studiestof voor De ontwikkeling van blok 1.1.1. Het betreft hier een overzicht van de verplichte literatuur. Dit overzicht is geschreven naar eigen inzicht van de

Nadere informatie

Samenvatting Erfelijkheid Vmbo 3a Biologie voor Jou. Erfelijke informatie ligt in de celkern in de chromosomen. Chromosomen bestaan weer uit DNA.

Samenvatting Erfelijkheid Vmbo 3a Biologie voor Jou. Erfelijke informatie ligt in de celkern in de chromosomen. Chromosomen bestaan weer uit DNA. Samenvatting Erfelijkheid Vmbo 3a Biologie voor Jou 4.1 Fenotype Genotype = waarneembare eigenschappen van een individu = de erfelijke informatie in het DNA Genotype + milieufactoren = fenotype Erfelijke

Nadere informatie

Een rondleiding door de cel (COO 2)

Een rondleiding door de cel (COO 2) Een rondleiding door de cel (COO 2) Vragen bij de oefen- en zelftoets-module behorende bij hoofdstuk 6 en 7 van Biology, Campbell, 10 e druk Versie 2014-2015 De vragen die voorkomen in het COO-programma

Nadere informatie

Eindexamen biologie 1-2 vwo 2005-II

Eindexamen biologie 1-2 vwo 2005-II 4 Beoordelingsmodel Aan het juiste antwoord op een meerkeuzevraag worden twee punten toegekend. Bouw en werking nieren 1 terugresorptie: pijl nummer 2 1 ultrafiltratie: pijl nummer 1 1 2 kenmerken zijn:

Nadere informatie

Erfelijkheid. Examen VMBO-GL en TL. biologie CSE GL en TL. Bij dit examen hoort een bijlage.

Erfelijkheid. Examen VMBO-GL en TL. biologie CSE GL en TL. Bij dit examen hoort een bijlage. Examen VMBO-GL en TL Erfelijkheid biologie CSE GL en TL Bij dit examen hoort een bijlage. Dit examen bestaat uit 26 vragen. Voor dit examen zijn maximaal 30 punten te behalen. Voor elk vraagnummer staat

Nadere informatie

Onderstaand is een stukje peptide getoond dat deel uit maakt van een groter eiwit en de naam draagt van een lokaal beroemde biochemicus:

Onderstaand is een stukje peptide getoond dat deel uit maakt van een groter eiwit en de naam draagt van een lokaal beroemde biochemicus: 1 Onderstaand is een stukje peptide getoond dat deel uit maakt van een groter eiwit en de naam draagt van een lokaal beroemde biochemicus: a. Geef de 1-lettercode van de 6 uitgeschreven aminozuren in de

Nadere informatie

De antwoorden op vragen 1 en 2, 3 en 4, en 5 t/m 8 graag op verschillende vellen schrijven. Vergeet ook niet op de 3 vellen je naam en studentnr.

De antwoorden op vragen 1 en 2, 3 en 4, en 5 t/m 8 graag op verschillende vellen schrijven. Vergeet ook niet op de 3 vellen je naam en studentnr. Tentamen Genoombiologie, 28 Oktober 2009, 9.00-11.45 h De antwoorden op vragen 1 en 2, 3 en 4, en 5 t/m 8 graag op verschillende vellen schrijven. Vergeet ook niet op de 3 vellen je naam en studentnr.

Nadere informatie

Biologie (jaartal onbekend)

Biologie (jaartal onbekend) Biologie (jaartal onbekend) 1) Bijgevoegde fotografische afbeelding geeft de elektronenmicroscopische opname van een organel (P) van een cel. Wat is de belangrijkste functie van dit organel? A. Het transporteren

Nadere informatie

Naam: Studentnummer: Opleiding:..

Naam: Studentnummer: Opleiding:.. EINDTETS Biochemie (8RA00) en TENTAMEN Biochemie (8S135) Prof. Dr. Ir. L. Brunsveld 25-06-2014 09:00 12:00 (totaal 100 punten, plus max. 5 extra voor bonus) 6 opgaven in totaal + 1 bonusvraag! (aangegeven

Nadere informatie

vwo erfelijkheid 2010

vwo erfelijkheid 2010 vwo erfelijkheid 2010 Bijengenetica Een bijenvolk bestaat uit: de koningin (een vruchtbaar vrouwtje), een groot aantal werksters (steriele vrouwtjes) en darren (mannetjes). Alle vrouwtjes zijn diploïd

Nadere informatie

Bioinformatica tentamen D2 voor 2MNW op maandag 30/05/2005 van 13:30-16:30 in Q105

Bioinformatica tentamen D2 voor 2MNW op maandag 30/05/2005 van 13:30-16:30 in Q105 Bioinformatica tentamen D2 voor 2MNW op maandag 30/05/2005 van 13:30-16:30 in Q105 Naam: Studentnummer: NB: er zijn extra vellen achteraan bijgevoegd die je kunt gebruiken om antwoorden verder uit te werken,

Nadere informatie

Naam: Studentnummer: Opleiding:..

Naam: Studentnummer: Opleiding:.. TENTAMEN Moleculaire Cel Biologie (8A840) Prof. Dr. Ir. L. Brunsveld & Dr. M. Merkx 24-01-2014 9:00 12:00 (totaal 100 punten, plus max. 5 extra voor bonus) 6 opgaven in totaal + 1 bonusvraag! (aangegeven

Nadere informatie

Overzicht. Celbiologie. Overzicht. Celbiologie (3) Celbiologie (2)

Overzicht. Celbiologie. Overzicht. Celbiologie (3) Celbiologie (2) Overzicht Celbiologie Eiwitten Metabolisme DNA Biologie voor informatici (in zes eenvoudige lessen) Dick de Ridder Genen Transcriptie Translatie Moleculaire biologie Experimenten Metingen Delft University

Nadere informatie

Knock-Out. De module is ontwikkeld door

Knock-Out. De module is ontwikkeld door 2 De module Knock-Out Muizen gebruiken voor kankeronderzoek is bestemd voor de lessen Natuur, Leven en Technologie (NLT). De module is op 24 april 2012 gecertificeerd door de Stuurgroep NLT voor gebruik

Nadere informatie

DNA practicum De modellenwereld van DNA

DNA practicum De modellenwereld van DNA DNA practicum De modellenwereld van DNA Inleiding Alle eigenschappen van een plant, zoals de grootte, de vorm van het blad, en de enzymen die nodig zijn voor de fotosynthese, liggen opgeslagen in het DNA.

Nadere informatie

Desoxyribose heeft 5 C-atomen. De fosfaatgroep zit aan het 5e C-atoom en de stikstofbase aan het 1e C-atoom.

Desoxyribose heeft 5 C-atomen. De fosfaatgroep zit aan het 5e C-atoom en de stikstofbase aan het 1e C-atoom. Desoxyribose heeft 5 C-atomen. De fosfaatgroep zit aan het 5e C-atoom en de stikstofbase aan het 1e C-atoom. Afbeelding 2. DNA-nucleotide.1 Bij het aan elkaar koppelen van nucleotiden gaat het 3e C-atoom

Nadere informatie

MENDELS TOMATEN PLANTJES

MENDELS TOMATEN PLANTJES MENDELS TOMATEN PLANTJES Als je naar de natuur kijkt, zie je veel variatie. Variatie tussen soorten en variatie binnen soorten. Variatie kan van nature ontstaan, maar verschillen kunnen ook door veredeling

Nadere informatie

Herhalingsoefeningen

Herhalingsoefeningen Herhalingsoefeningen Steven Maenhout 1 stamboomanalyse 1. De stamboom uit figuur 1 geeft de overerving van de witte haarlok eigenschap bij mensen. De aangetaste individuen hebben een lok ongepigmenteerd

Nadere informatie

Intermezzo, De expressie van een eiwit.

Intermezzo, De expressie van een eiwit. Samenvatting Bacteriën leven in een omgeving die voortdurend en snel verandert. Om adequaat te kunnen reageren op deze veranderingen beschikken bacteriën over tal van sensor systemen die de omgeving in

Nadere informatie

Genoom=de complete set aan informatie in het DNA van een organisme Template=de streng waar de nieuwe complementaire streng op wordt gebouwd

Genoom=de complete set aan informatie in het DNA van een organisme Template=de streng waar de nieuwe complementaire streng op wordt gebouwd Hoofdstuk 4 Blz. 197 Waterstofbruggen houden de 2 DNA kettingen aan elkaar, de waterstofbruggen vormen O..H en N..H Nucleotides bestaan uit een 5 C-suiker met 1 of meer fosfaatgroepen en een N-base (A,T,C,G)

Nadere informatie

GENOMISCH KOOKBOEK LEERLINGENHANDLEIDING

GENOMISCH KOOKBOEK LEERLINGENHANDLEIDING GENOMISCH KOOKBOEK LEERLINGENHANDLEIDING LEERLINGENHANDLEIDING GENOMISCH KOOKBOEK 1 HOOFDSTUK 1 DNA EN DE ROL VAN RNA BIJ TRANSCRIPTIE 1.1 Hieronder zie je een vak met daarin de begrippen DNA en RNA. Maak

Nadere informatie

BIOLOGIE VMBO KB VAKINFORMATIE STAATSEXAMEN 2016 V15.10.1

BIOLOGIE VMBO KB VAKINFORMATIE STAATSEXAMEN 2016 V15.10.1 BIOLOGIE VMBO KB VAKINFORMATIE STAATSEAMEN 2016 V15.10.1 De vakinformatie in dit document is vastgesteld door het College voor Toetsen en Examens (CvTE). Het CvTE is verantwoordelijk voor de afname van

Nadere informatie

1 Na + Na + Na + ATP K +

1 Na + Na + Na + ATP K + 2 a + 1 a + a + P a + a + a + ATP Cytoplasma K + 6 K + 5 a + P a + K + P P K + a + 3 K + K + 4 185 BILGIE THERIE 186 1 Inleiding HFDSTUK II Celdeling Celdeling bestaat uit de celdeling of cytokinese zelf

Nadere informatie

Naam: Studentnummer: Opleiding:..

Naam: Studentnummer: Opleiding:.. 1 2 3 4 5 6 B EINDTOETS Biochemie (8RA00) en TENTAMEN Biochemie (8S135) Prof. Dr. Ir. L. Brunsveld 15-08-2014 09:00 12:00 (totaal 100 punten, plus max. 5 extra voor bonus) 6 opgaven in totaal + 1 bonusvraag!

Nadere informatie

Samenvatting, discussie en vooruitzichten

Samenvatting, discussie en vooruitzichten Leuko-encefalopathie met betrokkenheid van de hersenstam en ruggenmerg en lactaatverhoging: moleculaire mechanismen, klinische aspecten en opening voor behandeling Samenvatting, discussie en vooruitzichten

Nadere informatie

Het menselijk genoom. Inleiding Medisch Technische Wetenschappen. Bioinformatica Deel 2. Gevouwen chromosoom. X chromosoom DNA.

Het menselijk genoom. Inleiding Medisch Technische Wetenschappen. Bioinformatica Deel 2. Gevouwen chromosoom. X chromosoom DNA. Het menselijk genoom Het menselijk genoom (DN) bestaat uit: Mega Basenparen (MB),,, C,. Inleiding Medisch echnische Wetenschappen Bioinformatica Deel Michael Egmont-Petersen Het menselijk DN is ingedeeld

Nadere informatie

Monohybride en dihybride kruisingen vmbo-kgt34

Monohybride en dihybride kruisingen vmbo-kgt34 Auteur VO-content Laatst gewijzigd Licentie Webadres 19 July 2016 CC Naamsvermelding-GelijkDelen 3.0 Nederland licentie http://maken.wikiwijs.nl/63372 Dit lesmateriaal is gemaakt met Wikiwijsleermiddelenplein.

Nadere informatie

Moleculaire biologische technieken

Moleculaire biologische technieken Moleculaire biologische technieken Hand-out Juli 2010 In deze hand-out de meeste teksten. Van de (eigen) animaties zijn enkele belangrijke frames weergegeven. Als je de links wilt weten moet je de module

Nadere informatie

Voorbereiding toelatingsexamen arts/tandarts. Biologie: Erfelijkheid 6/29/2013. dr. Brenda Casteleyn

Voorbereiding toelatingsexamen arts/tandarts. Biologie: Erfelijkheid 6/29/2013. dr. Brenda Casteleyn Voorbereiding toelatingsexamen arts/tandarts Biologie: Erfelijkheid 6/29/2013 dr. Brenda Casteleyn Met dank aan: Leen Goyens (http://users.telenet.be/toelating) en studenten van forum http://www.toelatingsexamen-geneeskunde.be

Nadere informatie

1 (~15 minuten; 15 punten)

1 (~15 minuten; 15 punten) TENTAMEN Moleculaire Cel Biologie (8A840) Prof. Dr. Ir. L. Brunsveld & Dr. M. Merkx 25-01-2013 09:00 12:00 (totaal 100 punten) 6 opgaven in totaal + 1 bonusvraag! (aangegeven tijd is indicatie) Gebruik

Nadere informatie

Mendel en Morgan versie 2009-2010

Mendel en Morgan versie 2009-2010 Mendel en Morgan versie 2009-2010 Vragen bij COO over hoofdstuk 14 en 15 van Campbells Biology, 8e druk De vragen in dit COO-programma zijn vaak gebaseerd op random gegenereerde gegevens. Behalve de antwoorden

Nadere informatie

Afsluitende les. Leerlingenhandleiding. DNA-onderzoek en gentherapie

Afsluitende les. Leerlingenhandleiding. DNA-onderzoek en gentherapie Afsluitende les Leerlingenhandleiding DNA-onderzoek en gentherapie Inleiding In de afsluitende les DNA-onderzoek en gentherapie zul je aan de hand van een aantal vragen een persoonlijke en kritische blik

Nadere informatie

Dit proefschrift beschrijft de rol van genetische factoren in het ontstaan van de ziekte van

Dit proefschrift beschrijft de rol van genetische factoren in het ontstaan van de ziekte van Samenvatting Dit proefschrift beschrijft de rol van genetische factoren in het ontstaan van de ziekte van Hirschsprung (ook wel afgekort als HSCR). HSCR is een aangeboren afwijking gekenmerkt door de afwezigheid

Nadere informatie