Supplementary Figures for Sciuscio et al. Extent and Patterns of Promoter Methylation in Glioblastoma and Respective Derived Spheres What Matters?
Figure S1 2207 2288 2459 2540 2081 GBM GS GBM GS GBM GS GBM GS GBM GS U M U M U M U M U M U M U M U M U M U M 2669 2683 GBM GS GBM GS U M U M U M U M 2638 GBM GS U M U M 2108 GBM GS U M U M 1871 GBM GS U M U M
Figure S2 CpG 1 5 10 15 20 25 MS primers A B 1871 2108 GBM GS GBM GS C 2638 GBM GS D Cell lines LN18 LN229
Figure S3 A PBL 2558 2558* 2683 LN 229 LN18 H2O U M U M U M U M U M U M U M B CpG 1 5 10 15 20 25 MS primers GBM 2558
Figure S4 10 GS 2207 GS 2540 GS 2288 GS 2669 GS 2683 1 0 +1 1 0 +1 1 0 +1 1 0 +1 1 0 +1
Figure S5 2540 p53 A 2683 H&E C B GS nude mouse GS nude mouse D Human GBM
Figure S6 7.4 Log2_204880_at_ 7.2 7 6.8 6.6 6.4 6.2 6 5.8 5.6 5.4 Meth_ Unmeth_ Brain Glioblastoma
Table S1 Gene/application Forward primer Reverse primer Amplicon Anealing Temp. NOTES /MSP 1 st step GGATATGTTGGGATAGTT CCAAAAACCCCAAACCC 289 bp 52 C Palmisano WA et al. Cancer Res 2000; 60: 5954 8. /MSP 2 nd step (meth) TTTCGACGTTCGTAGGTTT TCGC GCACTCTTCCGAAAACGAA ACG 81 bp 62 C Esteller M et al. N Engl J Med 2000; 343: 1350 4. /MSP 2 nd step (unmeth) TTTGTGTTTTGATGTTTGT AGGTTTTTGT AACTCCACACTCTTCCAAAA ACAAAACA 93 bp 62 C Esteller et al. N Engl J Med 2000; 343: 1350 4. /q MSP AGCGATGCGTTCGAGCAT CGCUTTTCGACGTTCGTAG GTTTTCGC CTCGAAACTACCACCGTCC CGA 136 bp 62 C Vlassenbroeck et al. J Mol Diagn 2008; 10: 332 7. ACTB /q MSP AGCGATGCGTTCGAGCAT CGCUTAGGGAGTATATAG GTTGGGGAAGTT AACACACAATAACAAACAC AAATTCAC 125 bp 62 C Vlassenbroeck et al. J Mol Diagn 2008; 10: 332 7. /q RT PCR CAC CGT TTG CGA CTT GGT ACT T AGA CCC TGC TCA CAA CCA GAC A 110 bp 60 C Rood et al. Neuro Oncol 2004; 6: 200 7. GAPDH /q RT PCR AGG TGA AGG TCG GAG TCA ACG CGT TCT CAG CCT TGA CGG TG 186 bp 60 C Andreeff et al. Leukemia 2008; 22: 2041 7. /q ChIP AAA AGG TAC GGG CCA TTT G CAG TCT GCG CAT CCT CG 171 bp 60 C Ji et al. Carcinogenesis 2008; 29: 1267 75. GAPDH /q ChIP TACTAGCGGTTTTACGGGC G TCGAACAGGAGGAGCAGA GAGCGA 166 bp 60 C EZ ChIP, Chromatin Immunoprecipitation Kit. Uspstate (Millipore), Billerica, MA MYOD1 /q ChIP CCGCCTGAGCAAAGTAAA TGA GGCAACCGCTGGTTTGG 75 bp 60 C Taniguchi H et al. J Pathol 2007; 213: 131 9.
Supplementary Information Sciuscio et al. Legends for Supplementary Figures Figure S1. Methylation Specific PCR Methylation specific PCR (MSP) on glioblastoma derived sphere (GS) fractions and respective parental tumor tissues (GBM). U, unmethylated; M, methylated. Of note, the weak unmethylated bands obtained by MSP in the samples GS_2288 and GS_2207 are in apparent contradiction to the MS-clone sequencing as shown in Fig. 1. This is likely due to the primer location. Looking at the methylation pattern (MS_clone sequencing, Fig. 1) it is evident that the MSP primers are interrogating a less densely methylated region that with some infidelity of the assay will give rise to some amplification even if not all CpGs are unmethylated. Due to the relatively low number of clones analyzed we did not detect these rarely methylated/unmethylated alleles. Conversely the amplifying power of the PCR is able to reveal also underrepresented populations of sparsely methylated/unmethylated alleles that presumably gave rise to this band. In contrast, the two bands present for GS_2683, are in agreement with clone sequencing and acgh that support the presence of a methylated and an unmethylated allele as discussed in the text. A full gel including positive and negative controls is shown in Figure S3. Figure S2. Methylation Specific Sequencing of the promoter Methylation specific sequencing (Sanger method) of paired samples of glioblastoma (GBM) and respective glioblastoma derived spheres (GS) reveals that the promoter is unmethylated (A, B and C). The glioblastoma cell lines LN18 and LN229 serve as negative and positive controls for methylation, respectively (D). The location of the CpGs interrogated by either gel based MSP (yellow/yellow) or qmsp (yellow/blue) are indicated. Black square, methylated CpG; white square, unmethylated CpG; green square, methylated and unmethylated CpG site; grey square, undetermined due to unreadable sequence. Figure S3. methylation pattern of glioblastoma 2558 (A) Methylation specific PCR (MSP) of GBM_2558. The detection of methylated is at the limit of detection using this qualitative MSP assay. Two out of four experiments yielded a visible band on a gel (marked with an arrow), two independent 1
Supplementary Information Sciuscio et al. experiments are shown here. The glioblastoma cell lines LN229 and LN18 with known methylation status are included as exclusively methylated or unmethylated controls, respectively (see also Fig. S2). PBL, peripheral blood lymphocytes (unmethylated); H 2 O, no template control. (U, unmethylated; M, methylated) (B) Methylation specific clone sequencing of GBM_2558 visualizes a relative low density methylation in a subpopulation of cells. The tumor content as estimated by H&E was 85%, but only 60% when considering CD68 immunostaining. Only FFPE tissue was available for this sample. The location of the CpGs interrogated by either gel based MSP (yellow/yellow) or qmsp (yellow/blue) are indicated. The pattern of methylation in the sample is in accordance with the difficulty to detect methylation by either MSP or qmsp in this sample. Black squares, methylated CpGs, white squares, unmethylated; grey squares undetermined due to unreadable sequence. Figure S4. ArrayCGH Representation of acgh data on chromosome 10 for selected glioblastoma derived spheres. The chromosomal location of the gene is indicated. The inserts show a magnification of the region with the 6 probes for. Deviation from the baseline (0) represents amplification (right shift, +1) or deletion (left shift, -1). Monosomy of chromosome 10 is detected in GS_2540, and GS_2669, exerts a deletion of 10pter to 10q22.2. The other GS display a normal chromosome 10 copy number. Figure S5. Characteristics of GS-induced intracranial tumors. The GS_2540 derived intracranial tumor that carries a p53-missense mutation (codon 248, CGG to TGG) was stained for p53 (A). The p53-positve tumor cells migrating along the corpus callosum to the opposite hemisphere demonstrate the highly invasive properties of these GS_2540 derived human tumor cells. (B) Higher magnification. (C) The hematoxilin and eosin stained intracranial tumor derived from GS_2683 displays an oligodendroglial component with the characteristic feature of cells displaying nuclear halo (fried egg appearance). This morphologic feature was also present in part of the patient s tumor (D) together with the classic chicken-wire pattern of the tumor vasculature, accordingly the patient s tumors had been classified as glioblastoma with an oligodendroglial component. 2
Supplementary Information Sciuscio et al. Figure S6. Differential expression in glioblastoma depending on status Box plot visualization of gene expression [log2] based on probe 204880_at [Affymetrix HG-133Plus2.0 GeneChips (Affymetrix, Santa Clara, CA)] in a cohort of glioblastoma patients for whom gene expression profiles have been reported previously (Murat et al. 2008). There is a significant difference of expression between methylated (n=43) and unmethylated (n=35) glioblastoma (p<0.002; Mann-Whitney test), and between non-neoplastic brain (n=4) and unmethylated glioblastoma (p=0.025), but not between unmethylated cases and brain tissue (p=0.5). 3