Tentamen Genetica Studentnr:

Save this PDF as:
 WORD  PNG  TXT  JPG

Maat: px
Weergave met pagina beginnen:

Download "Tentamen Genetica 22-10-2004 Studentnr:"

Transcriptie

1 CONTROLEER OF DIT TENTAMEN 11 PAGINA S BEVAT. Veel succes! Je mag de achterkant van het papier ook zo nodig gebruiken, maar beantwoord vragen 1-6 niet op blaadjes van vraag 7 en de daarop volgende. 1. Vijf stabiele klonen van semi-hybride muis/mens cellen worden onderzocht op de aanwezigheid van het menselijk enzym E, terwijl ook wordt nagegaan welke menselijke chromosomen in de klonen zijn overgebleven. De volgende resultaten werden gevonden: Kloon overgebleven menselijke chromosomen enzym E activiteit 1 1,2,10,16,19,21,22,23-2 5,10,11,12,14, ,8,13,18,23-4 4,9,10,11,17, ,7,15,16,20,21 - Op welk van de chromosomen 1 t/m 23 ligt vermoedelijk het gen dat verantwoordelijk is voor de vorming van enzym E? Licht je antwoord toe. 2. In Drosophila zorgen de recessieve allelen van het w gen voor witte ogen en recessieve allelen van het eb gen voor een ebony-kleurig lijf. Vrouwtjes met normale (rood-bruine ogen) en een normaal (grijs) lijf worden gekruist met mannetjes die normale (rood-bruine) ogen en een ebony-kleurig lijf hebben. De kruising levert de volgende nakomelingen op: Mannetjes :9 wildtype, 11 witogige, 10 ebony, 12 witogig, ebony; vrouwtjes: 19 wildtype, 21 ebony. a) Erft het w gen en/of het eb gen geslachtsgekoppeld over? Licht je antwoord toe. 1

2 b) Wat zijn de genotypes van de ouders? c) Teken de relevante chromosomen. 3. Benoem de verschillende onderdelen: a) A en B zijn: C en D zijn: E is : F en G zijn: R en r zijn: 2

3 b) Beschrijf kort de verschillen tussen de mitose en de meiose: 4. In een bepaald knaagdier is de vachtkleur zwart (B) dominant over bruin (b) en volledig gekleurd (C) is dominant over chinchilla (c). Heterozygote zwarte, volledig gekleurde ratten worden gekruist met bruine chinchilla ratten, dit levert de volgende nakomelingen: 31 zwart, volledig gekleurd 16 bruin volledig gekleurd 34 bruin, chinchilla 19 zwart, chinchilla a) Zijn de loci gekoppeld? (Motiveer je antwoord) b) Teken de chromosomale posities van de allelen in de ouders: 3

4 c) Wat is de genetische afstand tussen de twee loci (motiveer je antwoord) % wildtype nakomelingen (F1-generatie) zijn gevonden uit een kruising van twee fenotypisch wild-type erwten (Rond en Geel) (P-generatie). Deze nakomelingen worden onderworpen aan een proefkruising (homozygoot recessief voor allelen gerimpeld (r) en groen (g)). De volgende nakomelingen (F2-generatie) worden gevonden: 25% wild-type, groen, gerimpeld, groen en gerimpeld (in de verhouding 1:1:1:1) 25% wild-type 25% groen en wild-type ( in de verhouding 1:1) 25% gerimpeld en wild-type (in de verhouding 1:1) a) Geef de genotypes van de F1-generatie b) Geef de genotypes van de beide ouders (P-generatie). 6. Een plasmide wordt geknipt met de restrictie-enzymen BamHI, EcoRI en HindIII. Elk enzym knipt slechts een maal in het DNA. De resultaten van de verschillende digesties zijn hieronder weergegeven: Enzym: Fragment lengte (Kb) EcoRI 7 EcoRI & BamHI 1,2 en 5,8 EcoRI & HindIII 4,6 en 2,4 EcoRI & BamHI & HindIII 1,2 en 3,4 en 2,4 Teken een restrictie-kaart van het plasmide: 4

5 7. Geef aan of de volgende uitspraken goed of fout zijn, door het goede te omcirkelen. a. Een ribosoom is een ribozyme GOED/FOUT b. RNA polymerase kan drie nucleotide-strengen vasthouden GOED/FOUT c. DNA polymerase start bij de TATAA-box GOED/FOUT d. snrnp ( snurp ) bevatten een cap GOED/FOUT e. Meerdere ribosomen kunnen tegelijk één mrna vertalen GOED/FOUT f. RNA polymerase stopt bij het stopcodon GOED/FOUT g. Prokaryotisch mrna kan direct na transcriptie worden vertaald in eiwit GOED/FOUT h. De splicing reactie kan verlopen zonder eiwit GOED/FOUT i. Prokaryotische ribosomen starten bij de cap GOED/FOUT j. Het anticodon van 5 -AUG-3 is 5 -CAT-3 GOED/FOUT 8. Een muis wordt besmet met bacteriestam Streptococcus pneumoniae type A. De muis gaat dood. Als de bacterien vóór injectie worden verhit, blijven de muizen in leven. Bij een experiment met levende Streptococcus pneumoniae stam B blijven de muizen in leven. Als verhitte bacterien stam A worden gemengd met levende stam B bacterien gaan de muizen dood. Wat is de verklaring? Geef de namen van de processen die je beschrijft. ANTWOORD: 5

6 9. Wat is semi-conservatieve DNA replicatie? 10. Teken een replicatievork tijdens DNA synthese. Geef (A) enzymen en moleculen, (B) polariteit, (C) richting synthese aan. 11a. Waarom is het schadelijk voor je DNA om een dag onbeschermd in de zon te liggen? 11b. En hoe lost je lichaam dat op? 6

7 12. Een bacterie-cultuur wordt bestraald met röntgenstraling. Na bestraling blijkt dat sommige bacterien geen tryptofaan meer kunnen gebruiken, en dus afhankelijk zijn van tryptofaan in het medium. In welke genen kan de bacterie mutaties kan hebben opgelopen en licht elke oplossing kort toe. 13. Wat zijn telomeren? Geef een korte toelichting. 14. Wat is een snurp? Wat voor functie heeft het? 7

8 15. Teken een ribosoom tijdens eiwitsynthese met een gebonden mrna en gebonden trna s. Geef (A) moleculen, (B) polariteit, (C) richting synthese en (D) sites aan. 16a. Hoeveel leesramen zijn er in een mrna sequentie? 16b. Hoe weet het ribosoom welk leesraam het goede is? 17. Van mrna naar eiwit moet een streng nucleotiden worden omgezet in een streng aminozuren. Welke moleculen spelen daarbij een centrale rol? Licht je antwoord kort toe. 8

9 18. Gegeven een stukje van de volgende eukaryotische DNA streng, de sense streng, van 5 naar 3. Gegeven: stopcodons zijn: taa, tag, tga gaggtataatctgacgaaccttggcagtcctagtggctagataagccgccgccatgggcttcctcatgg agcactaaaattaagagccttgaaaatttaaataaaaaaggcgtagctgatacg...-3 a. Welke element herken je dat belangrijk is voor RNA synthese? b. Waar verwacht je dat RNA polymerase ongeveer start? c. Schrijf de eerste 10 nucleotiden van een mogelijke mrna sequentie. c. Schrijf de codons van het (mini-)eiwit dat je maakt van het mrna. d. Welke betekenis heeft de onderlijnde sequentie aataaa? e. Welke gevolgen heeft deze aataaa sequentie? f. Welke gevolgen verwacht je als er door een mutatie een insertie van een C gebeurt tussen de ag, die vet en onderlijnd is? 9

10 19. Beschrijf de transcriptie-regulatie van het bacteriële lac-operon. Gebruik daarbij een tekening. 20. Hoe verspreiden plantenvirussen zich? 21. Teken schematisch een transcriptiefactor met zijn domeinen. 10

11 22. Beschrijf hoe een humaan gen, bijvoorbeeld albumine, gekloneerd zou kunnen worden. Je beschikt over een plasmide, en over een stuk chromosomaal albumine DNA. 23. Beschrijf en teken de verschillende stappen van een PCR. Geef de polariteit aan van de strengen. 11

HERKANSINGSTENTAMEN Moleculaire Biologie deel 2, 5 Jan 2007

HERKANSINGSTENTAMEN Moleculaire Biologie deel 2, 5 Jan 2007 HERKANSINGSTENTAMEN Moleculaire Biologie deel 2, 5 Jan 2007 NAAM: STUDENTNUMMER: CONTROLEER OF DIT TENTAMEN 14 PAGINA S BEVAT. Veel succes! o Je mag de achterkant van het papier ook zo nodig gebruiken,

Nadere informatie

Genetica & Evolutie Deeltentamen 1 Versie 1 2007

Genetica & Evolutie Deeltentamen 1 Versie 1 2007 Vraag 1. Het kleur patroon van de vacht van een hertensoort wordt bepaald door één gen met drie allelen. De allelen D en F erven co- dominant over; allel f erft recessies over t.o.v. zowel D als F. Hoeveel

Nadere informatie

DNA & eiwitsynthese Oefen- en zelftoetsmodule behorende bij hoofdstuk 16 en 17 van Campbell, 7 e druk December 2008

DNA & eiwitsynthese Oefen- en zelftoetsmodule behorende bij hoofdstuk 16 en 17 van Campbell, 7 e druk December 2008 DNA & eiwitsynthese Oefen- en zelftoetsmodule behorende bij hoofdstuk 16 en 17 van Campbell, 7 e druk December 2008 DNA 1. Hieronder zie je de schematische weergave van een dubbelstrengs DNA-keten. Een

Nadere informatie

ANTWOORDEN HOOFDSTUK 6 VAN GEN TOT EIWIT

ANTWOORDEN HOOFDSTUK 6 VAN GEN TOT EIWIT ANTWOORDEN HOOFDSTUK 6 VAN GEN TOT EIWIT ANTWOORDEN 6.5 /TM 6.8 Codering 1.een juiste aanvulling van het schema : nucleotiden in mrna juist nucleotiden in DNA juist 3 kant en 5 kant bij mrna en DNA juist

Nadere informatie

94 Transcriptie en vorming van mrna bij prokaryoten en eukaryoten

94 Transcriptie en vorming van mrna bij prokaryoten en eukaryoten 94 Transcriptie en vorming van mrna bij prokaryoten en eukaryoten Transcriptie bij prokaryoten: Prokaryoten hebben geen celkern, waardoor het DNA los in het cytoplasma ligt. Hier vindt de transcriptie

Nadere informatie

Welke combinatie van twee celorganellen en hun respectievelijke functies is correct?

Welke combinatie van twee celorganellen en hun respectievelijke functies is correct? Biologie Vraag 1 Welke combinatie van twee celorganellen en hun respectievelijke functies is correct? ribosoom en synthese van eiwitten kern en fotosynthese mitochondrion en fotosynthese ribosoom

Nadere informatie

Welke van de bovenstaande celorganellen of levensprocessen kunnen zowel in prokaryote, als in eukaryote cellen voorkomen?

Welke van de bovenstaande celorganellen of levensprocessen kunnen zowel in prokaryote, als in eukaryote cellen voorkomen? Biologie Vraag 1 Celorganellen en levensprocessen bij levende cellen zijn: 1. Ribosomen 2. ATP synthese 5. DNA polymerase 3. Celmembranen 6. Fotosynthese 4. Kernmembraan 7. Mitochondria Welke van de bovenstaande

Nadere informatie

Welke van de bovenstaande celorganellen of levensprocessen kunnen zowel in prokaryote, als in eukaryote cellen voorkomen?

Welke van de bovenstaande celorganellen of levensprocessen kunnen zowel in prokaryote, als in eukaryote cellen voorkomen? Biologie Vraag 1 Celorganellen en levensprocessen bij levende cellen zijn: 1. Ribosomen 2. ATP synthese 5. DNA polymerase 3. Celmembranen 6. Fotosynthese 4. Kernmembraan 7. Mitochondria Welke van de bovenstaande

Nadere informatie

28 Testkruising testkruising = een kruising om te achterhalen of een organisme homozygoot of heterozygoot is. Voorbeeld van een testkruising om te bepalen of een organisme homozygoot of heterozygoot is

Nadere informatie

BIOLOGIE MOLECULAIRE GENETICA EIWITSYNTHESE VWO KLASSE 6

BIOLOGIE MOLECULAIRE GENETICA EIWITSYNTHESE VWO KLASSE 6 BIOLOGIE MOLECULAIRE GENETICA EIWITSYNTHESE VWO KLASSE 6 Henry N. Hassankhan Scholengemeenschap Lelydorp [HHS-SGL] ARTHUR A. HOOGENDOORN ATHENEUM - VRIJE ATHENEUM - AAHA Docent: A. Sewsahai DOELSTELLINGEN:

Nadere informatie

Hand-out bij de oefen- en zelftoets-module bij hoofdstuk 7 van 'The Molecular Biology of the Cell', Alberts et al.

Hand-out bij de oefen- en zelftoets-module bij hoofdstuk 7 van 'The Molecular Biology of the Cell', Alberts et al. Centraal Dogma Hand-out bij de oefen- en zelftoets-module bij hoofdstuk 7 van 'The Molecular Biology of the Cell', Alberts et al., 6e druk Mei 2016 Van DNA naar mrna Hier zie je een deel van de sequentie

Nadere informatie

Hetzelfde DNA in elke cel

Hetzelfde DNA in elke cel EIWITSYNTHESE (H18) Hetzelfde DNA in elke cel 2 Structuur en functie van DNA (1) Genen bestaan uit DNA Genen worden gedragen door chromosomen Chromosomen bestaan uit DNAmoleculen samengepakt met eiwitten

Nadere informatie

DNA & eiwitsynthese Vragen bij COO-programma bij hoofdstuk 11 en 12 Life

DNA & eiwitsynthese Vragen bij COO-programma bij hoofdstuk 11 en 12 Life DNA & eiwitsynthese Vragen bij COO-programma bij hoofdstuk 11 en 12 Life De vragen die voorkomen in het COO-programma DNA & eiwitsynthese zijn op dit formulier weergegeven. Het is de bedoeling dat je,

Nadere informatie

TENTAMEN BIOCHEMIE (8S135) Prof. Dr. Ir. L. Brunsveld :00 17:00 (totaal 100 punten) 6 opgaven in totaal (aangegeven tijd is indicatie)

TENTAMEN BIOCHEMIE (8S135) Prof. Dr. Ir. L. Brunsveld :00 17:00 (totaal 100 punten) 6 opgaven in totaal (aangegeven tijd is indicatie) TENTAMEN BIOCHEMIE (8S135) Prof. Dr. Ir. L. Brunsveld 25-01-2010 14:00 17:00 (totaal 100 punten) 6 opgaven in totaal (aangegeven tijd is indicatie) 1 (~30 minuten; 20 punten) Onderstaand is een stukje

Nadere informatie

STEMPEL DE WEG VAN GEN NAAR EIWIT

STEMPEL DE WEG VAN GEN NAAR EIWIT A LIFE TYPEFACE STEMPEL DE WEG VAN GEN NAAR EIWIT De eiwitsynthese is één van de belangrijkste processen die zich in de cel afspelen. Eiwitten staan aan de basis van het functioneren van de cel. Wat een

Nadere informatie

Biologie 1997 Augustus

Biologie 1997 Augustus www. Biologie 1997 Augustus Vraag 1 In de onderstaande tekening is de elektronenmicroscopische afbeelding van een cel van een traanklier van een mens weergegeven. Het afgescheiden traanvocht bevat een

Nadere informatie

Biotechnologie deel I

Biotechnologie deel I Biotechnologie deel I Hand-out bij de eerste oefen- en zelftoetsmodule van Biotechnologie & maatschappij behorende bij hoofdstuk 2,3, 4 en 5 van Introduction to Biotechnology, Thieman & Palladino, 3 e

Nadere informatie

Welke van de bovenstaande celorganellen of levensprocessen kunnen zowel in prokaryote, als in eukaryote cellen voorkomen?

Welke van de bovenstaande celorganellen of levensprocessen kunnen zowel in prokaryote, als in eukaryote cellen voorkomen? Biologie Vraag 1 Celorganellen en levensprocessen bij levende cellen zijn: 1. Ribosomen 2. ATP synthese 5. DNA polymerase 3. Celmembranen 6. Fotosynthese 4. Kernmembraan 7. Mitochondria Welke van de bovenstaande

Nadere informatie

Genetica & Evoltie Deeltentamen 1 2008. a. X- chromosoom gebonden recessief. b. Autosomaal recessief. c. X- chromosoom gebonden dominant.

Genetica & Evoltie Deeltentamen 1 2008. a. X- chromosoom gebonden recessief. b. Autosomaal recessief. c. X- chromosoom gebonden dominant. Vraag 1. Een fruitvliegje met het genotype AABBCC wordt gekruist met een aabbcc vlieg. De drie kenmerken erven onafhankelijk van elkaar over en A, B en C zijn volledig dominant over respectievelijk a,

Nadere informatie

Genetica & Evolutie Deeltentamen 1

Genetica & Evolutie Deeltentamen 1 Vraag 1. Iemands genotype is AaBb voor twee genen die gekoppeld op een chromosoom liggen. Als de beide dominante allelen op één chromosoom liggen, en de beide recessieve allelen op het andere homologe

Nadere informatie

vwo eiwitsynthese 2010

vwo eiwitsynthese 2010 vwo eiwitsynthese 2010 Aan- en uitzetten van genen Escherichia coli leeft in de dikke darm van onder andere de mens. Deze bacterie heeft vijf structurele genen die coderen voor enzymen die betrokken zijn

Nadere informatie

Tentamen Van Mens tot Cel

Tentamen Van Mens tot Cel Tentamen Van Mens tot Cel 1. Hans en Tineke willen graag een kindje. Zowel de ouders van Hans als de ouders van Tineke zijn beide drager van een autosomaal recessieve ziekte. Wat is de kans dat Hans en

Nadere informatie

Van mens tot Cel oefenvragen 1. De celdeling bestaat uit verschillende fasen. Hoe heten de G1, S en de G2 fase samen?

Van mens tot Cel oefenvragen 1. De celdeling bestaat uit verschillende fasen. Hoe heten de G1, S en de G2 fase samen? Van mens tot Cel oefenvragen 1. De celdeling bestaat uit verschillende fasen. Hoe heten de G1, S en de G2 fase samen? A: interfase B: profase C: anafase D: cytokinese 2. Een SNP (single nucleotide polymorphism)

Nadere informatie

Welke van de onderstaande structuren maakt spiercontractie mogelijk?

Welke van de onderstaande structuren maakt spiercontractie mogelijk? Biologie Vraag 1 Welke van de onderstaande structuren maakt spiercontractie mogelijk? Microtubuli Microfilamenten Intermediaire filamenten Microvilli Biologie: vraag 1 Biologie Vraag 2

Nadere informatie

DNA & eiwitsynthese (Junior College Utrecht) Vragen bij COO-programma

DNA & eiwitsynthese (Junior College Utrecht) Vragen bij COO-programma DNA & eiwitsynthese (Junior College Utrecht) Vragen bij COO-programma De vragen die voorkomen in het COO-programma DNA & eiwitsynthese zijn op dit formulier weergegeven. Het is de bedoeling dat je, als

Nadere informatie

biologie vwo 2017-I Gespierder door gendoping

biologie vwo 2017-I Gespierder door gendoping Gespierder door gendoping Het overdragen van genetisch materiaal naar menselijke cellen voor de behandeling van ziektes bevindt zich nog in een experimenteel stadium. Deze techniek zou ook gebruikt kunnen

Nadere informatie

Humane levenscyclus 1

Humane levenscyclus 1 Humane levenscyclus 1 Genexpressie 2 8 september 2011 Doel: Genexpressie (via welke stappen de informatie die in het DNA is opgeslagen gebruikt kan worden om eiwitten te vormen. Differentiële genexpressie

Nadere informatie

Examen Voorbereiding DNA. Teylingen College Leeuwenhorst 2015/2016. 2016 JasperOut.nl. Thema 2 DNA

Examen Voorbereiding DNA. Teylingen College Leeuwenhorst 2015/2016. 2016 JasperOut.nl. Thema 2 DNA Examen Voorbereiding DNA Teylingen College Leeuwenhorst 2015/2016 Thema 2 DNA Begrippenlijst: Begrip mtdna kerndna Plasmiden Genoom DNA-replicatie DNA-polymerase Eiwitsynthese RNA-molecuul Codon Genregulatie

Nadere informatie

Juli blauw Biologie Vraag 1

Juli blauw Biologie Vraag 1 Biologie Vraag 1 Bij bijen komt parthenogenese voor. Dit is de ontwikkeling van een individu uit een onbevruchte eicel. Bij bijen ontstaan de darren (mannelijke bijen) parthenogenetisch. De koningin en

Nadere informatie

Juli geel Biologie Vraag 1

Juli geel Biologie Vraag 1 Biologie Vraag 1 Bij bijen komt parthenogenese voor. Dit is de ontwikkeling van een individu uit een onbevruchte eicel. Bij bijen ontstaan de darren (mannelijke bijen) parthenogenetisch. De koningin en

Nadere informatie

Voorbereiding toelatingsexamen arts/tandarts. Biologie: Erfelijke informatie in de cel 6/29/2013. dr. Brenda Casteleyn

Voorbereiding toelatingsexamen arts/tandarts. Biologie: Erfelijke informatie in de cel 6/29/2013. dr. Brenda Casteleyn Voorbereiding toelatingsexamen arts/tandarts Biologie: Erfelijke informatie in de cel 6/29/2013 dr. Brenda Casteleyn Met dank aan: Leen Goyens (http://users.telenet.be/toelating) en studenten van forum

Nadere informatie

Biologie 2000 Vraag 1 De plaats waar de chromatiden van een chromosoom tijdens de eerste fasen van een cel/kerndeling aan mekaar vastzitten noemt men: A. Centriool B. Centromeer C. Centrosoom D. Chromomeer

Nadere informatie

DNA van mitochondriën, chloroplasten en in bacteriën Enkele gegevens over het DNA van de mens Ontdekking van DNA structuur door Watson en Crick

DNA van mitochondriën, chloroplasten en in bacteriën Enkele gegevens over het DNA van de mens Ontdekking van DNA structuur door Watson en Crick Hoofdstuk1: Erfelijke informatie in de cel... 2 1. Bouw van de kern tijdens de interfase... 2 2. Nucleïnezuren... 2 2.1. Primaire structuur van nucleïnezuren... 3 2.1.1. Bouwstenen... 3 2.2. De ruimtelijke

Nadere informatie

Paragraaf Homologe chromosomen

Paragraaf Homologe chromosomen Paragraaf Homologe chromosomen Opbouw: Lees de les op biologielessn.nl over homologe chromosomen goed door. Maak de onderstaande vragen van deze bladzijde. Reproductie vragen: 1. Wat zijn homologe chromosomen?

Nadere informatie

Oefenvragen Mens tot Cel

Oefenvragen Mens tot Cel Oefenvragen Mens tot Cel 1. In de familie van Tineke komt sma type 1 voor. Sma type 1 staat voor spinale spier atrofie type 1. De oom van Tineke heeft sma type 1 (zie de stamboom hieronder). Hoe groot

Nadere informatie

1. Welk van de onderstaande DNA sequenties zijn mogelijke herkenning-sites voor restrictie-enzymen? c 5' GAATTC 3' c 5' GGGGCCCC 3' c 5' CTGCAG 3' 5'

1. Welk van de onderstaande DNA sequenties zijn mogelijke herkenning-sites voor restrictie-enzymen? c 5' GAATTC 3' c 5' GGGGCCCC 3' c 5' CTGCAG 3' 5' proefexamen 1. Welk van de onderstaande DNA sequenties zijn mogelijke herkenning-sites voor restrictie-enzymen? c 5' GAATTC 3' c 5' GGGGCCCC 3' c 5' CTGCAG 3' 5' CTAAATC 3' 5' GGAACC 3' Restriction Endonucleases

Nadere informatie

Vragenlijst Module cellen

Vragenlijst Module cellen De uitwerking van de vragen zet je in de verslagen van je practica! (LEES LAATSTE BLADZIJDE!) Cursief gedrukte blauwe vragen alleen voor bio-mensen!! Vragenlijst Module cellen 1. Noem drie verschillen

Nadere informatie

Fenotype nakomelingen. donker kort 29 donker lang 9 wit kort 31 wit- lang 11

Fenotype nakomelingen. donker kort 29 donker lang 9 wit kort 31 wit- lang 11 1. Bij honden is het allel voor donkerbruine haarkleur (E) dominant over het allel voor witte haarkleur (e). Het allel voor kort haar (F) is dominant over het allel voor lang haar (f). Een aantal malen

Nadere informatie

www. Biologie 2001 Vraag 1 Dit zijn een aantal gegevens over een nucleïnezuur. 1. Het is een enkelvoudige keten. 2. Het bevat als basen: G - A - C - T. 3. Het varieert naargelang de soort cel binnen één

Nadere informatie

Tobianopatroon Een hengst met tobianopatroon en een merrie met normale kleuring krijgen een veulen met een tobianopatroon Kun je bepalen welke

Tobianopatroon Een hengst met tobianopatroon en een merrie met normale kleuring krijgen een veulen met een tobianopatroon Kun je bepalen welke Tobianopatroon Een hengst met tobianopatroon en een merrie met normale kleuring krijgen een veulen met een tobianopatroon Kun je bepalen welke eigenschap dominant is? Tobianopatroon Een hengst met tobianopatroon

Nadere informatie

De antwoorden op vragen 1 en 2, 3 en 4, en 5 t/m 8 graag op verschillende vellen schrijven. Vergeet ook niet op de 3 vellen je naam en studentnr.

De antwoorden op vragen 1 en 2, 3 en 4, en 5 t/m 8 graag op verschillende vellen schrijven. Vergeet ook niet op de 3 vellen je naam en studentnr. Tentamen Genoombiologie, 28 Oktober 2009, 9.00-11.45 h De antwoorden op vragen 1 en 2, 3 en 4, en 5 t/m 8 graag op verschillende vellen schrijven. Vergeet ook niet op de 3 vellen je naam en studentnr.

Nadere informatie

Computer Ondersteund Onderwijs (COO).

Computer Ondersteund Onderwijs (COO). Computer Ondersteund Onderwijs (COO). Over DNA en eiwit is er een computer praktikum. Bij dit COO leer je via een interactieve manier omgaan met de stof. Opstarten COO. Ga naar de site van het departement

Nadere informatie

a. Geef de 1-lettercode van de aminozuren in het peptide in de corresponderende volgorde. (4P)

a. Geef de 1-lettercode van de aminozuren in het peptide in de corresponderende volgorde. (4P) HERTENTAMEN Eindtoets BIOCHEMIE (8RA00) Prof. Dr. Ir. L. Brunsveld 16-08-2013 09:00 12:00 (totaal 100 punten) 6 opgaven in totaal! (aangegeven tijd is indicatie) Gebruik geen rode pen! 1 Peptiden en eiwitten

Nadere informatie

Basisstof 7 Genetische variatie

Basisstof 7 Genetische variatie Afbeelding 33. RNA-interferentie.1 RNA bevat 2 complementaire sequenties die aan elkaar plakken, zodat er een haarspeld structuur ontstaat (1 van afbeelding 33). Het enzym Dicer knipt het dubbele RNA in

Nadere informatie

Level 1. Vul het juiste woord in

Level 1. Vul het juiste woord in Level 1 Vul het juiste woord in Keuze uit: Gen, Allel, Locus, Dominant, Recessief, Co-dominantie, Monohybride kruising, Dihybride kruising, Autosoom, Autosomale overerving, X-chromosomale overerving, Intermediair

Nadere informatie

<A> Thymine is een pyrimidinebase en vormt 3 waterstofbruggen met adenine. <B> Adenine is een purinebase en vormt 2 waterstofbruggen met thymine.

<A> Thymine is een pyrimidinebase en vormt 3 waterstofbruggen met adenine. <B> Adenine is een purinebase en vormt 2 waterstofbruggen met thymine. Biologie Vraag 1 Welke uitspraak is correct? Thymine is een pyrimidinebase en vormt 3 waterstofbruggen met adenine. Adenine is een purinebase en vormt 2 waterstofbruggen met thymine. Cytosine

Nadere informatie

<A> Adenine is een purinebase en vormt 2 waterstofbruggen met thymine. <B> Guanine is een pyrimidinebase en vormt 2 waterstofbruggen met cytosine.

<A> Adenine is een purinebase en vormt 2 waterstofbruggen met thymine. <B> Guanine is een pyrimidinebase en vormt 2 waterstofbruggen met cytosine. Biologie Vraag 1 Welke uitspraak is correct? Adenine is een purinebase en vormt 2 waterstofbruggen met thymine. Guanine is een pyrimidinebase en vormt 2 waterstofbruggen met cytosine. Thymine

Nadere informatie

Tentamen Celbiologie. DATUM TIJD 14 tot 17 uur ZAAL N109 Wentgebouw. Beantwoord elk onderdeel op een apart vel. Veel succes!

Tentamen Celbiologie. DATUM TIJD 14 tot 17 uur ZAAL N109 Wentgebouw. Beantwoord elk onderdeel op een apart vel. Veel succes! Tentamen Celbiologie DATUM 19-11-2004 TIJD 14 tot 17 uur ZAAL N109 Wentgebouw. Dit tentamen bestaat uit onderdelen: - Onderdeel 1 bestaat uit twee vragen (vraag 1-2) 20 punten - Onderdeel 2 bestaat uit

Nadere informatie

Begrippenlijst DNA adenine Eén van de nucelotidebasen die in DNA en RNA voorkomen. Adenine (A) vormt een basenpaar met thymine (T) in het DNA en met

Begrippenlijst DNA adenine Eén van de nucelotidebasen die in DNA en RNA voorkomen. Adenine (A) vormt een basenpaar met thymine (T) in het DNA en met Begrippenlijst DNA adenine Eén van de nucelotidebasen die in DNA en RNA voorkomen. Adenine (A) vormt een basenpaar met thymine (T) in het DNA en met uracil (U) in RNA. Adenine komt ook voor in AMP, ADP,

Nadere informatie

Level 1. Vul het juiste woord in

Level 1. Vul het juiste woord in Level 1 Vul het juiste woord in Keuze uit: Gen, Allel, Locus, Dominant, Recessief, Co-dominantie, Monohybride kruising, Dihybride kruising, Autosoom, Autosomale overerving, X-chromosomale overerving, Intermediair

Nadere informatie

Let er op dat je voor iedere vraag een uitwerking maakt met kruisingsschema en/of berekening.

Let er op dat je voor iedere vraag een uitwerking maakt met kruisingsschema en/of berekening. Week Thema Onderwerp Datum 43 3 Basisstof 1 t/m 4 23/10 28/10 44 3 Basisstof 1 t/m 4 31/10 4/11 45 7/11 11/11 Basisstof 5 t/m 7 bespreken 3 Basisstof 5 t/m 7 bespreken Verrijkingsstof 1 Herhalen en bespreken

Nadere informatie

Examentraining onderwerp: diagrammen Lees eerst de vraag. ga dan naar de tekst! onderwerp: Bloedsomloop Lees eerst de vraag. ga dan naar de tekst!

Examentraining onderwerp: diagrammen Lees eerst de vraag. ga dan naar de tekst! onderwerp: Bloedsomloop Lees eerst de vraag. ga dan naar de tekst! Examentraining onderwerp: diagrammen Moet er een diagram getekend worden? Bedenk: Welk type grafiek is er nodig. Is het een Lijndiagram? bedenk dan: wat komt er op de X-as? (de onafhankelijke variabele,

Nadere informatie

Welke combinaties tussen een celorganel en zijn functie zijn correct?

Welke combinaties tussen een celorganel en zijn functie zijn correct? Biologie Vraag 1 Welke combinaties tussen een celorganel en zijn functie zijn correct? Lysosoom en vertering Mitochondrion en synthese van eiwitten Lysosoom en fotosynthese Mitochondrion en celademhaling

Nadere informatie

GENOMISCH KOOKBOEK LEERLINGENHANDLEIDING

GENOMISCH KOOKBOEK LEERLINGENHANDLEIDING GENOMISCH KOOKBOEK LEERLINGENHANDLEIDING LEERLINGENHANDLEIDING GENOMISCH KOOKBOEK 1 HOOFDSTUK 1 DNA EN DE ROL VAN RNA BIJ TRANSCRIPTIE 1.1 Hieronder zie je een vak met daarin de begrippen DNA en RNA. Maak

Nadere informatie

Newsletter April 2013

Newsletter April 2013 1. Inleiding Met het thema van deze nieuwsbrief willen we ons richten op de fundamenten van het fokken: de basisgenetica. Want of je het nu wil of niet. dit is ook de basis voor een succesvolle fok! Misschien

Nadere informatie

3. Eén gen kan vele allelen hebben. Hoeveel allelen van één gen heeft ieder individu?

3. Eén gen kan vele allelen hebben. Hoeveel allelen van één gen heeft ieder individu? Genetica Vragen bij hoofdstuk 13, 14 en 15 van 'Biology', Campbell, 7e druk Versie 2006 2007 Theorie 1. Hoe noemt men een plant die raszuiver is voor een bepaalde eigenschap? 2. Hoe noemt men planten met

Nadere informatie

Oefenvraagstukken genetica

Oefenvraagstukken genetica Oefenvraagstukken genetica Monohybride kruisingen. 50 meerkeuze vragen. OPLOSSEN MET KRUISSINGSSCHEMA!!!!! 1. Poes Kitty met lange haren heeft gepaard met kater Kobus. Zij krijgt zowel kortharige als langharige

Nadere informatie

1. Welk(e) van de volgende baseparen komt(en) van nature voor in een DNA dubbele helix. Omcirkel deze. C-G

1. Welk(e) van de volgende baseparen komt(en) van nature voor in een DNA dubbele helix. Omcirkel deze. C-G Tentamen Biochemie MST. Deel 2 29 oktober 201 1:0-1:0u (17:00u met handicap) Antwoorden invullen op dit vel. 90 punten is een Den, 0 punten is een 1 Naam: Studentnr: 1. Welk(e) van de volgende baseparen

Nadere informatie

a. Geef de 1-lettercode van de aminozuren in het peptide in de corresponderende volgorde. (4P) LLORETDEMAR (iedere fout -1P)

a. Geef de 1-lettercode van de aminozuren in het peptide in de corresponderende volgorde. (4P) LLORETDEMAR (iedere fout -1P) TENTAMEN BIOCHEMIE (8RA00) Prof. Dr. Ir. L. Brunsveld 28-06-2013 09:00 12:00 (totaal 100 punten) 6 opgaven in totaal! (aangegeven tijd is indicatie) Gebruik geen rode pen! 1 Peptiden en eiwitten (~15 minuten;

Nadere informatie

STEMPEL DE WEG VAN GEN NAAR EIWIT

STEMPEL DE WEG VAN GEN NAAR EIWIT A LIFE TYPEFACE STEMPEL DE WEG VAN GEN NAAR EIWIT De eiwitsynthese is één van de belangrijkste processen die zich in de cel afspelen. Eiwitten staan aan de basis van het functioneren van de cel. Wat een

Nadere informatie

- 1 - Microbiologie en Biochemie (MIB-10306) Biochemie deel Vrijdag 29 februari 2008, uur

- 1 - Microbiologie en Biochemie (MIB-10306) Biochemie deel Vrijdag 29 februari 2008, uur Microbiologie en Biochemie (MIB-10306) Biochemie deel Vrijdag 29 februari 2008, 9.00-12.00 uur - Begin met het invullen van je naam en registratienummer. - Alle antwoorden moeten op het vragenformulier

Nadere informatie

Onderstaand is een stukje peptide getoond dat deel uit maakt van een groter eiwit en de naam draagt van een lokaal beroemde biochemicus:

Onderstaand is een stukje peptide getoond dat deel uit maakt van een groter eiwit en de naam draagt van een lokaal beroemde biochemicus: 1 Onderstaand is een stukje peptide getoond dat deel uit maakt van een groter eiwit en de naam draagt van een lokaal beroemde biochemicus: a. Geef de 1-lettercode van de 6 uitgeschreven aminozuren in de

Nadere informatie

Synthetische biologie in de praktijk. igem TU Eindhoven 2016

Synthetische biologie in de praktijk. igem TU Eindhoven 2016 Synthetische biologie in de praktijk Doelgroep: Vakgebied: Tijdsduur: HAVO/VWO bovenbouw Biologie ± 40 minuten Inleiding Synthetische biologie is het (her)programmeren van een biologisch systeem (cellen

Nadere informatie

4 HAVO thema 4 Erfelijkheid EXAMENTRAINER OEFENVRAGEN

4 HAVO thema 4 Erfelijkheid EXAMENTRAINER OEFENVRAGEN Examentrainer Vragen Karyogrammen In afbeelding 1 zijn twee karyogrammen weergegeven. Deze karyogrammen zijn afkomstig van een eeneiige tweeling. Het ene kind is van het mannelijk geslacht zonder duidelijke

Nadere informatie

Monohybride en dihybride kruisingen vmbo-kgt34

Monohybride en dihybride kruisingen vmbo-kgt34 Auteur VO-content Laatst gewijzigd Licentie Webadres 19 July 2016 CC Naamsvermelding-GelijkDelen 3.0 Nederland licentie http://maken.wikiwijs.nl/63372 Dit lesmateriaal is gemaakt met Wikiwijsleermiddelenplein.

Nadere informatie

Biologie Vraag 1 <A> <B> <C> <D> Vraag 1. Dit zijn een aantal gegevens over een nucleïnezuur.

Biologie Vraag 1 <A> <B> <C> <D> Vraag 1. Dit zijn een aantal gegevens over een nucleïnezuur. Biologie Vraag 1 Dit zijn een aantal gegevens over een nucleïnezuur. 1. Het is een enkelvoudige keten. 2. Het bevat als basen: G A C T. 3. Het varieert naargelang de soort cel binnen één organisme. 4.

Nadere informatie

Biologie (jaartal onbekend)

Biologie (jaartal onbekend) Biologie (jaartal onbekend) 1) Bijgevoegde fotografische afbeelding geeft de elektronenmicroscopische opname van een organel (P) van een cel. Wat is de belangrijkste functie van dit organel? A. Het transporteren

Nadere informatie

Desoxyribose heeft 5 C-atomen. De fosfaatgroep zit aan het 5e C-atoom en de stikstofbase aan het 1e C-atoom.

Desoxyribose heeft 5 C-atomen. De fosfaatgroep zit aan het 5e C-atoom en de stikstofbase aan het 1e C-atoom. Desoxyribose heeft 5 C-atomen. De fosfaatgroep zit aan het 5e C-atoom en de stikstofbase aan het 1e C-atoom. Afbeelding 2. DNA-nucleotide.1 Bij het aan elkaar koppelen van nucleotiden gaat het 3e C-atoom

Nadere informatie

Tentamen Biochemie,, onderdeel Abrahams, 2e jaar MST, Antwoorden

Tentamen Biochemie,, onderdeel Abrahams, 2e jaar MST, Antwoorden Tentamen Biochemie,, onderdeel Abrahams, 2e jaar MST, 26-09-2014 Antwoorden 1. Hieronder is de structuur weergegeven van octadecyl rhodamine B chloride. Let op de alifatische (CH 2 ) 17 keten die is veresterd

Nadere informatie

4 VWO thema 4 Genetica EXAMENTRAINER OEFENVRAGEN

4 VWO thema 4 Genetica EXAMENTRAINER OEFENVRAGEN Examentrainer Vragen Erfelijke kaalheid De aanwezigheid of het geheel of gedeeltelijk ontbreken van hoofdhaar (kaalheid) berust op de allelen H n k (niet kaal) en H (kaal). In aanwezigheid van hoge concentraties

Nadere informatie

2 Voortplanten met organen Bouw en werking van geslachtsorganen Werking van geslachtshormonen Afsluiting 31

2 Voortplanten met organen Bouw en werking van geslachtsorganen Werking van geslachtshormonen Afsluiting 31 Inhoud Voorwoord 5 Inleiding 6 1 Voortplanten van genen 9 1.1 Genetica 9 1.2 Kruisingen 13 1.3 Crossing-over en mutatie 16 1.4 Erfelijkheid en praktijk 17 1.5 Inteelt en inteeltdepressie 21 1.6 Afsluiting

Nadere informatie

Naam: Studentnummer: Opleiding:..

Naam: Studentnummer: Opleiding:.. TENTAMEN Moleculaire Cel Biologie (8A840) Prof. Dr. Ir. L. Brunsveld & Dr. M. Merkx 24-01-2014 9:00 12:00 (totaal 100 punten, plus max. 5 extra voor bonus) 6 opgaven in totaal + 1 bonusvraag! (aangegeven

Nadere informatie

1 (~20 minuten; 20 punten)

1 (~20 minuten; 20 punten) TENTAMEN Moleculaire Cel Biologie (8A840) Prof. Dr. Ir. L. Brunsveld & Dr. M. Merkx 27-01-2012 14:00 17:00 (totaal 100 punten) 6 opgaven in totaal + 1 bonusvraag! (aangegeven tijd is indicatie) Gebruik

Nadere informatie

Copyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

Copyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings De meeste organismen hebben een twee sets chromosomen, met daarop informatie voor alle eigenschappen van dat organisme (diploid) Deze erfelijke informatie noemen we het genotype Hoe deze erfelijke informatie

Nadere informatie

Voorbereiding toelatingsexamen arts/tandarts. Biologie: Erfelijkheid 6/29/2013. dr. Brenda Casteleyn

Voorbereiding toelatingsexamen arts/tandarts. Biologie: Erfelijkheid 6/29/2013. dr. Brenda Casteleyn Voorbereiding toelatingsexamen arts/tandarts Biologie: Erfelijkheid 6/29/2013 dr. Brenda Casteleyn Met dank aan: Leen Goyens (http://users.telenet.be/toelating) en studenten van forum http://www.toelatingsexamen-geneeskunde.be

Nadere informatie

Welke van de onderstaande structuren maakt spiercontractie mogelijk?

Welke van de onderstaande structuren maakt spiercontractie mogelijk? Biologie Vraag 1 Welke van de onderstaande structuren maakt spiercontractie mogelijk? Microtubuli Microfilamenten Intermediaire filamenten Microvilli Biologie: vraag 1 Biologie Vraag 2

Nadere informatie

Biotechnologie deel II

Biotechnologie deel II Biotechnologie deel II Hand-out bij de tweede oefen- en zelftoetsmodule van Biotechnologie & maatschappij behorende bij hoofdstuk 6, 7, 8 en 11 van Introduction to Biotechnology, Thieman & Palladino, 3

Nadere informatie

Vragen bij paragraaf 5.1 en 5.2

Vragen bij paragraaf 5.1 en 5.2 Vragen bij paragraaf 5.1 en 5.2 1. Geef van onderstaande begrippen een omschrijving. celdifferentiatie overgang van stamcellen in specifieke cellen (specialisatie) katalysator een stof die een bepaalde

Nadere informatie

Proteomics. Waarom DNA alleen niet genoeg is

Proteomics. Waarom DNA alleen niet genoeg is Proteomics Waarom DNA alleen niet genoeg is Reinout Raijmakers Netherlands Proteomics Centre Universiteit Utrecht, Biomolecular Mass Spectrometry and Proteomics Group Van DNA naar organisme Eiwitten zijn

Nadere informatie

Moleculaire mechanismen. De connectie tussen interacties van eiwitten en activiteiten van cellen

Moleculaire mechanismen. De connectie tussen interacties van eiwitten en activiteiten van cellen Moleculaire mechanismen De connectie tussen interacties van eiwitten en activiteiten van cellen The Hallmarks of Cancer Hanahan and Weinberg, Cell 2000 Niet afhankelijk van groei signalen Apoptose ontwijken

Nadere informatie

2 Leg uit hoe de verschillende subtypes van Chlamydia trachomatis zijn ontstaan. Beschrijf de rol van antibioticagebruik hierin.

2 Leg uit hoe de verschillende subtypes van Chlamydia trachomatis zijn ontstaan. Beschrijf de rol van antibioticagebruik hierin. Examentrainer Vragen Nieuwe DNA-test voor chlamydia Chlamydia is de meest voorkomende seksueel overdraagbare aandoening (soa) en kan onder meer leiden tot onvruchtbaarheid. In Nederland worden jaarlijks

Nadere informatie

Nederlandse samenvatting

Nederlandse samenvatting Nederlandse samenvatting 111 Dit proefschrift behandelt de diagnose van epidermolysis bullosa simplex (EBS) op DNA niveau en een eerste aanzet tot het ontwikkelen van gentherapie voor deze ziekte. Een

Nadere informatie

Genetische Selectie. Eindwerk: hondenfokker 2 de jaar. Sabine Spiltijns

Genetische Selectie. Eindwerk: hondenfokker 2 de jaar. Sabine Spiltijns Genetische Selectie Eindwerk: hondenfokker 2 de jaar Sabine Spiltijns 2010-2011 0 We kunnen aan de hand van een genetische selectie ongeveer voorspellen hoe de puppy s van onze hondjes er gaan uitzien.

Nadere informatie

Transcriptie en de Genetische code

Transcriptie en de Genetische code Transcriptie en de Genetische code DNA getranscripteerd tot RNA, 3 grote groepen mrna: codeert voor proteïnen rrna: onderdeel van de Ribosomen trna: koppeling tussen AZ en het mrna De informatieflow gaat

Nadere informatie

V6 Oefenopgaven oktober 2009

V6 Oefenopgaven oktober 2009 V6 Oefenopgaven oktober 2009 Fitness Met fitness wordt in de biologie bedoeld het vermogen van genotypen om hun allelen naar de volgende generatie over te dragen. De fitness wordt uitgedrukt in een getal

Nadere informatie

Rondleiding door de cel

Rondleiding door de cel Rondleiding door de cel Interactieve opgaven bij de hoofdstukken 5 t/m 8 van Biology, Campbell Deze module behandelt de volgende delen van hoofdstukken van Campbell s Biology : Hoofdstuk 5.4, pagina 77-86:

Nadere informatie

Een rondleiding door de cel (COO 2)

Een rondleiding door de cel (COO 2) Een rondleiding door de cel (COO 2) Vragen bij de oefen- en zelftoets-module behorende bij hoofdstuk 7 en 8 van Biology, Campbell, 9 e druk Versie 2012-2013 De vragen die voorkomen in het COO-programma

Nadere informatie

1 (~20 minuten; 15 punten)

1 (~20 minuten; 15 punten) HERTENTAMEN Moleculaire Cel Biologie (8A840) Prof. Dr. Ir. L. Brunsveld & Dr. M. Merkx 20-04-2012 14:00 17:00 (totaal 100 punten) 6 opgaven in totaal + 1 bonusvraag! (aangegeven tijd is indicatie) Gebruik

Nadere informatie

AAbb of Aabb = normaal zicht aabb of aabb = retinitis pigmentosa AABB of AABb = retinitis pigmentosa

AAbb of Aabb = normaal zicht aabb of aabb = retinitis pigmentosa AABB of AABb = retinitis pigmentosa 13. (MC) Retinitis pigmentosa is een erfelijke vorm van blindheid, die kan veroorzaakt worden door een recessief allel (a) op een locus alfa, of door een dominant allel (B) op een andere locus, bèta. Onderstaande

Nadere informatie

Alles door elkaar 1. a) b) c) 2. a) b) c) a) b) BIOLOGIE 2017/18 WERKBOEK

Alles door elkaar 1. a) b) c) 2. a) b) c) a) b) BIOLOGIE 2017/18 WERKBOEK Alles door elkaar 1. Van twee erwtenplanten worden nakomelingen verkregen. Hiervan blijken er 28 rode bloemen te dragen en 11 witte bloemen. a) Wat zijn de genotypen van de ouderplanten? b) Welk allel

Nadere informatie

Dit is het overzicht van de studiestof voor De ontwikkeling van blok 1.1.1. Het betreft hier een overzicht van de verplichte literatuur.

Dit is het overzicht van de studiestof voor De ontwikkeling van blok 1.1.1. Het betreft hier een overzicht van de verplichte literatuur. Voorwoord Dit is het overzicht van de studiestof voor De ontwikkeling van blok 1.1.1. Het betreft hier een overzicht van de verplichte literatuur. Dit overzicht is geschreven naar eigen inzicht van de

Nadere informatie

www.vetserieus.nl Beste Student,

www.vetserieus.nl Beste Student, www.vetserieus.nl Beste Student, De documenten op VETserieus.nl zijn alleen bedoeld als ondersteuning bij het studeren. De samenvattingen worden nagekeken door studenten tijdens het volgen van de lessen

Nadere informatie

Het enzym dat verantwoordelijk is voor het vastleggen van de imprint na de DNA-replicatie is een DNA-methyltransferase.

Het enzym dat verantwoordelijk is voor het vastleggen van de imprint na de DNA-replicatie is een DNA-methyltransferase. Examentrainer Vragen Hongerwinterkinderen Gedurende de laatste winter van de Tweede Wereldoorlog stierven veel Nederlanders door barre omstandigheden: koude en voedselgebrek. Tijdens deze hongerwinter

Nadere informatie

Knock-Out. De module is ontwikkeld door

Knock-Out. De module is ontwikkeld door 2 De module Knock-Out Muizen gebruiken voor kankeronderzoek is bestemd voor de lessen Natuur, Leven en Technologie (NLT). De module is op 24 april 2012 gecertificeerd door de Stuurgroep NLT voor gebruik

Nadere informatie

Herhalingsoefeningen

Herhalingsoefeningen Herhalingsoefeningen Steven Maenhout 1 stamboomanalyse 1. De stamboom uit figuur 1 geeft de overerving van de witte haarlok eigenschap bij mensen. De aangetaste individuen hebben een lok ongepigmenteerd

Nadere informatie

Naam: Studentnummer: Opleiding:..

Naam: Studentnummer: Opleiding:.. EINDTETS Biochemie (8RA00) en TENTAMEN Biochemie (8S135) Prof. Dr. Ir. L. Brunsveld 25-06-2014 09:00 12:00 (totaal 100 punten, plus max. 5 extra voor bonus) 6 opgaven in totaal + 1 bonusvraag! (aangegeven

Nadere informatie

HAVO 5 Begrippenlijst Erfelijkheid allel Allelen zijn verschillende vormen van een gen. Zij liggen in homologe chromosomen op precies dezelfde

HAVO 5 Begrippenlijst Erfelijkheid allel Allelen zijn verschillende vormen van een gen. Zij liggen in homologe chromosomen op precies dezelfde HAVO 5 Begrippenlijst Erfelijkheid allel Allelen zijn verschillende vormen van een gen. Zij liggen in homologe chromosomen op precies dezelfde plaats. Allelen coderen voor dezelfde eigenschap bijvoorbeeld

Nadere informatie

1 Antwoorden Monohybride Kruisingen

1 Antwoorden Monohybride Kruisingen 1 Antwoorden Monohybride Kruisingen 1) A = zwart haar, a = wit haar P: Aa x Aa F1: A a A AA Aa Alleen genotype aa geeft wit haar, dus 25 % 2) a) Eigenschap C (= A) b) Aa c) Aa d) AA of Aa 3) zwart : wit

Nadere informatie

door dr. W. H. Mager Vakgroep Biochemie en Moleculaire Biologie Vrije Universiteit Amsterdam

door dr. W. H. Mager Vakgroep Biochemie en Moleculaire Biologie Vrije Universiteit Amsterdam 113 1 Biotechnologie door dr. W. H. Mager Vakgroep Biochemie en Moleculaire Biologie Vrije Universiteit Amsterdam 1. Inleiding 113 3 2. Chemische structuur van erfelijke eigenschappen. Het DNA 113 4 3.

Nadere informatie

2. In 1978 werd in een wetenschappelijk artikel het volgende aangekondigd:

2. In 1978 werd in een wetenschappelijk artikel het volgende aangekondigd: 1.Een onderzoeker wil een DNA fragment in een plasmidc plakken. Welke van de onderstaande reactie mengsels zal een recombinant plasmide opleveren? a. Fragment geknipt met EcoRI plasmide geknipt met EcoRI,

Nadere informatie