NIPT lang in verwachting: uitgerekende datum 1 april

Save this PDF as:
 WORD  PNG  TXT  JPG

Maat: px
Weergave met pagina beginnen:

Download "NIPT lang in verwachting: uitgerekende datum 1 april"

Transcriptie

1 NIPT lang in verwachting: uitgerekende datum 1 april Robert-Jan Galjaard Klinisch geneticus, laboratoriumspecialist klinische genetica Afdeling Klinische Genetica Erasmus MC, Rotterdam

2 Introductie NIPT in Nederland: TRIDENT studie TRIDENT-STUDIE Wetenschappelijk implementatieonderzoek Trial by Dutch laboratories for Evaluation of Non-Invasive Prenatal Testing

3 Waarom TRIDENT studie? WBO vergunning liever naar keten van partijen waarvan we voor elke schakel zelf de kwaliteit in NL bewaken zoals voorlichting, laboratorium, zorg tijdens en na zwangerschap De onderzoeksgroep (NIPT consortium) start TRIDENT-studie per 1 april 2014 Vergunning is voor 2 jaar verleend aan 8 academische centra Uitvoering NIPT door centra voor Prenatale diagnostiek

4 Waarom is TRIDENT studie onderzoek? Deel 1: Implementatie studie Evalueren wat goed gaat en/of wat beter moet bijvoorbeeld: - Aantal mislukte samples Nederlandse cijfers over sensitiviteit, specificiteit, positief voorspellende waarde Deel 2: Evaluatie studie ( Rotterdam: Horizon-2 studie) Evalueren waarom zwangeren wel of niet NIPT, vlokkentest of vruchtwaterpunctie kiezen en wat hun wensen voor de toekomst zijn

5 NIPT ALLEEN in kader TRIDENT studie Zwangere wil wel de NIPT, maar wil niet wil meedoen aan de TRIDENT studie; kan dat? Dat kan niet. De vergunning geldt alleen voor zwangeren die deelnemen aan de NIPT-studie. Over 2 jaar wordt een besluit genomen over het vervolg.

6 NIPT alleen in centra voor Prenatale diagnostiek Mag ik zelf bloed afnemen en insturen voor NIPT? Nee, dat mag niet. U moet verwijzen naar een centrum voor Prenatale diagnostiek Erasmus MC of satellietcentrum ( Breda, Dordrecht, Delft, Voorburg).

7 Wie mogen de NIPT test? ALLEEN zwangeren met een verhoogde kans op T21, T18, T13 na combinatietest met normale NT meting Trisomie 21 (downsyndroom), Trisomie 18 (edwardssyndroom) Trisomie 13 (patausyndroom) downsyndroom (trisomie 21) edwardssyndroom (trisomie 18) patausyndroom (trisomie 13)

8 Wie mogen de NIPT test? ALLEEN zwangeren met een verhoogde kans op T21, T18, T13 Met medische indicatie: Eerder kind/zwangerschap met een chromosoom te veel of als één van de ouders drager is van gebalanceerde robertsoniaanse translocatie chromosoom 21 of 13

9 Mag de NIPT zonder de combinatietest? Zwangere wil geen combinatietest, maar alleen NIPT; mag dat? Nee, zwangeren komen alleen in aanmerking voor NIPT als uit de combinatietest blijkt dat ze een verhoogde kans hebben. Of als er een medische indicatie is.

10 Mag de NIPT zonder de combinatietest? Vragen van patiënten Zwangere is al 15 weken zwanger en dus te laat voor de nekplooimeting; kan ze dan meteen meedoen aan de NIPT? Nee dat kan niet. De minister heeft in de vergunning voor NIPT bepaald dat de nieuwe bloedtest alleen mag worden aangeboden aan zwangeren die een verhoogde kans hebben op een kind met een trisomie 21, 18, 13.

11 Mag de NIPT met lage kans na combinatietest? Vragen van patiënten Uit de combinatietest is gebleken dat zwangere een lage kans heeft, maar toch graag de NIPT wil doen en zelf voor wil betalen. Kan dat? In de vergunning die de minister voor de NIPT verleend heeft is bepaald dat dit niet mogelijk is

12 Mag de NIPT bij leeftijdsindicatie? Vragen van patiënten Zwangere is ouder dan 36 jaar; mag ze dan automatisch meedoen aan de NIPT? Zwangeren 36 jaar of ouder krijgen alleen NIPT bij verhoogde kans na combinatietest of medische indicatie

13 Wordt de NIPT vergoed? Van 1 april 2014 tot 1 januari 2015: NIPT vergoed door de verzekeraar zonder verlies van eigen risico Vanaf 1 januari 2015: NIPT vergoed door verzekeraar met verlies van eigen risico

14 Wat verandert er in prenatale screening? Van 1 april 2014 tot 1 januari 2015: Combinatietest vergoeding zoals nu Leeftijdsindicatie blijft Wordt de NIPT vergoed? Vanaf 1 januari 2015: Combinatietest niet meer vergoed voor alle zwangeren Leeftijdsindicatie vervalt

15 NIPT: informatie gegeven door eerste lijns zorgverleners Voordeel NIPT: Geen risico op een miskraam na punctie Nadelen NIPT: NIPT uitslag geen 100% zekerheid: - Bij een niet-afwijkende uitslag wordt vervolgonderzoek niet geadviseerd: de kans is dan erg klein dat het kind toch een trisomie heeft - Bij afwijkende NIPT uitslag ook nog invasieve diagnostiek nodig - Niet voor iedereen beschikbaar - Uitslag duurt 2-3 weken Belasting zwangere: bloedafname, vragenlijst invullen Als zwangere NIPT wenst, doorverwijzen naar Centrum voor Prenatale diagnostiek/ incl. satellietlocatie

16 Aanmelding NIPT in centrum Prenatale diagnostiek Aanmelding: - Zwangeren worden aangemeld bij het secretariaat prenatale diagnostiek - Zwangeren worden geplaatst op de speciaal daartoe bestemde counselingsplaatsen binnen de punctie spreekuren ( Erasmus MC) - Counseling wordt uitgevoerd door de gynaecologen

17 In- en exclusiecriteria TRIDENT studie Inclusie criteria NIPT: - De vrouw is minimaal 18 jaar - Minimaal 10 weken zwanger - Vitaliteit van de zwangerschap is aangetoond ( echo) - Zwanger van een éénling - Begrijpt Nederlandse taal Exclusiecriteria NIPT: - Echoafwijkingen: vlokkentest of vruchtwaterpunctie meest aangewezen - Meerling of vanishing twin - Zwangere heeft maligniteit

18 Counseling in centrum voor Prenatale diagnostiek Gesprek en stappen voor TRIDENT studie: - De zwangere krijgt een (counseling) gesprek en kan kiezen tussen NIPT of een invasieve diagnostische test of geen aanvullende test. - Echoscopisch onderzoek wordt verricht om vitaliteit van de zwangerschap te controleren.

19 Extra informatie gegeven door gynaecoloog centrum Prenatale diagnostiek/ satellietcentra Nadelen NIPT: NIPT uitslag geen 100% zekerheid Vals-positief: afhankelijk van vooraf risico Vals-negatief (in folder <1:1000) Maternaal gewicht kg grotere kans op vals-negatieve uitslag Mislukken test (3:100) P T R IS O M Y PAPRIORI ZOBS Betrouwbaarheid invasieve prenatale diagnostiek Vruchtwaterpunctie: 100% Vlokkentest: 98-99% Miskraamkans na punctie vlokkenafname: ~5:1000 vruchtwaterpunctie: ~3:1000

20 Counseling in centrum voor Prenatale diagnostiek Implementatie studie TRIDENT - Zwangere krijgt de informatie van de studie: locale TRIDENT studiefolder toestemmingsformulier formulier na de bevalling (gegevens over uitkomst van de zwangerschap/bevalling) - Informed consent moet ondertekend worden - Iedereen wordt gevraagd voor de Horizon 2 studie Bij keuze voor NIPT: - Zwangere wegen - Aanvraag Prenataal Lab onderzoek - Horizon 2 studie

21 Counseling in centrum voor Prenatale diagnostiek Evaluatie studie Horizon 2 studie: - Uitleg studie en overhandigen patiënten informatiefolder - Zwangere tekent informed consent formulier - Zwangere krijgt flyer voor link naar digitale vragenlijst

22 Bloedafname en insturen voor NIPT Bloedafname: 3x10 ml EDTA buizen bloed zwangere Bloed moet met speciaal NIPT labformulier zelfde dag voor op lab Klinische Genetica Erasmus MC worden afgeleverd Kan iedere dag, bij voorkeur niet op vrijdag

23 Clinical Genetics Leading the way in genetic issues Niet-Invasieve Prenatale LaboratoriumTest

24 NIPT: foetaal DNA is placentair DNA Op foeto-maternale grensvlak: trofoblast van de placenta, komen foetale DNA fragmenten van alle chromosomen vrij in moederlijk bloed Het DNA in het plasma (bloedvloeistof zonder de bloedcellen) van een zwangere is een mix van maternaal en foetaal DNA Ong. 4-20% van het cel-vrij DNA is foetaal, afhankelijk van zwangerschapsduur

25 Foetaal DNA Foetaal DNA bestaat uit fragmenten van gemiddeld 200 baseparen (200 bp) De halfwaardetijd van foetaal DNA is gemiddeld ongeveer 16 minuten Daarom moet bloed binnen 24 uur op het laboratorium worden verwerkt Bron: foto Gendia

26 Bij trisomie meer losse DNA fragmenten in moederlijk bloed Foetaal cfdna Foetale Fractie Percentage extra DNA 4% 2 Maternaal cfdna 10% 5 20% 10 Twee chromosomen 21 Drie chromosomen 21 40% 20 Bron: Gendia

27 NIPT enkele stappen: centrifugatie bloed Cellen scheiden van bloedvloeistof ( plasma) Bloed na centrifugatie

28 NIPT enkele stappen: DNA isolatie Handmatig het beste eindresultaat Vrij foetaal DNA (cff DNA) in maternaal plasma Vrij DNA van maternaal plasma

29 DNA klaar maken voor basevolgordebepaling ( sequencen): sample preparatie DNA fragment DNA met unieke code DNA vermenigvuldigen dmv PCR

30 Controle lengteverdeling miljoenen DNA fragmenten Controle van o.a. lengte van DNA fragmenten

31 Sequencing: basevolgorde bepaling miljoenen DNA fragmenten DNA basevolgorde bepalen= sequencen ATACATT CATTATAAAGGCTCAGAAGTGAGAGAAAGCATGGCTTTTTCTG T A T T

32 Zoek de DNA fragmenten bij elkaar van één 1:N:0:CTTGTA CATTATAAAGGCTCAGAAGTGAGAGAAAGCATGGCTTTTTCTG Meet hoeveel miljoen DNA fragmenten per proef

33 Controle kwantiteit en kwaliteit basevolgorde DNA fragmenten Controle van hoeveelheid en kwaliteit basevolgorde van DNA fragmenten

34 Zoek chromosoom waarop DNA fragmenten passen CATTATAAAGGCTCAGAAGTGAGACAAAGCATGGCTTTTTCTG ATCGACCATTATAAAGGCTCAGAAGTGAGAGAAAGCATGGCTTTTTCTGGGTAGA DNA DNA mal DNA fragmenten moeten passen op normale DNA mal / chromosoom

35 Tel aantal DNA fragmenten van alle chromosomen en vergelijk met normaal T21 26 DNA fragmenten passen op chr 21 Chr 21 Normaal 21 DNA fragmenten passen op chr 21 Chr 21 Er zijn meer fragmenten chromosoom 21 bij drie chromosomen 21 dan bij twee chromosomen 21

36 Verschil tussen trisomie en normaal is extreem klein Normaal Sample T21 Sample chr Reads % mapped Reads % mapped difference M X Y total

37 Aantal DNA fragmenten dat past op chromosoom 13 en 18 is afhankelijk van andere chromosomen De bruikbare informatie voor bepalen onderscheid trisomie en normaal is groter voor chromosoom 21 dan voor chromosoom 18 Gevoeligheid/sensitiviteit van de test hierdoor voor chromosoom 21 groter NIPT Test: Trisomie 21, 18, 13 Specificiteit : > 99 % Sensitiviteit : T21 > 99 % T18 ~ 97 % T13 ~ 92 %

38 Het aantal DNA fragmenten dat past op een chromosoom hangt ook nog af van Unieke basesamenstelling DNA /chromosoom - Y chromosoom: weinig unieke stukken; lijkt op het X-chromosoom Dus nu geen foetale geslachtsbepaling

39 Resultaten NIPT validatie Erasmus MC Testuitslag NIPT beter door meerdere analysemethoden te gebruiken Correcte uitslag Vals-positief Vals-negatief Normaal Trisomie (1)* 0 Trisomie (5)* Trisomie T18 + T21 1 Anders (inst del/dup, transl.) 8 In analyse 24 Mislukte prep (niet gesequenced) 26 TOTAAL 323 * Na 2 e analysemethode (1 e analyse Bin Select, 2 e analyse met Wise Condor) wel gevonden. Nu standaard 3 analyse technieken (Ook Lmfit) P-566 en P-567 geïncludeerd, nog geen resultaten

40 Lab testuitslag in beeld gebracht: trisomie 21

41 Testuitslag van NIPT Testuitslag na 2-3 weken: - Geen aanwijzingen voor afwijking: een brief vanuit lab naar gynaecoloog en zwangere - Aanwijzingen voor afwijking: Telefonisch en per brief door lab aan gynaecoloog Gynaecoloog belt naar zwangere Gynaecoloog verwijst zo nodig naar klinisch geneticus Brief door klinisch geneticus Gegevens door gynaecoloog in speciale deel in Astraia gezet

42 Betrouwbaarheid NIPT uitslag: literatuur - Sensitiviteit hoog bij studies zonder samples met lage foetale DNA hoeveelheden - Vals-negatieven nu gedefinïeerd als 1:1000 Verwacht ook vals-positieven en -negatieven o.b.v. resp. CPM en GMDD Vlgs. Lab Erasmus MC zou theoretisch percentage vals-negatieven ongeveer 2-3:1000 kunnen zijn

43 Mozaïek trisomie 13 alleen in placenta niet in kind Labuitslag NIPT: aanwijzingen voor trisome 13 BS: 3.2 Lmfit: 12

44 Vroege embryonale ontwikkeling Zygote Trophoblast (STC-vlok) ICM Foetus (Vruchtwater) EEM (LTC-vlok)

45 Delingsfout in vroeg embryonale ontwikkeling STC mozaïek mozaïek normaal LTC normaal mozaïek afwijkend VRW normaal mozaïek afwijkend

46 NIPT in Nederland: niet alleen downsyndroom

47 Deletie van 17 Mb lange arm chromosoom 13 #13 z-scores LM fit: -2,1 BS: 1,0

48 Naar NIPT voor vele genetische ernstige aandoeningen?

49 Medicalisering van de zwangerschap

50 TRIDENT en Horizon studie na NIPT testuitslag - Na NIPT uitslag worden zwangeren voor Horizon 2 studie telefonisch geïnterviewd en gevraagd naar o.a. de tevredenheid over hun keuze NIPT - Bij miskraam of IUVD: placenta en huidbiopt foetus ter bevestiging Na bevalling invullen en terugsturen formulier over zwangerschapsuitkomst

51 NIPT: belangrijkste conclusies NIPT ALLEEN voor zwangeren met een verhoogde kans op T21, T18, T13 obv medische indicatie of CT ( 1 200), zonder echoafwijkingen - In de literatuur genoemde sensitiviteit T21:> 99%,T18: 97% en T13: 92% - Bij gunstige uitslag is er hele kleine kans dat het kind toch trisomie 21, 18 of 13 heeft (literatuur: kleiner dan 1:1000) - Een ongunstige uitslag van NIPT bevestigen met een invasieve test - Uitslag na 2-3 weken - Geen testuitslag bij 3:100 - Bij maternaal overgewicht: meer kans op vals-negatieve uitslagen - Bij miskraam of IUVD: placenta en huidbiopt foetus ter bevestiging

52 Antwoorden op vragen en evaluatie NIPT resultaten Antwoorden op (FAQ) NIPT op studiewebsite er weten? Problemen graag melden via: Vragenlijst Horizon-2 studie naar Klinische Genetica Erasmus MC

53 Acknowledgements Prenatale Cytogenetica Klinische Genetica Diane Van Opstal Femke de Vries Gosia Srebniak Hasna Kariouh Marjan Boter Prenatale klinisch genetici Samantha Riedijk Sanne v der Steen, Bonnie Kadiks Robert-Jan Galjaard NIPT Consortium: m.n. kerngroep Lidewij Henneman, Erik Sistermans, Dick Oepkes, Lieve Christiaens, Heleen Schuring-Blom, Robert-Jan Galjaard UMCG: Gerard te Meerman VUmC: Caroline Bax Biomics Frank Sleutels Rutger Brouwer Christel Kocks Zeliha Ozur Wilfred van IJcken DNA diagnostiek Klinische Genetica Dicky Halley, Hennie Bruggenwirth Stichting Prenatale screening Zuid-west Nederland Prenatale Geneeskunde Erasmus MC Attie Go Gynaecologen/ verloskundigen

NIPT en de. TRIDENT studie. Overzicht. 24 maart 2014. -Prenatale screening (algemeen) -NIPT. 1. NIPT: korte inleiding 3/26/2014

NIPT en de. TRIDENT studie. Overzicht. 24 maart 2014. -Prenatale screening (algemeen) -NIPT. 1. NIPT: korte inleiding 3/26/2014 NIPT en de TRIDENT studie 24 maart 2014 Irene van Langen Klinisch geneticus UMCG Mede-onderzoeker TRIDENT Studie Overzicht -Prenatale screening (algemeen) -NIPT 1. NIPT: korte inleiding 2. NIPT in Nederland

Nadere informatie

NIPT Regionale bijeenkomst AMC

NIPT Regionale bijeenkomst AMC NIPT Regionale bijeenkomst AMC 28 maart 2014 Deskundigheidsbevordering NIPT i.v.m. counseling prenatale screening Marion van Hoorn perinatoloog & Lidewij Henneman senior onderzoeker Disclosure belangen

Nadere informatie

NIPT. Nascholing Counseling NIPT

NIPT. Nascholing Counseling NIPT NIPT Dr. Kornelia Neveling Wetenschappelijk onderzoeker, afdeling Genetica, Radboudumc Dr. Dominique Smeets Laboratorium specialist, afdeling Genetica, Radboudumc Voorzitter bestuur SPN Nascholing Counseling

Nadere informatie

Deskundigheidsbevordering NIPT i.v.m. counseling prenatale screening

Deskundigheidsbevordering NIPT i.v.m. counseling prenatale screening Deskundigheidsbevordering NIPT i.v.m. counseling prenatale screening Programma: 1. Inleiding (10 minuten): recente ontwikkelingen rond NIPT, aandacht in de pers, belangstelling van publiek, toelichting

Nadere informatie

Gespreksleidraad voor counselors prenatale screening. Informeren over NIPT

Gespreksleidraad voor counselors prenatale screening. Informeren over NIPT Gespreksleidraad voor counselors prenatale screening Informeren over NIPT Inhoudsopgave blz. 1 De kernboodschap: wat vertel je over de NIPT? 3 2 Achtergrondinformatie NIPT 3 2.1 De belangrijkste feiten

Nadere informatie

NIPT. Mireille Bekker Gynaecoloog-perinatoloog UMCU Medisch adviseur SPSRU

NIPT. Mireille Bekker Gynaecoloog-perinatoloog UMCU Medisch adviseur SPSRU NIPT Mireille Bekker Gynaecoloog-perinatoloog UMCU Medisch adviseur SPSRU Disclosure belangen sprekers (potentiële) belangenverstrengeling Geen / zie hieronder Voor bijeenkomst mogelijk relevante relaties

Nadere informatie

Niet invasieve prenatale testen: stand van zaken in Nederland. Lidewij Henneman, senior onderzoeker

Niet invasieve prenatale testen: stand van zaken in Nederland. Lidewij Henneman, senior onderzoeker Niet invasieve prenatale testen: stand van zaken in Nederland Lidewij Henneman, senior onderzoeker Symposium Eurocat / SPSNN 26 september 2014 Disclosure belangen spreker (potentiële) belangenverstrengeling

Nadere informatie

NIPT. K. Huijsdens Labspecialist klinische genetica, AMC. Nascholing Counseling NIPT

NIPT. K. Huijsdens Labspecialist klinische genetica, AMC. Nascholing Counseling NIPT NIPT K. Huijsdens Labspecialist klinische genetica, AMC Nascholing Counseling NIPT Disclosure belangen sprekers (potentiële) belangenverstrengeling Geen / zie hieronder Voor bijeenkomst mogelijk relevante

Nadere informatie

NIPT. Nicole Corsten en Katelijne Bouman klinisch genetici UMCG, Isala en MCL. Nascholing Counseling NIPT

NIPT. Nicole Corsten en Katelijne Bouman klinisch genetici UMCG, Isala en MCL. Nascholing Counseling NIPT NIPT Nicole Corsten en Katelijne Bouman klinisch genetici UMCG, Isala en MCL Nascholing Counseling NIPT Disclosure belangen sprekers Disclosure: geen belangenverstrengeling Inhoud Wat, hoe en wanneer?

Nadere informatie

Veranderingen in de counseling voor (en na) de combinatietest

Veranderingen in de counseling voor (en na) de combinatietest Veranderingen in de counseling voor (en na) de combinatietest Ilse Feenstra Klinisch geneticus Wat verandert er in de counseling voor de screening op trisomie? Wat & wanneer? Vanaf 1 april 2014: - Alle

Nadere informatie

Prenataal testen met de NIPT

Prenataal testen met de NIPT ALGEMENE INFORMATIEFOLDER Prenataal testen met de NIPT Deze folder hoort bij een wetenschappelijke studie (TRIDENT-studie) van de Nederlandse Universitair Medische Centra 2014 www.meerovernipt.nl 1 In

Nadere informatie

De introductie van NIPT als eerste screeningstest in Nederland. Lidewij Henneman, senior onderzoeker Community Genetics

De introductie van NIPT als eerste screeningstest in Nederland. Lidewij Henneman, senior onderzoeker Community Genetics De introductie van NIPT als eerste screeningstest in Nederland Lidewij Henneman, senior onderzoeker Community Genetics Symposium Vervolmaakte Mens - 26 september 2016 Disclosure belangen spreker (potentiële)

Nadere informatie

Prenataal testen met de NIPT

Prenataal testen met de NIPT ALGEMENE INFORMATIEFOLDER Prenataal testen met de NIPT Deze folder hoort bij een wetenschappelijke studie (TRIDENT-studie) van de Nederlandse Universitair Medische Centra 2014 www.meerovernipt.nl 1 In

Nadere informatie

NIPT. Dr. Diane Van Opstal, Laboratoriumspecialist Klinische Genetica, Erasmus MC. Nascholing Counseling NIPT

NIPT. Dr. Diane Van Opstal, Laboratoriumspecialist Klinische Genetica, Erasmus MC. Nascholing Counseling NIPT NIPT Dr. Diane Van Opstal, Laboratoriumspecialist Klinische Genetica, Erasmus MC Nascholing Counseling NIPT Disclosure belangen sprekers (potentiële) belangenverstrengeling Geen Voor bijeenkomst mogelijk

Nadere informatie

Niet-Invasief Prenataal Testen: Nevenbevindingen, regionale en landelijke resultaten en een blik vooruit

Niet-Invasief Prenataal Testen: Nevenbevindingen, regionale en landelijke resultaten en een blik vooruit Niet-Invasief Prenataal Testen: Nevenbevindingen, regionale en landelijke resultaten en een blik vooruit Dr BHW Faas Laboratorium Specialist Klinische Genetica Radboud Universiteit Nijmegen Afdeling Genetica

Nadere informatie

Prenataal testen met de NIPT

Prenataal testen met de NIPT INFORMATIEFOLDER Prenataal testen met de NIPT voor zwangeren met verhoogd risico op een kind met down-, edwards-, of patausyndroom Deze folder hoort bij een wetenschappelijke studie (TRIDENT-1 studie)

Nadere informatie

TRIDENT studie. Mireille Bekker Gynaecoloog Radboud umc

TRIDENT studie. Mireille Bekker Gynaecoloog Radboud umc TRIDENT studie Mireille Bekker Gynaecoloog Radboud umc Historie April 2011 oprichting NIPT consortium Nederland TRIDENT studie: implementatie van lab tot uitslag ESPRIT studie: ethisch, economisch, maatschappelijk

Nadere informatie

Update NIPT sinds 1 april 2017

Update NIPT sinds 1 april 2017 Update NIPT sinds 1 april 2017 Dr. Lidewij Henneman Onderzoeker klinische genetica VU medisch centrum Regiobijeenkomst SPSRU sept 2017 Disclosure belangen sprekers (potentiële) belangenverstrengeling Geen

Nadere informatie

Cijfers NIPT. Sensitiviteit: Ontdekt de test alle foetussen met een afwijking?

Cijfers NIPT. Sensitiviteit: Ontdekt de test alle foetussen met een afwijking? Cijfers NIPT Cijfers NIPT Sensitiviteit: Ontdekt de test alle foetussen met een afwijking? De NIPT ontdekt ongeveer: 96 van de 100 (96%) foetussen met downsyndroom 87 van de 100 (87%) foetussen met edwardssyndroom

Nadere informatie

NIPT. Nascholing Counseling NIPT

NIPT. Nascholing Counseling NIPT NIPT Dr. Diane Van Opstal, Laboratoriumspecialist Klinische Genetica, Erasmus MC Dr. Maarten Knapen, gynaecoloog-perinatoloog Erasmus MC en medisch directeur SPSZN Nascholing Counseling NIPT Disclosure

Nadere informatie

Onderzoek naar de gezondheid van je kindje... 2 Er zijn vijf soortem prenatale testen:... 2 Combinatietest Down-, edwards-, patausyndroom...

Onderzoek naar de gezondheid van je kindje... 2 Er zijn vijf soortem prenatale testen:... 2 Combinatietest Down-, edwards-, patausyndroom... Contents Onderzoek naar de gezondheid van je kindje.... 2 Er zijn vijf soortem prenatale testen:... 2 Combinatietest... 2 Down-, edwards-, patausyndroom... 2 Uitslag... 2... 3 Betrouwbaarheid... 3... 3

Nadere informatie

Wat verandert er in de counseling?

Wat verandert er in de counseling? Wat verandert er in de counseling? [NAAM SPREKER] Nascholing counseling NIPT Disclosure belangen sprekers (potentiële) belangenverstrengeling Geen / zie hieronder Voor bijeenkomst mogelijk relevante relaties

Nadere informatie

Laboratorium techniek NIPT

Laboratorium techniek NIPT Laboratorium techniek NIPT Merryn Macville, laboratorium specialist klinische genetica 27 februari 2014 Invasieve prenatale diagnostiek 1966 Karyotypering amnioncellen 1970 1980 1990 2000 2010 Karyotypering

Nadere informatie

PrenataleScreening in Nederland. TRIDENT-1 & TRIDENT-2 studies. Marian Bakker SPSNN

PrenataleScreening in Nederland. TRIDENT-1 & TRIDENT-2 studies. Marian Bakker SPSNN PrenataleScreening in Nederland TRIDENT-1 & TRIDENT-2 studies Marian Bakker SPSNN Disclosure (Potentiële) belangenverstrengeling Voor bijeenkomst mogelijk relevante relaties met bedrijven Sponsoring of

Nadere informatie

NIPT: praktische aspecten, eerste resultaten en een blik vooruit. Kornelia Neveling (PhD) en Lean Beulen (MD) 4 th November 2014

NIPT: praktische aspecten, eerste resultaten en een blik vooruit. Kornelia Neveling (PhD) en Lean Beulen (MD) 4 th November 2014 NIPT: praktische aspecten, eerste resultaten en een blik vooruit Kornelia Neveling (PhD) en Lean Beulen (MD) 4 th November 2014 Inhoud Wat is NIPT? Hoe werkt NIPT? (van bloedafname tot testresultaat) Betrouwbaarheid

Nadere informatie

NIPT: praktische aspecten, eerste resultaten en een blik vooruit (II) Lean Beulen en Kornelia Neveling regionale bijeenkomst SPN d.d.

NIPT: praktische aspecten, eerste resultaten en een blik vooruit (II) Lean Beulen en Kornelia Neveling regionale bijeenkomst SPN d.d. NIPT: praktische aspecten, eerste resultaten en een blik vooruit (II) Lean Beulen en Kornelia Neveling regionale bijeenkomst SPN d.d. 4 november 2014 Proefimplementatie NIPT Vanwege verwachte impact van

Nadere informatie

Wat verandert er in de counseling?

Wat verandert er in de counseling? Wat verandert er in de counseling? Dr. Janneke Gitsels Nascholing counseling NIPT Disclosure belangen sprekers (potentiële) belangenverstrengeling Geen / zie hieronder Voor bijeenkomst mogelijk relevante

Nadere informatie

De NIPT binnen de prenatale screening: waar staan we en waar gaan we naar toe? Katelijne Bouman, klinisch geneticus UMCG en Isala

De NIPT binnen de prenatale screening: waar staan we en waar gaan we naar toe? Katelijne Bouman, klinisch geneticus UMCG en Isala De NIPT binnen de prenatale screening: waar staan we en waar gaan we naar toe? Katelijne Bouman, klinisch geneticus UMCG en Isala Introductie Sinds 2014 is de NIPT ( in het kader van wetenschappelijk onderzoek)

Nadere informatie

NIPT: Een nieuwe mogelijkheid voor prenatale screening. Prof.dr. Martina Cornel www.vumc.com/researchcommunitygenetics

NIPT: Een nieuwe mogelijkheid voor prenatale screening. Prof.dr. Martina Cornel www.vumc.com/researchcommunitygenetics NIPT: Een nieuwe mogelijkheid voor prenatale screening Prof.dr. Martina Cornel www.vumc.com/researchcommunitygenetics Disclosure belangen spreker (potentiële) belangenverstrengeling Zie hieronder Voor

Nadere informatie

Gespreksleidraad NIPT voor counselors. Prenatale screening op down-, edwards- en patausyndroom Maart 2017

Gespreksleidraad NIPT voor counselors. Prenatale screening op down-, edwards- en patausyndroom Maart 2017 Gespreksleidraad NIPT voor counselors Prenatale screening op down-, edwards- en patausyndroom Maart 2017 2 Inhoudsopgave 1 Inleiding 4 2 Kernboodschap 4 3 Verdiepende informatie NIPT 5 3.1 Wetenschappelijke

Nadere informatie

Inhoud. Combinatietest Structureel echoscopisch onderzoek Geavanceerd ultrageluid onderzoek NIPT Invasieve diagnostiek Vruchtwaterpunctie Vlokkentest

Inhoud. Combinatietest Structureel echoscopisch onderzoek Geavanceerd ultrageluid onderzoek NIPT Invasieve diagnostiek Vruchtwaterpunctie Vlokkentest Inhoud Combinatietest Structureel echoscopisch onderzoek Geavanceerd ultrageluid onderzoek NIPT Invasieve diagnostiek Vruchtwaterpunctie Vlokkentest Prenatale screening Doel: Aanstaande ouders die dat

Nadere informatie

NIPT. Regiobijeenkomst 27 februari. Audrey Coumans

NIPT. Regiobijeenkomst 27 februari. Audrey Coumans NIPT Regiobijeenkomst 27 februari Audrey Coumans NIPT in de media Gynaecologen woedend over verbod AMERIKA BELGIE DUITSLAND Inleiding Waarom duurt het hier altijd zo lang? Prenatale screening is bevolkingsonderzoek

Nadere informatie

NIPT: van TRIDENT-1 naar TRIDENT-2, waar staan we nu?

NIPT: van TRIDENT-1 naar TRIDENT-2, waar staan we nu? NIPT: van TRIDENT-1 naar TRIDENT-2, waar staan we nu? SPN bijeenkomst, november 2017 Van TRIDENT 1 naar TRIDENT 2 -Inleiding -Cijfers: landelijk-regionaal -Impressie werkzaamheden -Nevenbevindingen Dank

Nadere informatie

Prenataal testen voor genetische aandoeningen begrijpen. Professor Martina Cornel & Professor Heather Skirton Gen-Equip Project.

Prenataal testen voor genetische aandoeningen begrijpen. Professor Martina Cornel & Professor Heather Skirton Gen-Equip Project. Prenataal testen voor genetische aandoeningen begrijpen Professor Martina Cornel & Professor Heather Skirton Gen-Equip Project. Prenataal testen verwijst naar het testen van de foetus tijdens de zwangerschap

Nadere informatie

trisomie 13 en trisomie 18: de prenatale diagnose

trisomie 13 en trisomie 18: de prenatale diagnose trisomie 13 en trisomie 18: de prenatale diagnose Katelijne Bouman, klinisch geneticus Afdeling Genetica Universitair Medisch Centrum Groningen Trisomie 13 en 18: de prenatale diagnose Geboorteprevalentie

Nadere informatie

Nekplooimeting. gecombineerd met vroege bloedtest in de zwangerschap mogelijk tot 13 6/7 weken zwangerschapsduur. Afdeling Verloskunde/Gynaecologie

Nekplooimeting. gecombineerd met vroege bloedtest in de zwangerschap mogelijk tot 13 6/7 weken zwangerschapsduur. Afdeling Verloskunde/Gynaecologie Nekplooimeting gecombineerd met vroege bloedtest in de zwangerschap mogelijk tot 13 6/7 weken zwangerschapsduur Afdeling Verloskunde/Gynaecologie In het kort Deze folder geeft informatie over de echoscopische

Nadere informatie

Echo onderzoek tijdens de zwangerschap De termijnecho, combinatietest en de 20 weken echo

Echo onderzoek tijdens de zwangerschap De termijnecho, combinatietest en de 20 weken echo 12-12-2016 607 Echo onderzoek tijdens de zwangerschap De termijnecho, combinatietest en de 20 weken echo Elke zwangere in Almere mag gebruik maken van 2 echo-onderzoeken: een termijnecho in het begin van

Nadere informatie

NIPT De niet-invasieve prenatale test voor trisomie

NIPT De niet-invasieve prenatale test voor trisomie NIPT De niet-invasieve prenatale test voor trisomie NIPT De niet-invasieve prenatale test voor trisomie Waarom NIPT? In België kunnen alle zwangere vrouwen die dit wensen het risico dat de foetus het syndroom

Nadere informatie

Draaiboek TRIDENT studie Trial by Dutch laboratories for Evaluation of Non-Invasive Prenatal Testing. Aanbod NIPT

Draaiboek TRIDENT studie Trial by Dutch laboratories for Evaluation of Non-Invasive Prenatal Testing. Aanbod NIPT Draaiboek TRIDENT studie Trial by Dutch laboratories for Evaluation of Non-Invasive Prenatal Testing Aanbod NIPT Dit protocol is bedoeld voor zorgprofessionals die werkzaam zijn in de Prenatale Diagnostische

Nadere informatie

Prenatale screening: de combinatietest Kansbepaling vroeg in de zwangerschap op het syndroom van Down

Prenatale screening: de combinatietest Kansbepaling vroeg in de zwangerschap op het syndroom van Down Prenatale screening: de combinatietest Kansbepaling vroeg in de zwangerschap op het syndroom van Down Albert Schweitzer ziekenhuis polikliniek Gynaecologie april 2012 Pavo 0530 Inleiding Iedere ouder wenst

Nadere informatie

Uitslag van prenataal laboratoriumonderzoek en gevolgen voor de zwangerschap

Uitslag van prenataal laboratoriumonderzoek en gevolgen voor de zwangerschap 370 Uitslag van prenataal laboratoriumonderzoek en gevolgen voor de zwangerschap Jaarlijks rapporteren alle prenataal diagnostische centra, zowel die in de universitair medische centra als die in de satellietcentra,

Nadere informatie

De Voorzitter van de Tweede Kamer der Staten-Generaal Postbus 20018 2500 EA DEN HAAG. Datum 1 maart 2016 Betreft stand van zaken prenatale screening

De Voorzitter van de Tweede Kamer der Staten-Generaal Postbus 20018 2500 EA DEN HAAG. Datum 1 maart 2016 Betreft stand van zaken prenatale screening > Retouradres Postbus 20350 2500 EJ Den Haag De Voorzitter van de Tweede Kamer der Staten-Generaal Postbus 20018 2500 EA DEN HAAG Bezoekadres Parnassusplein 5 2511 VX Den Haag www.rijksoverheid.nl Bijlage(n)

Nadere informatie

Wat is NIPT? Yvonne Arens, klinisch geneticus 27 februari 2013

Wat is NIPT? Yvonne Arens, klinisch geneticus 27 februari 2013 Wat is NIPT? Yvonne Arens, klinisch geneticus 27 februari 2013 Screening ivm chromosoomafwijkingen Waarom Screening op Chromosoomafwijkingen? Risico op een kind met: Mentale Retardatie en/of Verstandelijke

Nadere informatie

De Combinatietest. Sylvia Schaefer, arts-echoscopist, VUmc

De Combinatietest. Sylvia Schaefer, arts-echoscopist, VUmc De Combinatietest Sylvia Schaefer, arts-echoscopist, VUmc De Combinatietest Kansbepalingstest Screening op Down-syndroom AD 9-14 weken Geen risico s Downsyndroom Trisomie 21 Vernoemd naar dr. John Langdon

Nadere informatie

Prenatale screening: de combinatietest. Kansbepaling vroeg in de zwangerschap op het syndroom van Down, Edwardssyndroom en Patausyndroom

Prenatale screening: de combinatietest. Kansbepaling vroeg in de zwangerschap op het syndroom van Down, Edwardssyndroom en Patausyndroom Prenatale screening: de combinatietest Kansbepaling vroeg in de zwangerschap op het syndroom van Down, Edwardssyndroom en Patausyndroom Inleiding Iedere ouder wenst een gezond kind. Helaas worden soms

Nadere informatie

Als zwangeren kiezen voor prenatale screening naar

Als zwangeren kiezen voor prenatale screening naar Zorg NIPT, de niet-invasieve prenatale test Uitdagingen voor de toekomst Lidewij Henneman, G.C.M.L. (Lieve) Page-Christiaens en Dick Oepkes De niet-invasieve prenatale test (NIPT) is een nieuwe, accurate

Nadere informatie

Position Paper. Prenatale Screening

Position Paper. Prenatale Screening Position Paper Prenatale Screening Vastgesteld door de Werkgroep Genetisch Onderzoek (2011/2012) Geaccordeerd door het VSOP bestuur, februari 2012 Achtergrond In 2001 en 2004 verschenen rapporten van de

Nadere informatie

Counseling over QF-PCR en array. Caroline Bax en Eva Pajkrt, perinatologen VUMC en AMC

Counseling over QF-PCR en array. Caroline Bax en Eva Pajkrt, perinatologen VUMC en AMC Counseling over QF-PCR en array Caroline Bax en Eva Pajkrt, perinatologen VUMC en AMC Inleiding Conventionele chromosoom analyse wordt sinds de jaren 60 gebruikt. Cytogenetische diagnose: Aneuploidie (On)gebalanceerde

Nadere informatie

Echo onderzoek tijdens de zwangerschap De termijnecho, combinatietest en de 20 weken echo

Echo onderzoek tijdens de zwangerschap De termijnecho, combinatietest en de 20 weken echo Echo onderzoek tijdens de zwangerschap De termijnecho, combinatietest en de 20 weken echo Elke zwangere in Almere mag gebruik maken van 2 echo-onderzoeken: een termijnecho in het begin van de zwangerschap

Nadere informatie

ESPRIT studie. Niet-invasieveprenatale testen (NIPT): gevolgen voor counseling, geïnformeerde besluitvorming en het prenatale screeningsbeleid

ESPRIT studie. Niet-invasieveprenatale testen (NIPT): gevolgen voor counseling, geïnformeerde besluitvorming en het prenatale screeningsbeleid Niet-invasieveprenatale testen (NIPT): gevolgen voor counseling, geïnformeerde besluitvorming en het prenatale screeningsbeleid Ethical Social Psychological Research for Implementing screening for fetal

Nadere informatie

Vlokkentest of vruchtwaterpunctie

Vlokkentest of vruchtwaterpunctie Vlokkentest of vruchtwaterpunctie U overweegt een vlokkentest of vruchtwaterpunctie te laten doen. Of u heeft in overleg met uw arts besloten om een van deze onderzoeken te ondergaan. In deze folder vindt

Nadere informatie

Non Invasieve Prenatale Test (NIPT) NIPT-bijeenkomst, 13 november 2013

Non Invasieve Prenatale Test (NIPT) NIPT-bijeenkomst, 13 november 2013 Non Invasieve Prenatale Test (NIPT) NIPT-bijeenkomst, 13 november 2013 Dr. Maarten Knapen medisch directeur Stichting Prenatale Screening Zuidwest Nederland gynaecoloog-perinatoloog ErasmusMC Rotterdam

Nadere informatie

ONDERZOEK IN VLOKKEN OF VRUCHTWATER BIJ ECHOAFWIJKINGEN

ONDERZOEK IN VLOKKEN OF VRUCHTWATER BIJ ECHOAFWIJKINGEN ONDERZOEK IN VLOKKEN OF VRUCHTWATER BIJ ECHOAFWIJKINGEN ONDERZOEK IN VLOKKEN E VRUCHTWATER BIJ ECHOAFWIJKINGEN Afdeling Genetica UMCG 2 Onderzoek in vlokken of in vruchtwater bij echoafwijkingen. U bent

Nadere informatie

Infobrochure. Prenatale screening. Dienst: Gynaecologie-verloskunde Tel: mensen zorgen voor mensen

Infobrochure. Prenatale screening. Dienst: Gynaecologie-verloskunde Tel: mensen zorgen voor mensen Infobrochure Prenatale screening Dienst: Gynaecologie-verloskunde Tel: 011 826 100 mensen zorgen voor mensen 2 Downsyndroom (trisomie 21) De meeste pasgeborenen zijn gezond. Elke baby heeft echter een

Nadere informatie

Combinatietest. Echo en bloedonderzoek bij 11-14 weken zwangerschap

Combinatietest. Echo en bloedonderzoek bij 11-14 weken zwangerschap Combinatietest Echo en bloedonderzoek bij 11-14 weken zwangerschap Aangeboren aandoeningen komen relatief weinig voor: 96 van de 100 zwangerschappen eindigen in de geboorte van een volkomen gezond kind.

Nadere informatie

Samenvatting. Huidige prenatale screening

Samenvatting. Huidige prenatale screening Samenvatting De afgelopen jaren zijn nieuwe tests ontwikkeld om bij een foetus chromosoomafwijkingen op te sporen, zoals bijvoorbeeld het syndroom van Down. Kenmerk van deze tests is dat ze niet invasief

Nadere informatie

Er zijn twee onderzoeken mogelijk: 1. Met de combinatietest wordt onderzocht of er een verhoogde kans bestaat dat uw ongeboren kind Downsyndroom

Er zijn twee onderzoeken mogelijk: 1. Met de combinatietest wordt onderzocht of er een verhoogde kans bestaat dat uw ongeboren kind Downsyndroom Prenatale screening op Downsyndroom en lichamelijke afwijkingen INHOUD 1. Wat leest u in deze brochure? 2. Onderzoek naardownsyndroomen lichamelijke afwijkingen 2.1 Onderzoek naar Downsyndroom 2.2 Onderzoek

Nadere informatie

DEEL 1. VOORBEREIDEN OP DE IMPLEMENTATIE VAN NIET-INVASIEVE PRENATALE SCREENING

DEEL 1. VOORBEREIDEN OP DE IMPLEMENTATIE VAN NIET-INVASIEVE PRENATALE SCREENING De invoering van de Niet-Invasieve Prenatale Test (NIPT) heeft wereldwijd een grote verandering teweeg gebracht in de prenatale zorg. NIPT is een accurate en veilige prenatale test waarbij bloed van de

Nadere informatie

Praktische informatie. Sjaak Toet Scholingsbijeenkomst NIPT

Praktische informatie. Sjaak Toet Scholingsbijeenkomst NIPT Praktische informatie Sjaak Toet Scholingsbijeenkomst NIPT Inhoud Aanvraag in Peridos Toestemmingsformulier Bloedafnameformulier Bloedafnamelocaties voor NIPT Kosten Betaling door de zwangere De uitslag

Nadere informatie

Prenatale screening en diagnostiek

Prenatale screening en diagnostiek Dienst Gynaecologie Verloskunde Informatie voor de ouders Prenatale screening en diagnostiek De term prenatale diagnostiek wordt vaak als een overkoepelende term gebruikt voor alle mogelijke testen en

Nadere informatie

Uitkomsten van laboratoriumonderzoek

Uitkomsten van laboratoriumonderzoek 341 Uitkomsten van laboratoriumonderzoek C y t o g e n e t i s c h o n d e r z o e k Cytogenetisch onderzoek in vlokken en vruchtwater (en onder bijzondere omstandigheden soms in navelstrengbloed) levert

Nadere informatie

Ministerie van Volksgezondheid, Welzijn en Sport. Beschikking van de Minister van Volksgezondheid, Welzijn en PG

Ministerie van Volksgezondheid, Welzijn en Sport. Beschikking van de Minister van Volksgezondheid, Welzijn en PG Ministerie van Volksgezondheid, Welzijn en Sport Beschikking van de Minister van Volksgezondheid, Welzijn en Sport, van 20SEP, 2016 houdende vergunningverlening in het kader van de Wet op het bevolkingsonderzoek

Nadere informatie

Valkuilen bij niet-invasieve foetale RhD typering Florentine F. Thurik

Valkuilen bij niet-invasieve foetale RhD typering Florentine F. Thurik Valkuilen bij niet-invasieve foetale RhD typering Florentine F. Thurik Arts onderzoeker Afdeling Experimentele Immunohematologie Sanquin Research, Amsterdam, The Netherlands f.thurik@sanquin.nl Prenatale

Nadere informatie

Samenvatting. Adviesvragen

Samenvatting. Adviesvragen Samenvatting Adviesvragen Wat zijn de beste tests om in de zwangerschap neuralebuisdefecten en downsyndroom te constateren bij een foetus? En hoe kan deze prenatale screening het beste worden uitgevoerd?

Nadere informatie

Regionaal Protocol Verwijsbeleid 1 e lijn naar VC de Poort

Regionaal Protocol Verwijsbeleid 1 e lijn naar VC de Poort Regionaal Protocol Verwijsbeleid 1 e lijn naar VC de Poort Nadat de zwangere voor de eerste controle bij de verwijzer is geweest waar zij uitleg heeft gekregen over de procedure rondom de 1 e trimester

Nadere informatie

Samenvatting. Huidig programma en criteria voor screening

Samenvatting. Huidig programma en criteria voor screening Samenvatting Technologische ontwikkelingen maken het in toenemende mate mogelijk om al vroeg in de zwangerschap eventuele afwijkingen bij de foetus op te sporen. Ook zijn nieuwe testen beschikbaar die

Nadere informatie

Risicoberekening voor TRISOMIE 21 in het eerste trimester

Risicoberekening voor TRISOMIE 21 in het eerste trimester Risico op trisomie 21 Centrum Menselijke Erfelijkheid Risicoberekening voor TRISOMIE 21 in het eerste trimester Hoewel de meeste baby s gezond zijn, heeft elke baby een kleine kans op een lichamelijke

Nadere informatie

Verloskundige zorg en kraamzorg

Verloskundige zorg en kraamzorg Verloskundige zorg en kraamzorg 2017 Verloskundige zorg en kraamzorg Gefeliciteerd met uw zwangerschap! Het krijgen van een kind is een bijzondere gebeurtenis. Om ervoor te zorgen dat u straks van uw kraamtijd

Nadere informatie

Prenatale diagnostiek

Prenatale diagnostiek Informatie over onderzoeken naar aangeboren afwijkingen In deze brochure vindt u informatie over diverse onderzoeksmogelijkheden naar aangeboren afwijkingen tijdens de zwangerschap. Het is niet nodig om

Nadere informatie

Tabel 1: Kans op het krijgen van een kind met het syndroom van Down uitgezet tegen de leeftijd.

Tabel 1: Kans op het krijgen van een kind met het syndroom van Down uitgezet tegen de leeftijd. De Nekplooimeting Inleiding Elke zwangere hoopt op een gezonde baby. Helaas worden er soms kinderen geboren met een lichamelijke en/of een verstandelijke handicap. Met behulp van een echo-onderzoek (de

Nadere informatie

Verloskundige zorg en kraamzorg

Verloskundige zorg en kraamzorg Verloskundige zorg en Kraamzorg 2016 Verloskundige zorg en kraamzorg Gefeliciteerd met uw zwangerschap! Het krijgen van een kind is een bijzondere gebeurtenis. Om ervoor te zorgen dat u straks van uw kraamtijd

Nadere informatie

Resultaten TRIDENT-studie Symposium 23 mei 2016 Stichting Prenatale Screening Zuidwest Nederland

Resultaten TRIDENT-studie Symposium 23 mei 2016 Stichting Prenatale Screening Zuidwest Nederland Resultaten TRIDENT-studie Symposium 23 mei 2016 Stichting Prenatale Screening Zuidwest Nederland Diane Van Opstal, Laboratorium Specialist Klinische Genetica TRIDENT 1 april 2014: start of NIPT in the

Nadere informatie

Controles en onderzoeken in de zwangerschap. De eerste controle

Controles en onderzoeken in de zwangerschap. De eerste controle Controles en onderzoeken in de zwangerschap De onderwerpen die in dit document aan de orde komen zijn: De eerste controle Vervolgcontroles Bloedonderzoek Prenatale screening Prenatale diagnostiek Overige

Nadere informatie

Verloskundige zorg en kraamzorg

Verloskundige zorg en kraamzorg Verloskundige zorg en Kraamzorg 2017 Verloskundige zorg en kraamzorg Gefeliciteerd met uw zwangerschap! Het krijgen van een kind is een bijzondere gebeurtenis. Om ervoor te zorgen dat u straks van uw kraamtijd

Nadere informatie

NIPT: dynamiek & ethiek van prenatale screening. 31 maart 2014 SPSZN - Rotterdam dr mr Antina de Jong - Health, Ethics & Society

NIPT: dynamiek & ethiek van prenatale screening. 31 maart 2014 SPSZN - Rotterdam dr mr Antina de Jong - Health, Ethics & Society NIPT: dynamiek & ethiek van prenatale screening 31 maart 2014 SPSZN - Rotterdam dr mr Antina de Jong - Inhoud Context prenatale screening NIPT: 3 scenario s Dubbele doelstelling prenatale screening De

Nadere informatie

Prenataal onderzoek Informatie over de combinatietest, 20 weken echo, vlokkentest, vruchtwaterpunctie en geavanceerd ultra geluid onderzoek (G.U.O.

Prenataal onderzoek Informatie over de combinatietest, 20 weken echo, vlokkentest, vruchtwaterpunctie en geavanceerd ultra geluid onderzoek (G.U.O. Prenataal onderzoek Informatie over de combinatietest, 20 weken echo, vlokkentest, vruchtwaterpunctie en geavanceerd ultra geluid onderzoek (G.U.O.) Maatschap Gynaecologie IJsselland Ziekenhuis Inhoudsopgave

Nadere informatie

Programma Regiobijeenkomst

Programma Regiobijeenkomst Programma Regiobijeenkomst 18:30 Welkom 18:35 Kwaliteit van de CT, monitoring vanuit het RIVM Erik Bom, RIVM 19:05 Landelijke en regionale ontwikkelingen in de prenatale screening Marian Bakker 19:35 Eerste

Nadere informatie

Prenatale screening Down

Prenatale screening Down Gynaecologie / Verloskunde Prenatale screening Down algemene informatie Inhoud Wat leest u in deze brochure? Onderzoek naar Downsyndroom en lichamelijke afwijkingen Onderzoek naar Downsyndroom Wat is Downsyndroom?

Nadere informatie

Verloskundige zorg en kraamzorg

Verloskundige zorg en kraamzorg Verloskundige zorg en kraamzorg 2015 Verloskundige zorg en kraamzorg Gefeliciteerd met uw zwangerschap! Het krijgen van een kind is een bijzondere gebeurtenis. Om ervoor te zorgen dat u straks van uw kraamtijd

Nadere informatie

Maatschap Gynaecologie. Nekplooimeting en serumtest

Maatschap Gynaecologie. Nekplooimeting en serumtest Maatschap Gynaecologie Nekplooimeting en serumtest Datum en tijd U wordt (dag) (datum) om uur verwacht. Plaats Op de dag van de afspraak meldt u zich op de polikliniek Verloskunde/Gynaecologie. Volgt u

Nadere informatie

Vruchtwateronderzoek bij zwangerschap

Vruchtwateronderzoek bij zwangerschap Vruchtwateronderzoek bij zwangerschap Inhoudsopgave Inleiding... 1 Wat is vruchtwateronderzoek... 1 Wie komt in aanmerking voor een vruchtwaterpunctie... 2 Wanneer wordt de punctie gedaan... 2 Wie voert

Nadere informatie

Prenatale screening op Downsyndroom en lichamelijke afwijkingen

Prenatale screening op Downsyndroom en lichamelijke afwijkingen Prenatale screening op Downsyndroom en lichamelijke afwijkingen Definitieve versie 13-3-2007 1 INHOUD 1. Wat leest u in deze brochure? 2. Onderzoek naar Downsyndroom en lichamelijke afwijkingen 2.1 Onderzoek

Nadere informatie

In het kort. Welke testen zijn er mogelijk bij prenatale screening? Wat is prenatale screening?

In het kort. Welke testen zijn er mogelijk bij prenatale screening? Wat is prenatale screening? prenatale screening Inhoudsopgave In het kort 3 Wat is prenatale screening? 3 Welke testen zijn er mogelijk bij prenatale screening? 3 Bij welke zwangerschapsduur vindt prenatale screening plaats? 3 Wie

Nadere informatie

Prenatale screening: het berekenen van de kans op aangeboren afwijkingen in het begin van de zwangerschap. Afdeling Verloskunde/Gynaecologie

Prenatale screening: het berekenen van de kans op aangeboren afwijkingen in het begin van de zwangerschap. Afdeling Verloskunde/Gynaecologie Prenatale screening: het berekenen van de kans op aangeboren afwijkingen in het begin van de zwangerschap Afdeling Verloskunde/Gynaecologie In het kort De meeste kinderen worden gezond geboren, maar een

Nadere informatie

De Vruchtwaterpunctie

De Vruchtwaterpunctie 12 De Vruchtwaterpunctie Aangepaste informatie van folders geproduceerd door Guy s and St Thomas Hospital, Londen; Royal College of Obstetricians and Gynaecologists www.rcog.org.uk/index.asp?pageid=625

Nadere informatie

Verloskunde Prenatale diagnostiek

Verloskunde Prenatale diagnostiek Verloskunde Prenatale diagnostiek Onderzoeken naar aangeboren afwijkingen Belangrijke telefoonnummers Algemeen nummer UMCG (050) 361 61 61 U kunt hier terecht met algemene vragen over het UMCG. Bijvoorbeeld

Nadere informatie

De Vruchtwaterpunctie

De Vruchtwaterpunctie 12 De Vruchtwaterpunctie Aangepaste informatie van folders geproduceerd door Guy s and St Thomas Hospital, Londen; Royal College of Obstetricians and Gynaecologists www.rcog.org.uk/index.asp?pageid=625

Nadere informatie

Praktischeinformatie over de uitvoeringvan de NIPT in TRIDENT-2

Praktischeinformatie over de uitvoeringvan de NIPT in TRIDENT-2 Praktischeinformatie over de uitvoeringvan de NIPT in TRIDENT-2 Marian Bakker Bijscholingsbijeenkomst NIPT 21 maart 2017 Inhoud Aanvraag procedure Digitale aanvraag via Peridos Toestemmingsformulier Bloedafnameformulier

Nadere informatie

Nascholing Counseling NIPT. Prof. Dr. Eva Pajkrt

Nascholing Counseling NIPT. Prof. Dr. Eva Pajkrt Nascholing Counseling NIPT Prof. Dr. Eva Pajkrt Programma Wat Wie 1. Inleiding Prof. Dr. E. Pajkrt 2. TRIDENT-1 + TRIDENT-2 Dr. L. Henneman 3. Down-, edwards- en patausyndroom Dr. M. de Boer 4. Praktische

Nadere informatie

Echoscopie tijdens de zwangerschap

Echoscopie tijdens de zwangerschap Echoscopie tijdens de zwangerschap Echoscopie tijdens de zwangerschap Deze folder geeft algemene informatie over echoscopie tijdens de zwangerschap. Iedere zwangere vrouw krijgt standaard 2 echo-onderzoeken

Nadere informatie

Screening van pasgeborenen

Screening van pasgeborenen Screening van pasgeborenen Algemeen en prenataal Arjan Lock, arts M&G 6 november 2014 Disclosure belangen spreker (Potentiële) belangenverstrengeling Voor bijeenkomst mogelijk relevante relaties met bedrijven

Nadere informatie

Verloskundige zorg en kraamzorg

Verloskundige zorg en kraamzorg Stad Holland, een dijk van een zorgverzekeraar Verloskundige zorg en Kraamzorg 2015 Verloskundige zorg en kraamzorg Gefeliciteerd met uw zwangerschap! Het krijgen van een kind is een bijzondere gebeurtenis.

Nadere informatie

Prenatale array CGH Counseling en voorbeelden

Prenatale array CGH Counseling en voorbeelden Prenatale array CGH Counseling en voorbeelden Merel van Maarle,klinisch geneticus AMC Mariet Elting,klinisch geneticus VUmc Regionale bijeenkomst 17 december 2012 Stand van zaken VUmc/AMC Zwangerschap

Nadere informatie

Prenatale screening op Downsyndroom en lichamelijke afwijkingen. Algemene informatie

Prenatale screening op Downsyndroom en lichamelijke afwijkingen. Algemene informatie Prenatale screening op Downsyndroom en lichamelijke afwijkingen Algemene informatie Inhoud Wat leest u in deze brochure? Onderzoek naar Downsyndroom en lichamelijke afwijkingen Onderzoek naar Downsyndroom

Nadere informatie

man, vrouw en kind info voor de ouders Downsyndroomscreening

man, vrouw en kind info voor de ouders Downsyndroomscreening man, vrouw en kind info voor de ouders Downsyndroomscreening 01. Wat is het syndroom van Down? Het syndroom van Down (trisomie 21) is een afwijking in het erfelijk materiaal van de baby (de chromosomen).

Nadere informatie

Controles en onderzoeken in de zwangerschap. De eerste controle

Controles en onderzoeken in de zwangerschap. De eerste controle Controles en onderzoeken in de zwangerschap De onderwerpen die in dit document aan de orde komen zijn: De eerste controle Vervolgcontroles Bloedonderzoek Prenatale screening Prenatale diagnostiek Overige

Nadere informatie

Echoscopie tijdens de zwangerschap

Echoscopie tijdens de zwangerschap Echoscopie tijdens de zwangerschap Echoscopie tijdens de zwangerschap Deze folder geeft algemene informatie over echoscopie tijdens de zwangerschap. Iedere zwangere vrouw krijgt standaard 2 echo-onderzoeken

Nadere informatie