Meeloopdag 12 maart 2015 Hoorcollege DNA. Dr. Martijn Hoeke Docent Moleculaire Biologie
|
|
|
- Tessa van der Pol
- 8 jaren geleden
- Aantal bezoeken:
Transcriptie
1 Meeloopdag 12 maart 2015 Hoorcollege DNA Dr. Martijn Hoeke Docent Moleculaire Biologie
2 Beta-vakken op de middelbare school Natuurkunde Wiskunde/Informatica Scheikunde Biologie
3 Natuurwetenschappen zijn geen gescheiden disciplines Natuurkunde Wiskunde/Informatica Scheikunde Biologie
4 Natuurwetenschappen op HBO en universiteit Natuurkunde Fysische chemie Wiskunde/Informatica Biofysica BIO-INFORMATICA Scheikunde BIOCHEMIE/ MOLECULAIRE BIOLOGIE Biologie
5 Natuurwetenschappen op HBO en universiteit Natuurkunde Fysische chemie Wiskunde/Informatica Biofysica BIO-INFORMATICA Scheikunde BIOCHEMIE/ MOLECULAIRE BIOLOGIE Biologie LIFE SCIENCES
6 What is Molecular Biology? Study of biology at the molecular level Interactions between components of the cell On the border between alive and lifeless
7 Biologie & Medisch Laboratoriumonderzoek Biotechnologie
8 Wat weten jullie al van moleculaire biologie? Nulmeting
9 shakeq.com Interactie gedurende hoorcollege Evaluatie hoorcollege achteraf
10 Oefenvraag: Ik zit momenteel in A. HAVO-4 B. HAVO-5 C. VWO-5 D. VWO-6 E. MBO-niveau 4 F. Anders Stemmen: 0 Gesloten Internet Ga naar shakeq.com en log in met wur1086 Deze presentatie is geladen zonder de Shakespeak Add-In. SMS Stuur naar : wur1086 <spatie> uw keuze (bv. wur1086 b) Add-In gratis downloaden? Ga naar
11 Oefenvraag: Ik zit momenteel in A. HAVO-4 Deze voorbeeld resultaten zullen op 0 gezet worden zodra een sessie en diavoorstelling gestart zijn. 16,7% B. C. D. E. F. HAVO-5 VWO-5 VWO-6 MBO-niveau 4 Anders 33,3% Voel u vrij om ondertussen de layout van de resultaten te veranderen (bv. de kleur) 50,0% 66,7% 83,3% 100,0% Gesloten Internet Ga naar shakeq.com en log in met wur1086 Deze presentatie is geladen zonder de Shakespeak Add-In. SMS Stuur naar : wur1086 <spatie> uw keuze (bv. wur1086 b) Add-In gratis downloaden? Ga naar
12 1) Tomaten bevatten tegenwoordig allemaal DNA A. Dat klopt, vroeger kon het kweken gerust zonder B. Dat klopt niet, in tomaten zit geen DNA C. DNA heeft altijd al in tomaten gezeten D. Niet de tomaten maar het ongedierte bevat DNA Stemmen: 0 Gesloten Internet Ga naar shakeq.com en log in met wur1086 Deze presentatie is geladen zonder de Shakespeak Add-In. SMS Stuur naar : wur1086 <spatie> uw keuze (bv. wur1086 b) Add-In gratis downloaden? Ga naar
13 2) DNA vind je bij de mens: A. Alleen in de celkern B. Alleen buiten de celkern C. In de celkern en in mitochondriën D. In de celkern en in peroxisomen E. Geen van alle, een menselijke cel heeft geen celkern Stemmen: 0 Gesloten Internet Ga naar shakeq.com en log in met wur1086 Deze presentatie is geladen zonder de Shakespeak Add-In. SMS Stuur naar : wur1086 <spatie> uw keuze (bv. wur1086 b) Add-In gratis downloaden? Ga naar
14 3) De mens bevat DNA. Wij bestaan uit miljarden cellen. Wat is de lengte van het DNA in 1 cel? A. 2 nm (0, mm) B. 2 μm (0,002 mm) C. 2 mm D. 2 cm E. 2 m PS. Een cel heeft een diameter van ca. 20 µm (0,02 mm) Stemmen: 0 Gesloten Internet Ga naar shakeq.com en log in met wur1086 Deze presentatie is geladen zonder de Shakespeak Add-In. SMS Stuur naar : wur1086 <spatie> uw keuze (bv. wur1086 b) Add-In gratis downloaden? Ga naar
15 4) Hoeveel genen heeft de mens? A. ± B. ± C. ± D. ± E. ± 5000 Stemmen: 0 Gesloten Internet Ga naar shakeq.com en log in met wur1086 Deze presentatie is geladen zonder de Shakespeak Add-In. SMS Stuur naar : wur1086 <spatie> uw keuze (bv. wur1086 b) Add-In gratis downloaden? Ga naar
16 5) Hoeveel % van het DNA van de mens wordt in beslag genomen door (eiwit coderende sequenties van)genen? A. ± 98% B. ± 87% C. ± 49% D. ± 21% E. ± 2% Stemmen: 0 Gesloten Internet Ga naar shakeq.com en log in met wur1086 Deze presentatie is geladen zonder de Shakespeak Add-In. SMS Stuur naar : wur1086 <spatie> uw keuze (bv. wur1086 b) Add-In gratis downloaden? Ga naar
17 6) Kunnen we DNA maken in een reageerbuis, zonder daarbij gebruik te maken van een levende cel? A. Nee, dat is science fiction alleen een levende cel kan DNA maken B. Nee, ook een cel maakt geen nieuw DNA, het wordt enkel doorgegeven C. Ja, dat kan sinds 1983 D. Nog niet, maar we zijn er bijna Stemmen: 0 Gesloten Internet Ga naar shakeq.com en log in met wur1086 Deze presentatie is geladen zonder de Shakespeak Add-In. SMS Stuur naar : wur1086 <spatie> uw keuze (bv. wur1086 b) Add-In gratis downloaden? Ga naar
18 Einde Nulmeting Het stemmen is voorbij Telefoons weer uit/stil We gaan beginnen met het hoorcollege Uitslagen later in dit hoorcollege
19 Molecular biology in a nutshell... Figure 1-2 Essential Cell Biology ( Garland Science 2010) 20
20 1) Tomaten bevatten tegenwoordig allemaal DNA A. B. Dat klopt, vroeger kon het kweken gerust zonder Dat klopt niet, in tomaten zit geen DNA Deze voorbeeld resultaten zullen op 0 gezet worden zodra een sessie en diavoorstelling gestart zijn. 25,0% Voel u vrij om ondertussen de layout van de resultaten te veranderen (bv. de kleur) 50,0% C. DNA heeft altijd al in tomaten gezeten 75,0% D. Niet de tomaten maar het ongedierte bevat DNA 100,0% Gesloten
21 The eukaryotic cell Figure 1-24 Essential Cell Biology ( Garland Science 2010)
22 The nucleus Figure 1-16 Essential Cell Biology ( Garland Science 2010) Figure 1-15 Essential Cell Biology ( Garland Science 2010)
23 Mitochondria and chloroplasts evolved from bacteria Figure 1-29 Essential Cell Biology ( Garland Science 2010)
24 Mitochondria and chloroplasts evolved from bacteria Figure 1-19 Essential Cell Biology ( Garland Science 2010) Figure 1-21 Essential Cell Biology ( Garland Science 2010)
25 Mitochondria and chloroplasts replicate independently of cell Have their own genome During evolution most genes moved to nuclear genome Figure 1-18 Essential Cell Biology ( Garland Science 2010) Figure 1-20 Essential Cell Biology ( Garland Science 2010)
26 2) DNA vind je bij de mens: A. B. Alleen in de celkern Alleen buiten de celkern Deze voorbeeld resultaten zullen op 0 gezet worden zodra een sessie en diavoorstelling gestart zijn. 20,0% Voel u vrij om ondertussen de layout van de resultaten te veranderen (bv. de kleur) 40,0% C. In de celkern en in mitochondriën 60,0% D. In de celkern en in peroxisomen 80,0% E. Geen van alle, een menselijke cel heeft geen celkern 100,0% Gesloten
27 The DNA backbone consists of sugar and phosphate Note: the DNA-molecule has a negative charge
28 DNA forms a double helix Nobel Price in Physiology or Medicine 1962 Discovery of the DNA double helix ( ) Francis Crick (1928-now) James Watson The figure in the 1953 paper by Watson and Crick in Nature that shows their double helix model for DNA for the first time. Reproduced from Watson, J. D., and Crick, F. H. C. Nature 171 (1953):
29 DNA has a 5 - and 3 -end 5 -end 3 -end 3 -end 5 -end
30 Base paring occurs between A-T and C-G through hydrogen bonds
31 DNA double helix is wrapped around histones; nucleosomes Figure 5-22 (part 1 of 2) Essential Cell Biology ( Garland Science 2010)
32 Nucleosomes fold together to form 30-nm fibers Experimental data support the zigzag model Zigzag Model Solenoid Model Adopted from Khorasanizadeh, S., Cell 116 (2004):
33 Chromatin 30 nm thick Unpacked chromatin fibre, showing the nucleosomes Figure 5-21 Essential Cell Biology ( Garland Science 2010)
34 Overview DNA structure Figure 5-25 Essential Cell Biology ( Garland Science 2010) Figure 5-17 Essential Cell Biology ( Garland Science 2010)
35 2 meters of DNA is compacted into a cell nucleus
36 3) De mens bevat DNA. Wij bestaan uit miljarden cellen. Wat is de lengte van het DNA in 1 cel? A. B. 2 nm (0, mm) 2 μm (0,002 mm) Deze voorbeeld resultaten zullen op 0 gezet worden zodra een sessie en diavoorstelling gestart zijn. 20,0% Voel u vrij om ondertussen de layout van de resultaten te veranderen (bv. de kleur) 40,0% C. 2 mm 60,0% D. 2 cm 80,0% E. 2 m 100,0% Gesloten
37 What is a gene? Molecular unit of heredity Codes for a protein or RNA that has a function in a living organism
38
39 4) Hoeveel genen heeft de mens? A. B. ± ± Deze voorbeeld resultaten zullen op 0 gezet worden zodra een sessie en diavoorstelling gestart zijn. 20,0% Voel u vrij om ondertussen de layout van de resultaten te veranderen (bv. de kleur) 40,0% C. ± ,0% D. ± ,0% E. ± ,0% Gesloten
40 How does a gene encode information? The GENETIC CODE
41 The genetic code of DNA cracked ( ) The four letter alphabet of DNA (a gene): ATGCAGTCGTCGAAGGCTCAAAGTGTG Forms three letter words (codons): ATG CAG TCG TCG AAG GCT CAA AGT GTG Each sentence forms a protein; each word is a building block of a protein: M Q S S K A Q S V
42 The same amino acid can be coded by multiple codons Which nucleotides in a codon are the most important for amino acid coding? Figure 7-24 Essential Cell Biology ( Garland Science 2010) 43
43 Figure 1.21: Simplified schematic diagram of the protein synthetic machinery in an animal, plant, or yeast cell. Adopted from Secko, D., The Science Creative Quarterly 2 (2007).
44 Ribosomes in an eukaryotic cell ER = Endoplasmic Reticulum Cytoplasm Mitochondria have their own ribosomes and trna Figure 7-30 Essential Cell Biology ( Garland Science 2010) 45
45 Our genome codes for...
46 5) Hoeveel % van het DNA van de mens wordt in beslag genomen door (eiwit coderende sequenties van)genen? A. B. ± 98% ± 87% Deze voorbeeld resultaten zullen op 0 gezet worden zodra een sessie en diavoorstelling gestart zijn. 20,0% Voel u vrij om ondertussen de layout van de resultaten te veranderen (bv. de kleur) 40,0% C. ± 49% 60,0% D. ± 21% 80,0% E. ± 2% 100,0% Gesloten
47 Questions... On with replication!
48 DNA-replication occurs semi-conservative Figure 6-6 Essential Cell Biology ( Garland Science 2010)
49 DNA elongation only at 3 -end Figure 6-2 Essential Cell Biology ( Garland Science 2010)
50 Polymerase chain reaction; DNA replication in vitro Technique to amplify/replicate specific DNAfragments Developed in 1983 by Kary Mullis Most important technique in biotechnology Mullis was awarded the Noble Prize in 1993
51 6) Kunnen we DNA maken in een reageerbuis, zonder daarbij gebruik te maken van een levende cel? A. Nee, dat is science fiction... Deze voorbeeld resultaten zullen op 0 gezet worden zodra een sessie en diavoorstelling gestart zijn. 25,0% Voel u vrij om ondertussen de layout van de resultaten te veranderen (bv. de kleur) B. Nee, ook een cel maakt geen nieuw DNA, het wordt enkel doorgegeven 50,0% C. Ja, dat kan sinds ,0% D. Nog niet, maar we zijn er bijna 100,0% Gesloten
52 Polymerase chain reaction Denaturing: 95⁰C Figure Essential Cell Biology ( Garland Science 2010) Hybridisation: 55⁰C - 65⁰C (depending on primer sequences) Elongation: 72⁰C
53 Polymerase chain reaction Figure Essential Cell Biology ( Garland Science 2010)
54 PCR-video
55 PCR requires Template DNA Primers dntps (datp + dgtp + dttp + dctp) Taq polymerase Buffer (including MgCl 2 )
56 Automated thermocyclers
57 DNA gel electroforesis Figure 10-3 Essential Cell Biology ( Garland Science 2010)
58 Zelf aan de slag met DNA en PCR? Jaar 1: primerset ontwerpen en testen voor: Geslachtbepaling M/V Paarden/Runder vlees? Bacterie/Schimmel Jaar 2: knippen en plakken met DNA Jaar 3: DNA database; Gene Hunting Kloneren, GFP-fusie-eiwit maken
59 GFP fusion expression vectors; used to locate proteins in the cell Enhanced Green Fluorescent Protein (EGFP)
60 Histone labeled with GFP Neurospora crassa = schimmel
61 Martijn LS&T Leeuwarden LS&T Leeuwarden Thank you for your attention! Follow me on YouTube, Twitter and martijnhoeke.nl Agora CJ Leeuwarden T 0031 (0) mail@lstleeuwarden.nl
We gaan stemmen, pak uw telefoon!
www.sendsteps.com We gaan stemmen, pak uw telefoon! SMS 1 2 SMS naar 2255 Typ Antwoord uw keuze (bv. Antwoord b) Internet 1 2 Ga naar sendc.com Log in met Antwoord Stemmen is anoniem Geen extra
Genetic code. Assignment
Genetic code The genetic code consists of a number of lines that determine how living cells translate the information coded in genetic material (DNA or RNA sequences) to proteins (amino acid sequences).
SAMPLE 11 = + 11 = + + Exploring Combinations of Ten + + = = + + = + = = + = = 11. Step Up. Step Ahead
7.1 Exploring Combinations of Ten Look at these cubes. 2. Color some of the cubes to make three parts. Then write a matching sentence. 10 What addition sentence matches the picture? How else could you
Internet 1 SMS 1. Ga naar sendc.com Log in met Scherm. SMS naar 2255 Typ Scherm <spatie> uw keuze (bv. Scherm b) Geen extra kosten per bericht
Internet 1 2 Ga naar sendc.com Log in met Scherm SMS 1 2 SMS naar 2255 Typ Scherm uw keuze (bv. Scherm b) Geen extra kosten per bericht De vraag gaat open zodra u een sessie en diavoorstelling
HANDLEIDING VOOR DOCENTEN Versie september 2011
HANDLEIDING VOOR DOCENTEN Versie september 2011 DNAbAND is aanvankelijk ontwikkeld voor 1 e jaars modules moleculaire biologie binnen de unit Life Sciences and Technology, een samenwerking tussen Hogeschool
Plek voor sport? Ineke Deelen, Nynke Burgers en Marijke Jansen. Universiteit Utrecht Faculteit Geowetenschappen Sociale Geografie en Planologie
Plek voor sport? Ineke Deelen, Nynke Burgers en Marijke Jansen Universiteit Utrecht Faculteit Geowetenschappen Sociale Geografie en Planologie KNAG onderwijsdag Almere, 7 november 2014 Aanleiding geografisch
FRAME [UPRIGHT MODEL] / [DEPTH] / [HEIGHT] / [FINISH] TYPE OF BASEPLATE P Base plate BP80 / E alternatives: ZINC finish in all cases
![FRAME [UPRIGHT MODEL] / [DEPTH] / [HEIGHT] / [FINISH] TYPE OF BASEPLATE P Base plate BP80 / E alternatives: ZINC finish in all cases](/thumbs/60/44127117.jpg "FRAME [UPRIGHT MODEL] / [DEPTH] / [HEIGHT] / [FINISH] TYPE OF BASEPLATE P Base plate BP80 / E alternatives: ZINC finish in all cases")
FRAME XS UPRIGHT BASE PLATE UPRIGHT HORIZONTAL PROFILE DIAGONAL PROFILE DESCRIPTION A vertical structure consisting of 2 uprights, joined by a system of bracing profiles, and base plates intended to support
Ik, wij en zij in de transitie. Congres Jeugdzorg 2015 Ben Kuipers
Ik, wij en zij in de transitie Congres Jeugdzorg 2015 Ben Kuipers www.shakespeak.com We gaan stemmen Internet 1 2 SMS 1 Deze presentatie is geladen zonder de Shakespeak Add-In. Add-In gratis downloaden?
Hoe ontmoet je goede meerkeuzevragen? Susan Voogd en Marit Praagman
Hoe ontmoet je goede meerkeuzevragen? Susan Voogd en Marit Praagman Workshopdoelen De deelnemer: Herkent toetstechnische fouten (F) Kan een aantal specifieke vuistregels voor het samenstellen van meerkeuzevragen
Global TV Canada s Pulse 2011
Global TV Canada s Pulse 2011 Winnipeg Nobody s Unpredictable Methodology These are the findings of an Ipsos Reid poll conducted between August 26 to September 1, 2011 on behalf of Global Television. For
DNA practicum De modellenwereld van DNA
DNA practicum De modellenwereld van DNA Inleiding Alle eigenschappen van een plant, zoals de grootte, de vorm van het blad, en de enzymen die nodig zijn voor de fotosynthese, liggen opgeslagen in het DNA.
Houdt u er alstublieft rekening mee dat het 5 werkdagen kan duren voordat uw taalniveau beoordeeld is.
- Instructie Deze toets heeft als doel uw taalniveau te bepalen. Om een realistisch beeld te krijgen van uw niveau,vragen we u niet langer dan één uur te besteden aan de toets. De toets bestaat uit twee
1. Welk van de onderstaande DNA sequenties zijn mogelijke herkenning-sites voor restrictie-enzymen? c 5' GAATTC 3' c 5' GGGGCCCC 3' c 5' CTGCAG 3' 5'
proefexamen 1. Welk van de onderstaande DNA sequenties zijn mogelijke herkenning-sites voor restrictie-enzymen? c 5' GAATTC 3' c 5' GGGGCCCC 3' c 5' CTGCAG 3' 5' CTAAATC 3' 5' GGAACC 3' Restriction Endonucleases
Keuzetwijfels in de Emerging Adulthood rondom Studie- en Partnerkeuze. in Relatie tot Depressie
1 Keuzetwijfels in de Keuzetwijfels in de Emerging Adulthood rondom Studie- en Partnerkeuze in Relatie tot Depressie Open Universiteit Nederland Masterscriptie (S58337) Naam: Ilse Meijer Datum: juli 2011
After that, the digits are written after each other: first the row numbers, followed by the column numbers.
Bifid cipher The bifid cipher is one of the classical cipher techniques that can also easily be executed by hand. The technique was invented around 1901 by amateur cryptographer Felix Delastelle. The cipher
FOR DUTCH STUDENTS! ENGLISH VERSION NEXT PAGE. Toets Inleiding Kansrekening 1 8 februari 2010
FOR DUTCH STUDENTS! ENGLISH VERSION NEXT PAGE Toets Inleiding Kansrekening 1 8 februari 2010 Voeg aan het antwoord van een opgave altijd het bewijs, de berekening of de argumentatie toe. Als je een onderdeel
Chapter 4 Understanding Families. In this chapter, you will learn
Chapter 4 Understanding Families In this chapter, you will learn Topic 4-1 What Is a Family? In this topic, you will learn about the factors that make the family such an important unit, as well as Roles
Meetkunde en Lineaire Algebra
Hoofdstuk 1 Meetkunde en Lineaire Algebra Vraag 1.1 Het trapoppervlak is een afwikkelbaar oppervlak met oneindig veel singuliere punten. Vraag 1.2 Het schroefoppervlak is een afwikkelbaar oppervlak met
Disclosure belangen spreker
Disclosure belangen spreker (potentiële) belangenverstrengeling Geen / Zie hieronder Voor bijeenkomst mogelijk relevante relaties met bedrijven Sponsoring of onderzoeksgeld Honorarium of andere (financiële)
een kopie van je paspoort, een kopie van je diploma voortgezet onderwijs (hoogst genoten opleiding), twee pasfoto s, naam op de achterkant
Vragenlijst in te vullen en op te sturen voor de meeloopochtend, KABK afdeling fotografie Questionnaire to be filled in and send in before the introduction morning, KABK department of Photography Stuur
2019 SUNEXCHANGE USER GUIDE LAST UPDATED
2019 SUNEXCHANGE USER GUIDE LAST UPDATED 0 - -19 1 WELCOME TO SUNEX DISTRIBUTOR PORTAL This user manual will cover all the screens and functions of our site. MAIN SCREEN: Welcome message. 2 LOGIN SCREEN:
Curves. Tjitske Faber 25 oktober 2016
Curves Tjitske Faber 25 oktober 2016 We gaan stemmen Internet 1 Ga naar shakeq.com 2 Log in met Free5879 Deze presentatie is geladen zonder de Shakespeak Add-In. Add-In gratis downloaden? Ga naar http://shakespeak.com/en/free-download/
Predicting peptide interactions using protein building blocks
Faculty of Science and Bio-engineering Sciences Department of Bio-engineering Sciences Predicting peptide interactions using protein building blocks Thesis submitted in partial fulfilment of the requirements
1. In welk deel van de wereld ligt Nederland? 2. Wat betekent Nederland?
First part of the Inburgering examination - the KNS-test Of course, the questions in this exam you will hear in Dutch and you have to answer in Dutch. Solutions and English version on last page 1. In welk
Installatie van Windows 10 op laptops. Windows 10 installation on laptops
Installatie van Windows 10 op laptops In mei vindt de migratie naar Windows 10 plaats op de laptops. Per dag worden ongeveer 25 laptops gemigreerd. Elke laptop heeft een ISSC-sticker met een laptop-nummer.
S e v e n P h o t o s f o r O A S E. K r i j n d e K o n i n g
S e v e n P h o t o s f o r O A S E K r i j n d e K o n i n g Even with the most fundamental of truths, we can have big questions. And especially truths that at first sight are concrete, tangible and proven
Value based healthcare door een quality improvement bril
Rotterdam, 7 december 2017 Value based healthcare door een quality improvement bril Ralph So, intensivist en medisch manager Kwaliteit, Veiligheid & Innovatie 16.35-17.00 uur Everybody in healthcare really
2. HOOFDSTUK 1 : Micro-organismen en Microbiologie. 1.2 Micro-organismen als cellen (Editie 10 = 1.2)
MICROBIOLOGIE - DEEL I - LES 1 Prof. Dr. ir. J. Swings «Biology of Microorganisms», 9de ed. (2000) LES 1 1. INLEIDING 2. HOOFDSTUK 1 : Micro-organismen en Microbiologie 1.2 Micro-organismen als cellen
The first line of the input contains an integer $t \in \mathbb{n}$. This is followed by $t$ lines of text. This text consists of:
Document properties Most word processors show some properties of the text in a document, such as the number of words or the number of letters in that document. Write a program that can determine some of
Travel Survey Questionnaires
Travel Survey Questionnaires Prot of Rotterdam and TU Delft, 16 June, 2009 Introduction To improve the accessibility to the Rotterdam Port and the efficiency of the public transport systems at the Rotterdam
Leidt e-learning tot gedragsverandering bij studenten? - Tim Torsy Vera Balduyck Belinda Drieghe
Leidt e-learning tot gedragsverandering bij studenten? - Tim Torsy Vera Balduyck Belinda Drieghe HGZO Congres 2017 23 & 24 maart 2017 congreshotel De Werelt Lunteren INHOUD 1. Praktisch 2. Theoretische
Dutch survival kit. Vragen hoe het gaat en reactie Asking how it s going and reaction. Met elkaar kennismaken Getting to know each other
Dutch survival kit This Dutch survival kit contains phrases that can be helpful when living and working in the Netherlands. There is an overview of useful sentences and phrases in Dutch with an English
QUEEN S VALLEY SCHOOL QUEEN S VALLEY JUNIOR SCHOOL
INSTRUCTIONS FOR HOLIDAY HOMEWORK (CLASS VIII) Subject: CHEMISTRY 1. BIO GAS PLANT: Material required Clay, thermocol sheet, plastic straw, cardboard, pastel sheet, artificial hut, trees etc. Make a village
Ius Commune Training Programme 2015-2016 Amsterdam Masterclass 16 June 2016
www.iuscommune.eu Dear Ius Commune PhD researchers, You are kindly invited to attend the Ius Commune Amsterdam Masterclass for PhD researchers, which will take place on Thursday 16 June 2016. During this
Programmaoverzicht Bachelor Open dag
Programmaoverzicht Bachelor Open dag 11 2017 Ronde en tijd Openingsronde 09.00-09.30 uur Sessies en activiteiten Waarom Tilburg University? Informatiesessie met de rector magnificus en een student van
ANGSTSTOORNISSEN EN HYPOCHONDRIE: DIAGNOSTIEK EN BEHANDELING (DUTCH EDITION) FROM BOHN STAFLEU VAN LOGHUM
Read Online and Download Ebook ANGSTSTOORNISSEN EN HYPOCHONDRIE: DIAGNOSTIEK EN BEHANDELING (DUTCH EDITION) FROM BOHN STAFLEU VAN LOGHUM DOWNLOAD EBOOK : ANGSTSTOORNISSEN EN HYPOCHONDRIE: DIAGNOSTIEK STAFLEU
Opgave 2 Geef een korte uitleg van elk van de volgende concepten: De Yield-to-Maturity of a coupon bond.
Opgaven in Nederlands. Alle opgaven hebben gelijk gewicht. Opgave 1 Gegeven is een kasstroom x = (x 0, x 1,, x n ). Veronderstel dat de contante waarde van deze kasstroom gegeven wordt door P. De bijbehorende
Chemistry at Rotterdam University of Applied Science. Dr. C.B. Minkenberg and Dr. H. Hijnen Senior lecturers and researchers
Chemistry at Rotterdam University of Applied Science Dr. C.B. Minkenberg and Dr. H. Hijnen Senior lecturers and researchers 1 ROTTERDAM UNIVERSITY Organisation: Faculty of Engineering and Applied Science
Classification of triangles
Classification of triangles A triangle is a geometrical shape that is formed when 3 non-collinear points are joined. The joining line segments are the sides of the triangle. The angles in between the sides
Demultiplexing reads FASTA format genome sequencing reads run
Demultiplexing reads In bioinformatics, FASTA format is a text-based format for representing either nucleotide sequences or peptide sequences, in which nucleotides or amino acids are represented using
Meetkunde en Lineaire Algebra
Hoofdstuk 1 Meetkunde en Lineaire Algebra Vraag 1.1 Het trapoppervlak is een afwikkelbaar oppervlak met oneindig veel singuliere punten. vals Vraag 1.2 Het schroefoppervlak is een afwikkelbaar oppervlak
Bijlage 2: Informatie met betrekking tot goede praktijkvoorbeelden in Londen, het Verenigd Koninkrijk en Queensland
Bijlage 2: Informatie met betrekking tot goede praktijkvoorbeelden in Londen, het Verenigd Koninkrijk en Queensland 1. Londen In Londen kunnen gebruikers van een scootmobiel contact opnemen met een dienst
Programma Open dag zaterdag 28 februari 2015 Program Open Day Saturday 28 February 2015
Programma Open dag zaterdag 28 februari 2015 Program Open Day Saturday 28 February 2015 Tijd 09.15 09.45 Je bent op de Open dag, wat nu? Personal welcome international visitors 10.00 10.45 Je bent op de
TOEGANG VOOR NL / ENTRANCE FOR DUTCH : https://www.stofs.co.uk/en/register/live/?regu lator=c&camp=24759
DISCLAIMER : 1. Het is een risicovolle belegging / It is an investment with risc. 2. Gebruik enkel geld dat u kan missen / Only invest money you can miss. 3. Gebruik de juiste procedure / Use the correct
E-health: hoe ziet de toekomst er uit? Verkennen van toekomstscenario s
E-health: hoe ziet de toekomst er uit? Verkennen van toekomstscenario s Jentien Brinkhuis & Boy Zwartjes (Progez & Caransscoop) Progez en Caransscoop vormen samen Proscoop jbrinkhuis@progez.nl bzwartjes@caransscoop.nl
Engels op Niveau A2 Workshops Woordkennis 1
A2 Workshops Woordkennis 1 A2 Workshops Woordkennis 1 A2 Woordkennis 1 Bestuderen Hoe leer je 2000 woorden? Als je een nieuwe taal wilt spreken en schrijven, heb je vooral veel nieuwe woorden nodig. Je
ICARUS Illumina E653BK on Windows 8 (upgraded) how to install USB drivers
ICARUS Illumina E653BK on Windows 8 (upgraded) how to install USB drivers English Instructions Windows 8 out-of-the-box supports the ICARUS Illumina (E653) e-reader. However, when users upgrade their Windows
Agri, Food & Life Science People Plants Possibilities
Agri, Food & Life Science People Plants Possibilities 20 mei 2015 dr. C.M. Kreike Inhoud Lectoraat Green Biotechnology People Plants Possibilities Toekomst Lectoraat Green Biotechnology Missie: Het verstevigen
ETS 4.1 Beveiliging & ETS app concept
ETS 4.1 Beveiliging & ETS app concept 7 juni 2012 KNX Professionals bijeenkomst Nieuwegein Annemieke van Dorland KNX trainingscentrum ABB Ede (in collaboration with KNX Association) 12/06/12 Folie 1 ETS
The mitochondrial genome has bases and codes for 37 genes: 13 polypeptides, 22 trnas and 2 ribosomal RNAs.
Genome density The genome of an organism is the whole of hereditary infromation in a cell. This hereditary information is either coded in DNA or for some types of viruses in RNA. Genes are structural components
Samen verantwoordelijk
Samen verantwoordelijk Onderzoek in de geboortezorgketen: overdracht en registratie Cherelle van Stenus Ariana Need Magda Boere-Boonekamp 15-05-2014 1 Onderzoeksproject April 2014 begonnen met fase 1:
Yes/No (if not you pay an additional EUR 75 fee to be a member in 2020
Meedoen aan dit evenement? Meld je eenvoudig aan Ben je lid? Ja/Nee Do you want to participate? Please apply Are you a LRCH member? Yes/No (if not you pay an additional EUR 75 fee to be a member in 2020
Handleiding Zuludesk Parent
Handleiding Zuludesk Parent Handleiding Zuludesk Parent Met Zuludesk Parent kunt u buiten schooltijden de ipad van uw kind beheren. Hieronder vind u een korte handleiding met de mogelijkheden. Gebruik
My Inspiration I got my inspiration from a lamp that I already had made 2 years ago. The lamp is the you can see on the right.
Mijn Inspiratie Ik kreeg het idee om een variant te maken van een lamp die ik al eerder had gemaakt. Bij de lamp die in de onderstaande foto s is afgebeeld kun je het licht dimmen door de lamellen open
UNECE/UNESCAP Workshop on. Electronic Trade Documents. Ulaanbaatar, Mongolia, October 2009
/UNESCAP Workshop on Electronic Trade Documents Ulaanbaatar, Mongolia, October 2009 Presentation Need for digital paper documents Developing Electronic documents for SW Using Digital Paper in Supply Chains
In te vullen door Gemeente/ To be filled out by Municipality
In te vullen door Gemeente/ To be filled out by Municipality Datum: Bijzonderheden: Gegevens opgevraagd (laatste) gemeente BQ11 bericht BV BSN Particulier Expat Student Volgnummer: Persoonsgegevens / Personal
(1) De hoofdfunctie van ons gezelschap is het aanbieden van onderwijs. (2) Ons gezelschap is er om kunsteducatie te verbeteren
(1) De hoofdfunctie van ons gezelschap is het aanbieden van onderwijs (2) Ons gezelschap is er om kunsteducatie te verbeteren (3) Ons gezelschap helpt gemeenschappen te vormen en te binden (4) De producties
Het menselijk genoom. Inleiding Medisch Technische Wetenschappen. Bioinformatica Deel 2. Gevouwen chromosoom. X chromosoom DNA.
Het menselijk genoom Het menselijk genoom (DN) bestaat uit: Mega Basenparen (MB),,, C,. Inleiding Medisch echnische Wetenschappen Bioinformatica Deel Michael Egmont-Petersen Het menselijk DN is ingedeeld
Introductie in flowcharts
Introductie in flowcharts Flow Charts Een flow chart kan gebruikt worden om: Processen definieren en analyseren. Een beeld vormen van een proces voor analyse, discussie of communicatie. Het definieren,
In te vullen door Gemeente/ To be filled out by Municipality
In te vullen door Gemeente/ To be filled out by Municipality Datum: Bijzonderheden: Gegevens opgevraagd (laatste) gemeente BQ11 bericht BV BSN Particulier Expat Student Volgnummer: Persoonsgegevens / Personal
Cambridge Assessment International Education Cambridge International General Certificate of Secondary Education. Published
Cambridge Assessment International Education Cambridge International General Certificate of Secondary Education DUTCH 055/02 Paper 2 Reading MARK SCHEME Maximum Mark: 45 Published This mark scheme is published
Desoxyribose heeft 5 C-atomen. De fosfaatgroep zit aan het 5e C-atoom en de stikstofbase aan het 1e C-atoom.
Desoxyribose heeft 5 C-atomen. De fosfaatgroep zit aan het 5e C-atoom en de stikstofbase aan het 1e C-atoom. Afbeelding 2. DNA-nucleotide.1 Bij het aan elkaar koppelen van nucleotiden gaat het 3e C-atoom
Proteomics. Waarom DNA alleen niet genoeg is
Proteomics Waarom DNA alleen niet genoeg is Reinout Raijmakers Netherlands Proteomics Centre Universiteit Utrecht, Biomolecular Mass Spectrometry and Proteomics Group Van DNA naar organisme Eiwitten zijn
RECEPTEERKUNDE: PRODUCTZORG EN BEREIDING VAN GENEESMIDDELEN (DUTCH EDITION) FROM BOHN STAFLEU VAN LOGHUM
Read Online and Download Ebook RECEPTEERKUNDE: PRODUCTZORG EN BEREIDING VAN GENEESMIDDELEN (DUTCH EDITION) FROM BOHN STAFLEU VAN LOGHUM DOWNLOAD EBOOK : RECEPTEERKUNDE: PRODUCTZORG EN BEREIDING VAN STAFLEU
Interface tussen Stuurbediening en Sony autoaudio
The information in this document is in Dutch, English version follows later in this document Interface tussen Stuurbediening en Sony autoaudio LET OP! HOEWEL DE UITERSTE ZORGVULDIGHEID IS BETRACHT BIJ
Onderstaand is een stukje peptide getoond dat deel uit maakt van een groter eiwit en de naam draagt van een lokaal beroemde biochemicus:
1 Onderstaand is een stukje peptide getoond dat deel uit maakt van een groter eiwit en de naam draagt van een lokaal beroemde biochemicus: a. Geef de 1-lettercode van de 6 uitgeschreven aminozuren in de
Ontwerpen van een variabele belasting om te meten aan zonnepanelen
Assignment IWP Energy Transition September 2018 Project Title Ontwerpen van een variabele belasting om te meten aan zonnepanelen Brief description of the problem Zonnepanelen produceren stroom als er (zon)licht
Persoonlijke informatie / Personal information
LOB-cv Answers Persoonlijke informatie / Personal information Naam / Name Place of residence Woonplaats Country of residence School / School Nationaliteit / Nationality Geboortedatum / Date-of-birth Place-of-birth
Het Verband Tussen Persoonlijkheid, Stress en Coping. The Relation Between Personality, Stress and Coping
Het Verband Tussen Persoonlijkheid, Stress en Coping The Relation Between Personality, Stress and Coping J.R.M. de Vos Oktober 2009 1e begeleider: Mw. Dr. T. Houtmans 2e begeleider: Mw. Dr. K. Proost Faculteit
Four-card problem. Input
Four-card problem The four-card problem (also known as the Wason selection task) is a logic puzzle devised by Peter Cathcart Wason in 1966. It is one of the most famous tasks in the study of deductive
OUTDOOR HD BULLET IP CAMERA PRODUCT MANUAL
OUTDOOR HD BULLET IP CAMERA PRODUCT MANUAL GB - NL GB PARTS & FUNCTIONS 1. 7. ---- 3. ---- 4. ---------- 6. 5. 2. ---- 1. Outdoor IP camera unit 2. Antenna 3. Mounting bracket 4. Network connection 5.
AE1103 Statics. 25 January h h. Answer sheets. Last name and initials:
Space above not to be filled in by the student AE1103 Statics 09.00h - 12.00h Answer sheets Last name and initials: Student no.: Only hand in the answer sheets! Other sheets will not be accepted Write
UNIT 2 Begeleiding. Coaching proces, Instrumenten and vaardigheden voor Coacing en mobiliteit for Coaching and Mobility
UNIT 2 Begeleiding Coaching proces, Instrumenten and vaardigheden voor Coacing en mobiliteit for Coaching and Mobility 1 2 Wat is coaching? Coaching is een methode voor het ontwikkelen van potentieel
TENTAMEN BIOCHEMIE (8S135) Prof. Dr. Ir. L. Brunsveld :00 17:00 (totaal 100 punten) 6 opgaven in totaal (aangegeven tijd is indicatie)
TENTAMEN BIOCHEMIE (8S135) Prof. Dr. Ir. L. Brunsveld 25-01-2010 14:00 17:00 (totaal 100 punten) 6 opgaven in totaal (aangegeven tijd is indicatie) 1 (~30 minuten; 20 punten) Onderstaand is een stukje
Genetics of Viruses & Bacteria. Chapter 18
Genetics of Viruses & Bacteria Chapter 18 Structure of Virus NOT CELLS! infectious particle consisting of a nucleic acid enclosed in a protein coat Viral Genomes Classified as DNA or RNA virus Dbl. stranded
Interaction Design for the Semantic Web
Interaction Design for the Semantic Web Lynda Hardman http://www.cwi.nl/~lynda/courses/usi08/ CWI, Semantic Media Interfaces Presentation of Google results: text 2 1 Presentation of Google results: image
Snuffel Workshop Apps / Tools. Door: Pieter Vorstenbosch & Luuk Burgers
Snuffel Workshop Apps / Tools Door: Pieter Vorstenbosch & Luuk Burgers Leerdoelen Ø Activeren Voorkennis Ø Aanscherpen leervragen Ø Brainstormen Ø Leerinteractie Ø Toetsing Ø Instructie buiten de les Ø
It s all about the money Group work
It s all about the money Group work Tijdsduur: 45 minuten Kernwoorden: money (geld) coin (munt), banknote (bankbiljet), currency (munteenheid) Herhalings-/uitbreidingswoorden: debate (debat), proposal
Functioneren van een Kind met Autisme. M.I. Willems. Open Universiteit
Onderzoek naar het Effect van de Aanwezigheid van een Hond op het Alledaags Functioneren van een Kind met Autisme M.I. Willems Open Universiteit Naam student: Marijke Willems Postcode en Woonplaats: 6691
i(i + 1) = xy + y = x + 1, y(1) = 2.
Kenmerk : Leibniz/toetsen/Re-Exam-Math A + B-45 Course : Mathematics A + B (Leibniz) Date : November 7, 204 Time : 45 645 hrs Motivate all your answers The use of electronic devices is not allowed [4 pt]
Settings for the C100BRS4 MAC Address Spoofing with cable Internet.
Settings for the C100BRS4 MAC Address Spoofing with cable Internet. General: Please use the latest firmware for the router. The firmware is available on http://www.conceptronic.net! Use Firmware version
Persoonsgegevens personal details
AANGIFTE EERSTE INSCHRIJVING IN DE BASISREGISTRATIE PERSONEN VANUIT HET BUITENLAND First registration in the Municipal Personal Records Database (BRP) in the Netherlands from abroad In te vullen door Gemeente
CTI SUITE TSP DETAILS
CTI SUITE TSP DETAILS TAPI allows an application to access telephony services provided by a telecom PABX. In order to implement its access to ETRADEAL, a TAPI interface has been developed by Etrali. As
20 twenty. test. This is a list of things that you can find in a house. Circle the things that you can find in the tree house in the text.
9006625806_boek.indd 1 31/08/16 15:26 1 6 test This is a list of things that you can find in a house. Circle the things that you can find in the tree house in the text. living room kitchen bedroom toilet
Calculator spelling. Assignment
Calculator spelling A 7-segmentdisplay is used to represent digits (and sometimes also letters). If a screen is held upside down by coincide, the digits may look like letters from the alphabet. This finding
Firewall van de Speedtouch 789wl volledig uitschakelen?
Firewall van de Speedtouch 789wl volledig uitschakelen? De firewall van de Speedtouch 789 (wl) kan niet volledig uitgeschakeld worden via de Web interface: De firewall blijft namelijk op stateful staan
Usability walkthrough for accessibility
Usability walkthrough for accessibility steven stijger steven_stijger@nl.ibm.com http://www.flickr.com/photos/81167076@n00/322162512/ Copyright IBM Corporation 2008 usability walkthrough usability test
igem TU Eindhoven 2016 Synthetic biology in the lab
Synthetic biology in the lab Target Group: Last years of high school (16-18 years) Subjects: Timespan: Biology/Sociology ± 40 minutes Introduction Synthetic biology is reprogramming of biologic systems
Preschool Kindergarten
Preschool Kindergarten Objectives Students will recognize the values of numerals 1 to 10. Students will use objects to solve addition problems with sums from 1 to 10. Materials Needed Large number cards
Het beheren van mijn Tungsten Network Portal account NL 1 Manage my Tungsten Network Portal account EN 14
QUICK GUIDE C Het beheren van mijn Tungsten Network Portal account NL 1 Manage my Tungsten Network Portal account EN 14 Version 0.9 (June 2014) Per May 2014 OB10 has changed its name to Tungsten Network
Lichamelijke factoren als voorspeller voor psychisch. en lichamelijk herstel bij anorexia nervosa. Physical factors as predictors of psychological and
Lichamelijke factoren als voorspeller voor psychisch en lichamelijk herstel bij anorexia nervosa Physical factors as predictors of psychological and physical recovery of anorexia nervosa Liesbeth Libbers
Het is geen open boek tentamen. Wel mag gebruik gemaakt worden van een A4- tje met eigen aantekeningen.
Examen ET1205-D1 Elektronische Circuits deel 1, 5 April 2011, 9-12 uur Het is geen open boek tentamen. Wel mag gebruik gemaakt worden van een A4- tje met eigen aantekeningen. Indien, bij het multiple choice
The Kentalis Reading House
The Kentalis Reading House Technology-facilitated enhancement of parent involvement Annet de Klerk, Loes Wauters Overview A first impression Motivation The importance of emergent literacy at home Kentalis
Voorbeelden van machtigingsformulieren Nederlands Engels. Examples of authorisation forms (mandates) Dutch English. Juli 2012 Versie 2.
Voorbeelden van machtigingsformulieren Nederlands Engels Examples of authorisation forms (mandates) Dutch English Voorbeelden machtigingsformulieren standaard Europese incasso Examples of authorisation
MyDHL+ Tarief berekenen
MyDHL+ Tarief berekenen Bereken tarief in MyDHL+ In MyDHL+ kunt u met Bereken tarief heel eenvoudig en snel opvragen welke producten er mogelijk zijn voor een bestemming. Ook ziet u hierbij het geschatte
Programma Open dag zaterdag 28 februari 2015 Program Open Day Saturday 28 February 2015
Programma Open dag zaterdag 28 februari 2015 Program Open Day Saturday 28 February 2015 Tijd 09.15 09.45 Je bent op de Open dag, wat nu? Personal welcome international visitors 10.00 10.45 Je bent op de
Maillijsten voor medewerkers van de Universiteit van Amsterdam
See page 11 for Instruction in English Maillijsten voor medewerkers van de Universiteit van Amsterdam Iedereen met een UvAnetID kan maillijsten aanmaken bij list.uva.nl. Het gebruik van de lijsten van
Cambridge International Examinations Cambridge International General Certificate of Secondary Education
*3745107457* Cambridge International Examinations Cambridge International General Certificate of Secondary Education DUTCH 0515/03 Paper 3 Speaking Role Play Card One 1 March 30 April 2015 Approx. 15 minutes
Johto. Flexible light
Johto Flexible light Johto is a high quality lighting system based on LED for technically sophisticated interior and exterior light. It provides homogeneous and dot free illumination in very low installation