NIPT: praktische aspecten, eerste resultaten en een blik vooruit. Kornelia Neveling (PhD) en Lean Beulen (MD) 4 th November 2014

Save this PDF as:
 WORD  PNG  TXT  JPG

Maat: px
Weergave met pagina beginnen:

Download "NIPT: praktische aspecten, eerste resultaten en een blik vooruit. Kornelia Neveling (PhD) en Lean Beulen (MD) 4 th November 2014"

Transcriptie

1 NIPT: praktische aspecten, eerste resultaten en een blik vooruit Kornelia Neveling (PhD) en Lean Beulen (MD) 4 th November 2014

2 Inhoud Wat is NIPT? Hoe werkt NIPT? (van bloedafname tot testresultaat) Betrouwbaarheid NIPT Technische ontwikkelingen Klinische (proef)implementatie Counseling Eerste resultaten Een blik vooruit

3 Wat is NIPT?

4 NIPT Non-invasive prenatal testing niet-invasieve prenatale test bij vrouwen met verhoogd risico op T21/T18/T13 > prenataal onderzoek zonder invasieve ingreep (vlokkentest of vruchtwaterpunctie) mogelijk vermijden van kans op miskraam (3-5 op 1000 testen)

5 Wat is een trisomie? een gezond individu heeft 46 chromosomen in een cel (23 van moeder en 23 van vader) twee zijn geslachtschromosomen (XX of XY) 44 autosomen: chr 1 tot en met chr 22 (2x) > diploïd trisomie: 3 in plaats van 2 kopieën van een chromosoom foutje in celdeling van eicel of zaadcel vaak oorzaak van ernstige aandoening van het kind Trisomie 21 (downsyndroom) Trisomie 18 (edwardssyndroom) Trisomie 13 (patausyndroom)

6 Testen op een trisomie combinatietest: > bloedtest, nekplooimeeting, maternale leeftijd > bij verhoogd risico: vlokkentest of vruchtwaterpunctie nieuw: mogelijkheid om niet-invasief onderzoek te doen 1997

7 Wat betekent dat? chromosomen bestaan uit DNA in het bloed van de moeder: DNA-fragmenten van foetus > circulating cell-free fetal DNA (ccffdna) afkomstig van placenta sterk gefragmenteerd detecteerbaar vanaf week 5 van zwangerschap in totaal: ~2-10 ng ccf DNA per ml maternaal plasma slechts 5-15% hiervan is foetaal DNA dit foetaal DNA onderzoeken op T13/18/21 Hui and Bianchi, Trends in Genetics, 2013

8 Verschillen zijn heel subtiel Lo LYM, Chiu RWK. Nat Rev Genet, 2007;8: trisomie 21 monster % foetaal DNA chr 21 (%) chr 21 (-fold) chorionic villus 100% 50% 1.5 maternaal plasma ~10% 5% 1.05 de techniek moet heel subtiele verschillen kunnen detecteren minstens 10 million reads/monster

9 Hoe werkt het?

10 Bloed afnemen > DNA isoleren > sequencing placenta Maternal blood Fetal DNA Maternal DNA DNA isolatie sequencing (NGS) > bepalen van sequentie (lezen van DNA) > informatie interpreteren

11 DNA voorbereiden genomisch DNA DNA fragmenteren adaptoren binden sequentie amplificeren vertalen naar miljoenen losse reads AAGTGTTGAGGCTTTGTGATGCTTATATTATATTAGCAAACTTAGA

12 Lezen van de DNA we vergelijken de reads met een bekende referentie sequentie (mapping) chromosoom 3 Reference Genome chromosoom 15 > nu weten we waar de fragmenten DNA vandaan komen > voor elk chromosoom hebben we vele fragmenten DNA gelezen > en dan tellen we: hoeveel fragmenten DNA (reads) zien we per chromosoom?

13 Hoeveel reads per chromosoom? Bepalen of er van een chromosoom meer (of minder) materiaal aanwezig is, ten opzichte van een referentie set van normale individuen/plasma s subtiel verschil!!!

14 Goede analyse tools nodig: Z-score tellen van alle reads op een chromosoom corrigeren voor het gemiddelde aantal reads (referentie monsters) berekenen van een score Z-score = % reads (monster) gemiddelde % reads (ref) standaarddeviatie (ref) Z-score < -3 = loss/monosomie Z-score > 3 = gain/trisomie

15 Betere analyse tools beschikbaar vele verschillende opties: Z-score (Chiu et al., 2008) Normalized Chromosome Value (Sehnert et al., 2011) student s t -test-based (Jiang et al., 2012) WISECONDOR (Straver et al., 2013)... WISECONDOR: within sample copy number aberration detector

16 Resultaten WISECONDOR Voorbeeld 1 chromosoom 13 chromosoom 18 chromosoom 21 > Wisecondor kijkt naar alle autosomen, niet naar geslachtschromosomen

17 Voorbeeld 2 duplicatie 18p

18 Voorbeeld 3 15 Mb deletie op 11p

19 Hoe betrouwbaar zijn de resultaten?

20 Sensitiviteit en specificiteit N N T21 Sensitivity Specificity Chiu % 97,9% Ehrich % 99,8% Sensitiviteit: T21: 99% T18: 97% T13: 92% Palomaki ,6% 99,8% Sehnert % 100% Ashoor % 100% Bianchi % 100% Lau % 100% Norton % 99,97% Sparks % 100% Jiang % 100% Liang % 100% Nicolaides % 100%

21 Discrepanties Mogelijke oorzaken voor discrepanties: Technisch (waaronder lage foetale fractie) Vanishing twin Confined placental mosaicism (CPM, mozaïek beperkt tot placenta) Maternaal of foetaal mozaïek Maternale deletie of duplicatie Maternale geslachtschromosomale afwijking Maternale maligniteit Osborne et al., Prenat Diagn 2013, 33(6), NIPT (duplo metingen) trisomie 13 monosomie 18? vruchtwater 46,XY en normaal array profiel Postnatale analyse van placenta biopten normaal > Maternale tumor met cytogenetisch numerieke afwijkingen (#13 als #18)

22 Wat kunnen we (niet) met NIPT? test is gevalideerd voor - Trisomie 21 (downsyndroom) - Trisomie 18 (edwardssyndroom) - Trisomie 13 (patausyndroom) WISECONDOR detecteert ook andere trisomieën grotere partiële afwijkingen (>15 Mb) op dit moment niet mogelijk (in Nederland): detecteren van (veranderingen op) geslachtschromosomen kleine partiële afwijkingen (<15 Mb) ( ) niet mogelijk met deze test: triploïdie gebalanceerde translokaties puntmutaties in genen

23 Technische ontwikkelingen

24 April-September: sequencen op SOLiD 5500XL SOLiD 5500XL 32 sample op 1 flowchip run tijd 6-7 dagen

25 April-September: sequencen op SOLiD 5500XL Week 1 ma/di: Binnenkomst materiaal Afdraaien plasma scheiden van buffy coat di/woe: DNA isolatie do/vrij Library prep Week 2 ma/di epcr en starten NGS machine (5500xl) 3 wkn Runnen NGS machine Week 3 do/vrij Data analyse en interpretatie Week 4 ma Uitslag

26 Sinds September: 2 NextSeq 500 (Illumina) NextSeq500 (Illumina) max 24 samples op een run run tijd: 11 uur (!!!)

27 Sinds September: 2 NextSeq 500 (Illumina) Week 1 ma/di: Binnenkomst materiaal Afdraaien plasma scheiden van buffy coat di/woe: DNA isolatie / Library prep do vrij Library prep Runnen NGS machine (NextSeq) (>) 1 week Week 2 ma Data analyse en interpretatie di Uitslag

28 Verdere technische ontwikkelingen kleinere afwijkingen geslachtschromosomen meten (en verrijken) van foetale fractie ontwikkeling van sample tracking methode gebruiken van Streck -buizen (of andere buizen) hoeveelheid ccffdna kritisch: zichtbaar vanaf week 5 in zwangerschap percentage foetaal DNA voldoende vanaf ~ week 10 Wat kunt u doen? stuur (4x) 10ml EDTA bloed let op positie van de sticker! X X X X

Technische aspecten van Niet- Invasieve Prenatale Testen (NIPT)

Technische aspecten van Niet- Invasieve Prenatale Testen (NIPT) Technische aspecten van Niet- Invasieve Prenatale Testen (NIPT) Dr Brigitte Faas Laboratorium specialist Klinische Genetica SPN, bijscholing counseling NIPT Introductie 1997: Lo et al.: Free fetal DNA

Nadere informatie

Niet-Invasief Prenataal Testen: Nevenbevindingen, regionale en landelijke resultaten en een blik vooruit

Niet-Invasief Prenataal Testen: Nevenbevindingen, regionale en landelijke resultaten en een blik vooruit Niet-Invasief Prenataal Testen: Nevenbevindingen, regionale en landelijke resultaten en een blik vooruit Dr BHW Faas Laboratorium Specialist Klinische Genetica Radboud Universiteit Nijmegen Afdeling Genetica

Nadere informatie

NIPT. Nascholing Counseling NIPT

NIPT. Nascholing Counseling NIPT NIPT Dr. Kornelia Neveling Wetenschappelijk onderzoeker, afdeling Genetica, Radboudumc Dr. Dominique Smeets Laboratorium specialist, afdeling Genetica, Radboudumc Voorzitter bestuur SPN Nascholing Counseling

Nadere informatie

NIPT. K. Huijsdens Labspecialist klinische genetica, AMC. Nascholing Counseling NIPT

NIPT. K. Huijsdens Labspecialist klinische genetica, AMC. Nascholing Counseling NIPT NIPT K. Huijsdens Labspecialist klinische genetica, AMC Nascholing Counseling NIPT Disclosure belangen sprekers (potentiële) belangenverstrengeling Geen / zie hieronder Voor bijeenkomst mogelijk relevante

Nadere informatie

NIPT. Nascholing Counseling NIPT

NIPT. Nascholing Counseling NIPT NIPT Dr. Diane Van Opstal, Laboratoriumspecialist Klinische Genetica, Erasmus MC Dr. Maarten Knapen, gynaecoloog-perinatoloog Erasmus MC en medisch directeur SPSZN Nascholing Counseling NIPT Disclosure

Nadere informatie

NIPT. Nicole Corsten en Katelijne Bouman klinisch genetici UMCG, Isala en MCL. Nascholing Counseling NIPT

NIPT. Nicole Corsten en Katelijne Bouman klinisch genetici UMCG, Isala en MCL. Nascholing Counseling NIPT NIPT Nicole Corsten en Katelijne Bouman klinisch genetici UMCG, Isala en MCL Nascholing Counseling NIPT Disclosure belangen sprekers Disclosure: geen belangenverstrengeling Inhoud Wat, hoe en wanneer?

Nadere informatie

NIPT. Mireille Bekker Gynaecoloog-perinatoloog UMCU Medisch adviseur SPSRU

NIPT. Mireille Bekker Gynaecoloog-perinatoloog UMCU Medisch adviseur SPSRU NIPT Mireille Bekker Gynaecoloog-perinatoloog UMCU Medisch adviseur SPSRU Disclosure belangen sprekers (potentiële) belangenverstrengeling Geen / zie hieronder Voor bijeenkomst mogelijk relevante relaties

Nadere informatie

NIPT. Dr. Diane Van Opstal, Laboratoriumspecialist Klinische Genetica, Erasmus MC. Nascholing Counseling NIPT

NIPT. Dr. Diane Van Opstal, Laboratoriumspecialist Klinische Genetica, Erasmus MC. Nascholing Counseling NIPT NIPT Dr. Diane Van Opstal, Laboratoriumspecialist Klinische Genetica, Erasmus MC Nascholing Counseling NIPT Disclosure belangen sprekers (potentiële) belangenverstrengeling Geen Voor bijeenkomst mogelijk

Nadere informatie

Laboratorium techniek NIPT

Laboratorium techniek NIPT Laboratorium techniek NIPT Merryn Macville, laboratorium specialist klinische genetica 27 februari 2014 Invasieve prenatale diagnostiek 1966 Karyotypering amnioncellen 1970 1980 1990 2000 2010 Karyotypering

Nadere informatie

NIPT en de. TRIDENT studie. Overzicht. 24 maart 2014. -Prenatale screening (algemeen) -NIPT. 1. NIPT: korte inleiding 3/26/2014

NIPT en de. TRIDENT studie. Overzicht. 24 maart 2014. -Prenatale screening (algemeen) -NIPT. 1. NIPT: korte inleiding 3/26/2014 NIPT en de TRIDENT studie 24 maart 2014 Irene van Langen Klinisch geneticus UMCG Mede-onderzoeker TRIDENT Studie Overzicht -Prenatale screening (algemeen) -NIPT 1. NIPT: korte inleiding 2. NIPT in Nederland

Nadere informatie

NIPT Regionale bijeenkomst AMC

NIPT Regionale bijeenkomst AMC NIPT Regionale bijeenkomst AMC 28 maart 2014 Deskundigheidsbevordering NIPT i.v.m. counseling prenatale screening Marion van Hoorn perinatoloog & Lidewij Henneman senior onderzoeker Disclosure belangen

Nadere informatie

Wat is NIPT? Yvonne Arens, klinisch geneticus 27 februari 2013

Wat is NIPT? Yvonne Arens, klinisch geneticus 27 februari 2013 Wat is NIPT? Yvonne Arens, klinisch geneticus 27 februari 2013 Screening ivm chromosoomafwijkingen Waarom Screening op Chromosoomafwijkingen? Risico op een kind met: Mentale Retardatie en/of Verstandelijke

Nadere informatie

Uitkomsten van laboratoriumonderzoek

Uitkomsten van laboratoriumonderzoek 341 Uitkomsten van laboratoriumonderzoek C y t o g e n e t i s c h o n d e r z o e k Cytogenetisch onderzoek in vlokken en vruchtwater (en onder bijzondere omstandigheden soms in navelstrengbloed) levert

Nadere informatie

NIPT lang in verwachting: uitgerekende datum 1 april

NIPT lang in verwachting: uitgerekende datum 1 april NIPT lang in verwachting: uitgerekende datum 1 april Robert-Jan Galjaard Klinisch geneticus, laboratoriumspecialist klinische genetica Afdeling Klinische Genetica Erasmus MC, Rotterdam Introductie NIPT

Nadere informatie

NIPT: van TRIDENT-1 naar TRIDENT-2, waar staan we nu?

NIPT: van TRIDENT-1 naar TRIDENT-2, waar staan we nu? NIPT: van TRIDENT-1 naar TRIDENT-2, waar staan we nu? SPN bijeenkomst, november 2017 Van TRIDENT 1 naar TRIDENT 2 -Inleiding -Cijfers: landelijk-regionaal -Impressie werkzaamheden -Nevenbevindingen Dank

Nadere informatie

NIPT De niet-invasieve prenatale test voor trisomie

NIPT De niet-invasieve prenatale test voor trisomie NIPT De niet-invasieve prenatale test voor trisomie NIPT De niet-invasieve prenatale test voor trisomie Waarom NIPT? In België kunnen alle zwangere vrouwen die dit wensen het risico dat de foetus het syndroom

Nadere informatie

Onderzoek naar de gezondheid van je kindje... 2 Er zijn vijf soortem prenatale testen:... 2 Combinatietest Down-, edwards-, patausyndroom...

Onderzoek naar de gezondheid van je kindje... 2 Er zijn vijf soortem prenatale testen:... 2 Combinatietest Down-, edwards-, patausyndroom... Contents Onderzoek naar de gezondheid van je kindje.... 2 Er zijn vijf soortem prenatale testen:... 2 Combinatietest... 2 Down-, edwards-, patausyndroom... 2 Uitslag... 2... 3 Betrouwbaarheid... 3... 3

Nadere informatie

Als zwangeren kiezen voor prenatale screening naar

Als zwangeren kiezen voor prenatale screening naar Zorg NIPT, de niet-invasieve prenatale test Uitdagingen voor de toekomst Lidewij Henneman, G.C.M.L. (Lieve) Page-Christiaens en Dick Oepkes De niet-invasieve prenatale test (NIPT) is een nieuwe, accurate

Nadere informatie

Gespreksleidraad voor counselors prenatale screening. Informeren over NIPT

Gespreksleidraad voor counselors prenatale screening. Informeren over NIPT Gespreksleidraad voor counselors prenatale screening Informeren over NIPT Inhoudsopgave blz. 1 De kernboodschap: wat vertel je over de NIPT? 3 2 Achtergrondinformatie NIPT 3 2.1 De belangrijkste feiten

Nadere informatie

Deskundigheidsbevordering NIPT i.v.m. counseling prenatale screening

Deskundigheidsbevordering NIPT i.v.m. counseling prenatale screening Deskundigheidsbevordering NIPT i.v.m. counseling prenatale screening Programma: 1. Inleiding (10 minuten): recente ontwikkelingen rond NIPT, aandacht in de pers, belangstelling van publiek, toelichting

Nadere informatie

Resultaten TRIDENT-studie Symposium 23 mei 2016 Stichting Prenatale Screening Zuidwest Nederland

Resultaten TRIDENT-studie Symposium 23 mei 2016 Stichting Prenatale Screening Zuidwest Nederland Resultaten TRIDENT-studie Symposium 23 mei 2016 Stichting Prenatale Screening Zuidwest Nederland Diane Van Opstal, Laboratorium Specialist Klinische Genetica TRIDENT 1 april 2014: start of NIPT in the

Nadere informatie

Vraag het aan uw zorgverlener

Vraag het aan uw zorgverlener Een eenvoudig, veilig bloedonderzoek dat zeer gevoelige resultaten geeft Een geavanceerde niet-invasieve test voor de bepaling van foetale trisomie en evaluatie van het Y-chromosoom Vraag het aan uw zorgverlener

Nadere informatie

NIPT: praktische aspecten, eerste resultaten en een blik vooruit (II) Lean Beulen en Kornelia Neveling regionale bijeenkomst SPN d.d.

NIPT: praktische aspecten, eerste resultaten en een blik vooruit (II) Lean Beulen en Kornelia Neveling regionale bijeenkomst SPN d.d. NIPT: praktische aspecten, eerste resultaten en een blik vooruit (II) Lean Beulen en Kornelia Neveling regionale bijeenkomst SPN d.d. 4 november 2014 Proefimplementatie NIPT Vanwege verwachte impact van

Nadere informatie

Veranderingen in de counseling voor (en na) de combinatietest

Veranderingen in de counseling voor (en na) de combinatietest Veranderingen in de counseling voor (en na) de combinatietest Ilse Feenstra Klinisch geneticus Wat verandert er in de counseling voor de screening op trisomie? Wat & wanneer? Vanaf 1 april 2014: - Alle

Nadere informatie

Update NIPT sinds 1 april 2017

Update NIPT sinds 1 april 2017 Update NIPT sinds 1 april 2017 Dr. Lidewij Henneman Onderzoeker klinische genetica VU medisch centrum Regiobijeenkomst SPSRU sept 2017 Disclosure belangen sprekers (potentiële) belangenverstrengeling Geen

Nadere informatie

Counseling over QF-PCR en array. Caroline Bax en Eva Pajkrt, perinatologen VUMC en AMC

Counseling over QF-PCR en array. Caroline Bax en Eva Pajkrt, perinatologen VUMC en AMC Counseling over QF-PCR en array Caroline Bax en Eva Pajkrt, perinatologen VUMC en AMC Inleiding Conventionele chromosoom analyse wordt sinds de jaren 60 gebruikt. Cytogenetische diagnose: Aneuploidie (On)gebalanceerde

Nadere informatie

Cijfers NIPT. Sensitiviteit: Ontdekt de test alle foetussen met een afwijking?

Cijfers NIPT. Sensitiviteit: Ontdekt de test alle foetussen met een afwijking? Cijfers NIPT Cijfers NIPT Sensitiviteit: Ontdekt de test alle foetussen met een afwijking? De NIPT ontdekt ongeveer: 96 van de 100 (96%) foetussen met downsyndroom 87 van de 100 (87%) foetussen met edwardssyndroom

Nadere informatie

Verklarende Woordenlijst

Verklarende Woordenlijst 12 Verklarende Woordenlijst Gebaseerd op een woordenlijst die werd ontwikkeld door Londen IDEAS Genetic Knowledge Park aangepast volgens hun kwaliteitsnormen. Juli 2008 Vertaald door Mies Wits-Douw en

Nadere informatie

Prenataal testen met de NIPT

Prenataal testen met de NIPT ALGEMENE INFORMATIEFOLDER Prenataal testen met de NIPT Deze folder hoort bij een wetenschappelijke studie (TRIDENT-studie) van de Nederlandse Universitair Medische Centra 2014 www.meerovernipt.nl 1 In

Nadere informatie

Prenataal testen met de NIPT

Prenataal testen met de NIPT ALGEMENE INFORMATIEFOLDER Prenataal testen met de NIPT Deze folder hoort bij een wetenschappelijke studie (TRIDENT-studie) van de Nederlandse Universitair Medische Centra 2014 www.meerovernipt.nl 1 In

Nadere informatie

Niet invasieve prenatale testen: stand van zaken in Nederland. Lidewij Henneman, senior onderzoeker

Niet invasieve prenatale testen: stand van zaken in Nederland. Lidewij Henneman, senior onderzoeker Niet invasieve prenatale testen: stand van zaken in Nederland Lidewij Henneman, senior onderzoeker Symposium Eurocat / SPSNN 26 september 2014 Disclosure belangen spreker (potentiële) belangenverstrengeling

Nadere informatie

NIPT. Niet-invasieve prenatale test in een genetisch laboratorium. Kris Van Den Bogaert Centrum voor Menselijke Erfelijkheid Leuven, België

NIPT. Niet-invasieve prenatale test in een genetisch laboratorium. Kris Van Den Bogaert Centrum voor Menselijke Erfelijkheid Leuven, België NIPT Niet-invasieve prenatale test in een genetisch laboratorium Kris Van Den Bogaert Centrum voor Menselijke Erfelijkheid Leuven, België avondseminarie UCLL, 28 april 2016 NIPT: alternatief voor combinatietest,

Nadere informatie

Prenataal testen met de NIPT

Prenataal testen met de NIPT INFORMATIEFOLDER Prenataal testen met de NIPT voor zwangeren met verhoogd risico op een kind met down-, edwards-, of patausyndroom Deze folder hoort bij een wetenschappelijke studie (TRIDENT-1 studie)

Nadere informatie

ESPRIT studie. Niet-invasieveprenatale testen (NIPT): gevolgen voor counseling, geïnformeerde besluitvorming en het prenatale screeningsbeleid

ESPRIT studie. Niet-invasieveprenatale testen (NIPT): gevolgen voor counseling, geïnformeerde besluitvorming en het prenatale screeningsbeleid Niet-invasieveprenatale testen (NIPT): gevolgen voor counseling, geïnformeerde besluitvorming en het prenatale screeningsbeleid Ethical Social Psychological Research for Implementing screening for fetal

Nadere informatie

Valkuilen bij niet-invasieve foetale RhD typering Florentine F. Thurik

Valkuilen bij niet-invasieve foetale RhD typering Florentine F. Thurik Valkuilen bij niet-invasieve foetale RhD typering Florentine F. Thurik Arts onderzoeker Afdeling Experimentele Immunohematologie Sanquin Research, Amsterdam, The Netherlands f.thurik@sanquin.nl Prenatale

Nadere informatie

NIPT: Een nieuwe mogelijkheid voor prenatale screening. Prof.dr. Martina Cornel www.vumc.com/researchcommunitygenetics

NIPT: Een nieuwe mogelijkheid voor prenatale screening. Prof.dr. Martina Cornel www.vumc.com/researchcommunitygenetics NIPT: Een nieuwe mogelijkheid voor prenatale screening Prof.dr. Martina Cornel www.vumc.com/researchcommunitygenetics Disclosure belangen spreker (potentiële) belangenverstrengeling Zie hieronder Voor

Nadere informatie

Verklarende woordenlijst

Verklarende woordenlijst 12 Verklarende woordenlijst Gebaseerd op een woordenlijst die werd ontwikkeld door Londen IDEAS Genetic Knowledge Park aangepast volgens hun kwaliteitsnormen. Januari 2008 Gesteund door EuroGentest, NoE

Nadere informatie

Infobrochure. Prenatale screening. Dienst: Gynaecologie-verloskunde Tel: mensen zorgen voor mensen

Infobrochure. Prenatale screening. Dienst: Gynaecologie-verloskunde Tel: mensen zorgen voor mensen Infobrochure Prenatale screening Dienst: Gynaecologie-verloskunde Tel: 011 826 100 mensen zorgen voor mensen 2 Downsyndroom (trisomie 21) De meeste pasgeborenen zijn gezond. Elke baby heeft echter een

Nadere informatie

Gespreksleidraad NIPT voor counselors. Prenatale screening op down-, edwards- en patausyndroom Maart 2017

Gespreksleidraad NIPT voor counselors. Prenatale screening op down-, edwards- en patausyndroom Maart 2017 Gespreksleidraad NIPT voor counselors Prenatale screening op down-, edwards- en patausyndroom Maart 2017 2 Inhoudsopgave 1 Inleiding 4 2 Kernboodschap 4 3 Verdiepende informatie NIPT 5 3.1 Wetenschappelijke

Nadere informatie

Inhoud. Combinatietest Structureel echoscopisch onderzoek Geavanceerd ultrageluid onderzoek NIPT Invasieve diagnostiek Vruchtwaterpunctie Vlokkentest

Inhoud. Combinatietest Structureel echoscopisch onderzoek Geavanceerd ultrageluid onderzoek NIPT Invasieve diagnostiek Vruchtwaterpunctie Vlokkentest Inhoud Combinatietest Structureel echoscopisch onderzoek Geavanceerd ultrageluid onderzoek NIPT Invasieve diagnostiek Vruchtwaterpunctie Vlokkentest Prenatale screening Doel: Aanstaande ouders die dat

Nadere informatie

Position Paper. Prenatale Screening

Position Paper. Prenatale Screening Position Paper Prenatale Screening Vastgesteld door de Werkgroep Genetisch Onderzoek (2011/2012) Geaccordeerd door het VSOP bestuur, februari 2012 Achtergrond In 2001 en 2004 verschenen rapporten van de

Nadere informatie

man, vrouw en kind info voor de ouders Downsyndroomscreening

man, vrouw en kind info voor de ouders Downsyndroomscreening man, vrouw en kind info voor de ouders Downsyndroomscreening 01. Wat is het syndroom van Down? Het syndroom van Down (trisomie 21) is een afwijking in het erfelijk materiaal van de baby (de chromosomen).

Nadere informatie

Prenataal testen voor genetische aandoeningen begrijpen. Professor Martina Cornel & Professor Heather Skirton Gen-Equip Project.

Prenataal testen voor genetische aandoeningen begrijpen. Professor Martina Cornel & Professor Heather Skirton Gen-Equip Project. Prenataal testen voor genetische aandoeningen begrijpen Professor Martina Cornel & Professor Heather Skirton Gen-Equip Project. Prenataal testen verwijst naar het testen van de foetus tijdens de zwangerschap

Nadere informatie

Non Invasieve Prenatale Test (NIPT) NIPT-bijeenkomst, 13 november 2013

Non Invasieve Prenatale Test (NIPT) NIPT-bijeenkomst, 13 november 2013 Non Invasieve Prenatale Test (NIPT) NIPT-bijeenkomst, 13 november 2013 Dr. Maarten Knapen medisch directeur Stichting Prenatale Screening Zuidwest Nederland gynaecoloog-perinatoloog ErasmusMC Rotterdam

Nadere informatie

De NIPT binnen de prenatale screening: waar staan we en waar gaan we naar toe? Katelijne Bouman, klinisch geneticus UMCG en Isala

De NIPT binnen de prenatale screening: waar staan we en waar gaan we naar toe? Katelijne Bouman, klinisch geneticus UMCG en Isala De NIPT binnen de prenatale screening: waar staan we en waar gaan we naar toe? Katelijne Bouman, klinisch geneticus UMCG en Isala Introductie Sinds 2014 is de NIPT ( in het kader van wetenschappelijk onderzoek)

Nadere informatie

Downsyndroomscreening

Downsyndroomscreening info voor de ouders Downsyndroomscreening 01. Wat is het syndroom van Down? Het syndroom van Down (trisomie 21) is een afwijking in het erfelijk materiaal van de baby (de chromosomen). Een baby met het

Nadere informatie

Wie is er genetisch normaal? Centrum voor Menselijke Erfelijkheid

Wie is er genetisch normaal? Centrum voor Menselijke Erfelijkheid Wie is er genetisch normaal? Koen Devriendt Centrum voor Menselijke Erfelijkheid prenatale diagnose klassieke karyotypering variatie is minimaal merker chromosoom translocatie inversie variabele banden

Nadere informatie

trisomie 13 en trisomie 18: de prenatale diagnose

trisomie 13 en trisomie 18: de prenatale diagnose trisomie 13 en trisomie 18: de prenatale diagnose Katelijne Bouman, klinisch geneticus Afdeling Genetica Universitair Medisch Centrum Groningen Trisomie 13 en 18: de prenatale diagnose Geboorteprevalentie

Nadere informatie

Samenvatting. Huidige prenatale screening

Samenvatting. Huidige prenatale screening Samenvatting De afgelopen jaren zijn nieuwe tests ontwikkeld om bij een foetus chromosoomafwijkingen op te sporen, zoals bijvoorbeeld het syndroom van Down. Kenmerk van deze tests is dat ze niet invasief

Nadere informatie

Vlokkentest of vruchtwaterpunctie

Vlokkentest of vruchtwaterpunctie Vlokkentest of vruchtwaterpunctie U overweegt een vlokkentest of vruchtwaterpunctie te laten doen. Of u heeft in overleg met uw arts besloten om een van deze onderzoeken te ondergaan. In deze folder vindt

Nadere informatie

Risicoberekening voor TRISOMIE 21 in het eerste trimester

Risicoberekening voor TRISOMIE 21 in het eerste trimester Risico op trisomie 21 Centrum Menselijke Erfelijkheid Risicoberekening voor TRISOMIE 21 in het eerste trimester Hoewel de meeste baby s gezond zijn, heeft elke baby een kleine kans op een lichamelijke

Nadere informatie

Wat verandert er in de counseling?

Wat verandert er in de counseling? Wat verandert er in de counseling? [NAAM SPREKER] Nascholing counseling NIPT Disclosure belangen sprekers (potentiële) belangenverstrengeling Geen / zie hieronder Voor bijeenkomst mogelijk relevante relaties

Nadere informatie

Prenatale screening: de combinatietest Kansbepaling vroeg in de zwangerschap op het syndroom van Down

Prenatale screening: de combinatietest Kansbepaling vroeg in de zwangerschap op het syndroom van Down Prenatale screening: de combinatietest Kansbepaling vroeg in de zwangerschap op het syndroom van Down Albert Schweitzer ziekenhuis polikliniek Gynaecologie april 2012 Pavo 0530 Inleiding Iedere ouder wenst

Nadere informatie

Prenatale screening: de combinatietest. Kansbepaling vroeg in de zwangerschap op het syndroom van Down, Edwardssyndroom en Patausyndroom

Prenatale screening: de combinatietest. Kansbepaling vroeg in de zwangerschap op het syndroom van Down, Edwardssyndroom en Patausyndroom Prenatale screening: de combinatietest Kansbepaling vroeg in de zwangerschap op het syndroom van Down, Edwardssyndroom en Patausyndroom Inleiding Iedere ouder wenst een gezond kind. Helaas worden soms

Nadere informatie

Nekplooimeting. gecombineerd met vroege bloedtest in de zwangerschap mogelijk tot 13 6/7 weken zwangerschapsduur. Afdeling Verloskunde/Gynaecologie

Nekplooimeting. gecombineerd met vroege bloedtest in de zwangerschap mogelijk tot 13 6/7 weken zwangerschapsduur. Afdeling Verloskunde/Gynaecologie Nekplooimeting gecombineerd met vroege bloedtest in de zwangerschap mogelijk tot 13 6/7 weken zwangerschapsduur Afdeling Verloskunde/Gynaecologie In het kort Deze folder geeft informatie over de echoscopische

Nadere informatie

Draaiboek TRIDENT studie Trial by Dutch laboratories for Evaluation of Non-Invasive Prenatal Testing. Aanbod NIPT

Draaiboek TRIDENT studie Trial by Dutch laboratories for Evaluation of Non-Invasive Prenatal Testing. Aanbod NIPT Draaiboek TRIDENT studie Trial by Dutch laboratories for Evaluation of Non-Invasive Prenatal Testing Aanbod NIPT Dit protocol is bedoeld voor zorgprofessionals die werkzaam zijn in de Prenatale Diagnostische

Nadere informatie

Wat verandert er in de counseling?

Wat verandert er in de counseling? Wat verandert er in de counseling? Dr. Janneke Gitsels Nascholing counseling NIPT Disclosure belangen sprekers (potentiële) belangenverstrengeling Geen / zie hieronder Voor bijeenkomst mogelijk relevante

Nadere informatie

Gezondheidsraad NIPT en de screening op aangeboren afwijkingen

Gezondheidsraad NIPT en de screening op aangeboren afwijkingen Gezondheidsraad NIPT en de screening op aangeboren afwijkingen Achtergronddocument bij Prenatale screening A16/05 NIPT en de screening op aangeboren afwijkingen Achtergronddocument bij Prenatale screening

Nadere informatie

Chromosoomonderzoek bij herhaalde miskramen

Chromosoomonderzoek bij herhaalde miskramen Chromosoomonderzoek bij herhaalde miskramen Een miskraam betekent vrijwel altijd een teleurstelling voor een vrouw en haar partner. Al snel zal de vraag naar de oorzaak gesteld worden; na een tweede miskraam

Nadere informatie

PUBLICATIE VAN DE HOGE GEZONDHEIDSRAAD nr. 8912

PUBLICATIE VAN DE HOGE GEZONDHEIDSRAAD nr. 8912 PUBLICATIE VAN DE HOGE GEZONDHEIDSRAAD nr. 8912 Implementatie van niet-invasieve prenatale genetische screening van trisomie 21 (Syndroom van Down) in de Belgische zorgpraktijk In this scientific advisory

Nadere informatie

Prenatale array CGH Counseling en voorbeelden

Prenatale array CGH Counseling en voorbeelden Prenatale array CGH Counseling en voorbeelden Merel van Maarle,klinisch geneticus AMC Mariet Elting,klinisch geneticus VUmc Regionale bijeenkomst 17 december 2012 Stand van zaken VUmc/AMC Zwangerschap

Nadere informatie

ONDERZOEK IN VLOKKEN OF VRUCHTWATER BIJ ECHOAFWIJKINGEN

ONDERZOEK IN VLOKKEN OF VRUCHTWATER BIJ ECHOAFWIJKINGEN ONDERZOEK IN VLOKKEN OF VRUCHTWATER BIJ ECHOAFWIJKINGEN ONDERZOEK IN VLOKKEN E VRUCHTWATER BIJ ECHOAFWIJKINGEN Afdeling Genetica UMCG 2 Onderzoek in vlokken of in vruchtwater bij echoafwijkingen. U bent

Nadere informatie

NIPT Niet-Invasieve Prenatale Test: Technische en klinische aspecten

NIPT Niet-Invasieve Prenatale Test: Technische en klinische aspecten NIPT Niet-Invasieve Prenatale Test: Technische en klinische aspecten Hilde VAN ESCH Centrum voor Menselijke Erfelijkheid Leuven, België Leuven, 15 oktober 2016 www.uzleuven.be/nipt cme.nipt@uzleuven.be

Nadere informatie

Hoe kijken we naar het DNA van een patiënt?

Hoe kijken we naar het DNA van een patiënt? Hoe kijken we naar het DNA van een patiënt? Ies Nijman UMC Utrecht Dept of Genetics, Centre for Molecular Medicine Center for Personalized Cancer Treatment (CPCT), Hartwig Medical Foundation 1994 DNA sequenties,

Nadere informatie

Infoblad. Chromosoomafwijkingen. Chromosoomafwijkingen, wat zijn dat eigenlijk? En waardoor ontstaan ze? Hierover lees je in dit infoblad.

Infoblad. Chromosoomafwijkingen. Chromosoomafwijkingen, wat zijn dat eigenlijk? En waardoor ontstaan ze? Hierover lees je in dit infoblad. Chromosoomafwijkingen Chromosoomafwijkingen, wat zijn dat eigenlijk? En waardoor ontstaan ze? Hierover lees je in dit infoblad. Chromosomen In het lichaam zitten heel veel cellen. De cellen zijn de bouwstenen

Nadere informatie

Prenatale screening en diagnostiek

Prenatale screening en diagnostiek Dienst Gynaecologie Verloskunde Informatie voor de ouders Prenatale screening en diagnostiek De term prenatale diagnostiek wordt vaak als een overkoepelende term gebruikt voor alle mogelijke testen en

Nadere informatie

TRIDENT studie. Mireille Bekker Gynaecoloog Radboud umc

TRIDENT studie. Mireille Bekker Gynaecoloog Radboud umc TRIDENT studie Mireille Bekker Gynaecoloog Radboud umc Historie April 2011 oprichting NIPT consortium Nederland TRIDENT studie: implementatie van lab tot uitslag ESPRIT studie: ethisch, economisch, maatschappelijk

Nadere informatie

PrenataleScreening in Nederland. TRIDENT-1 & TRIDENT-2 studies. Marian Bakker SPSNN

PrenataleScreening in Nederland. TRIDENT-1 & TRIDENT-2 studies. Marian Bakker SPSNN PrenataleScreening in Nederland TRIDENT-1 & TRIDENT-2 studies Marian Bakker SPSNN Disclosure (Potentiële) belangenverstrengeling Voor bijeenkomst mogelijk relevante relaties met bedrijven Sponsoring of

Nadere informatie

De introductie van NIPT als eerste screeningstest in Nederland. Lidewij Henneman, senior onderzoeker Community Genetics

De introductie van NIPT als eerste screeningstest in Nederland. Lidewij Henneman, senior onderzoeker Community Genetics De introductie van NIPT als eerste screeningstest in Nederland Lidewij Henneman, senior onderzoeker Community Genetics Symposium Vervolmaakte Mens - 26 september 2016 Disclosure belangen spreker (potentiële)

Nadere informatie

Adviesrichtlijn voor patiënten voor reproductieve genetica. Educatieve inhoud afkomstig van

Adviesrichtlijn voor patiënten voor reproductieve genetica. Educatieve inhoud afkomstig van Adviesrichtlijn voor patiënten voor reproductieve Educatieve inhoud afkomstig van 3 12 37 IVF en embryo-ontwikkeling 44 51 54 57 Deze adviesrichtlijn is bedoeld voor zorgverleners. De richtlijn bevat basisinformatie

Nadere informatie

Niet Invasieve Prenatale Test (NIPT)

Niet Invasieve Prenatale Test (NIPT) Niet Invasieve Prenatale Test (NIPT) T +32(0)89 32 50 50 F +32(0)89 32 79 00 info@zol.be Campus Sint-Jan Schiepse bos 6 B 3600 Genk Campus Sint-Barbara Bessemerstraat 478 B 3620 Lanaken Medisch Centrum

Nadere informatie

De ins en outs van de. Eerste trimester combinatietest. Drs. Jacqueline Siljee

De ins en outs van de. Eerste trimester combinatietest. Drs. Jacqueline Siljee De ins en outs van de Eerste trimester combinatietest Drs. Jacqueline Siljee Projectmanager referentie laboratorium voor downsyndroom screening Infectieziekten onderzoek, Diagnostiek en Screening - IDS

Nadere informatie

NON-INVASIEVE PRENATALE TEST. Versie 1.0

NON-INVASIEVE PRENATALE TEST. Versie 1.0 NON-INVASIEVE PRENATALE TEST Versie 1.0 Datum Goedkeuring 31-05-2013 Methodiek Consensus based Discipline Monodisciplinair Verantwoording NVOG Inhoudsopgave Inleiding...1 Prenatale screening en diagnostiek

Nadere informatie

DEEL 1. VOORBEREIDEN OP DE IMPLEMENTATIE VAN NIET-INVASIEVE PRENATALE SCREENING

DEEL 1. VOORBEREIDEN OP DE IMPLEMENTATIE VAN NIET-INVASIEVE PRENATALE SCREENING De invoering van de Niet-Invasieve Prenatale Test (NIPT) heeft wereldwijd een grote verandering teweeg gebracht in de prenatale zorg. NIPT is een accurate en veilige prenatale test waarbij bloed van de

Nadere informatie

High through put automatisering in de Genetica. Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 19 11 2014

High through put automatisering in de Genetica. Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 19 11 2014 High through put automatisering in de Genetica Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 19 11 2014 Inleiding Wie? Wat? Hoe? Automatisering / Robotisering Toekomst plannen Medewerkers Afdeling Genetica

Nadere informatie

Echo onderzoek tijdens de zwangerschap De termijnecho, combinatietest en de 20 weken echo

Echo onderzoek tijdens de zwangerschap De termijnecho, combinatietest en de 20 weken echo 12-12-2016 607 Echo onderzoek tijdens de zwangerschap De termijnecho, combinatietest en de 20 weken echo Elke zwangere in Almere mag gebruik maken van 2 echo-onderzoeken: een termijnecho in het begin van

Nadere informatie

Maatschap Gynaecologie. Nekplooimeting en serumtest

Maatschap Gynaecologie. Nekplooimeting en serumtest Maatschap Gynaecologie Nekplooimeting en serumtest Datum en tijd U wordt (dag) (datum) om uur verwacht. Plaats Op de dag van de afspraak meldt u zich op de polikliniek Verloskunde/Gynaecologie. Volgt u

Nadere informatie

Niet Invasieve Prenatale Test

Niet Invasieve Prenatale Test Niet Invasieve Prenatale Test Ellen Roets Prenatale diagnostiek UZ Gent Studiedag Vroedvrouwen NVKVV Kursaal Oostende 16 maart 2015 NIPT Downscreening : wat we hadden Principe Valkuilen Huidige situatie

Nadere informatie

Chapter 11. Nederlandse samenvatting

Chapter 11. Nederlandse samenvatting Chapter 11 Nederlandse samenvatting DOELSTELLING VAN DIT PROEFSCHRIFT Prenatale diagnostiek wordt routinematig aangeboden aan alle zwangere vrouwen, die een verhoogd risico hebben op het krijgen van een

Nadere informatie

VKGL kwaliteitscommissie_veldnorm

VKGL kwaliteitscommissie_veldnorm Reden voor toelichting: Als richtlijnen voor de constitutionele Cytogenetica worden de Europese richtlijnen van de ECA (European Cytogeneticists Association) aangehouden: General Guidelines and Quality

Nadere informatie

Combinatietest: interpretatie kansuitslagen. Melanie Engels, screeningscoördinator, VUmc

Combinatietest: interpretatie kansuitslagen. Melanie Engels, screeningscoördinator, VUmc Combinatietest: interpretatie kansuitslagen Melanie Engels, screeningscoördinator, VUmc Uitslag Onderwerpen Combinatietest Test karakteristieken Achtergrond kansberekening Beleid bij onverwachte bevindingen

Nadere informatie

De Combinatietest. Sylvia Schaefer, arts-echoscopist, VUmc

De Combinatietest. Sylvia Schaefer, arts-echoscopist, VUmc De Combinatietest Sylvia Schaefer, arts-echoscopist, VUmc De Combinatietest Kansbepalingstest Screening op Down-syndroom AD 9-14 weken Geen risico s Downsyndroom Trisomie 21 Vernoemd naar dr. John Langdon

Nadere informatie

Cover Page. The handle http://hdl.handle.net/1887/25414 holds various files of this Leiden University dissertation

Cover Page. The handle http://hdl.handle.net/1887/25414 holds various files of this Leiden University dissertation Cover Page The handle http://hdl.handle.net/1887/25414 holds various files of this Leiden University dissertation Author: Verweij, Joanne Title: NIPT : non-invasive prenatal testing : towards implementation

Nadere informatie

Er zijn twee onderzoeken mogelijk: 1. Met de combinatietest wordt onderzocht of er een verhoogde kans bestaat dat uw ongeboren kind Downsyndroom

Er zijn twee onderzoeken mogelijk: 1. Met de combinatietest wordt onderzocht of er een verhoogde kans bestaat dat uw ongeboren kind Downsyndroom Prenatale screening op Downsyndroom en lichamelijke afwijkingen INHOUD 1. Wat leest u in deze brochure? 2. Onderzoek naardownsyndroomen lichamelijke afwijkingen 2.1 Onderzoek naar Downsyndroom 2.2 Onderzoek

Nadere informatie

De Voorzitter van de Tweede Kamer der Staten-Generaal Postbus 20018 2500 EA DEN HAAG. Datum 1 maart 2016 Betreft stand van zaken prenatale screening

De Voorzitter van de Tweede Kamer der Staten-Generaal Postbus 20018 2500 EA DEN HAAG. Datum 1 maart 2016 Betreft stand van zaken prenatale screening > Retouradres Postbus 20350 2500 EJ Den Haag De Voorzitter van de Tweede Kamer der Staten-Generaal Postbus 20018 2500 EA DEN HAAG Bezoekadres Parnassusplein 5 2511 VX Den Haag www.rijksoverheid.nl Bijlage(n)

Nadere informatie

NIPT Niet Invasieve Prenatale Test: Technische en klinische aspecten

NIPT Niet Invasieve Prenatale Test: Technische en klinische aspecten NIPT Niet Invasieve Prenatale Test: Technische en klinische aspecten Nathalie BRISON, PhD Hilde VAN ESCH, MD, PhD Centrum voor Menselijke Erfelijkheid Leuven, België Leuven, 10 maart 2016 www.uzleuven.be/nipt

Nadere informatie

Niet-Invasieve Prenatale Test (NIPT): Nieuwe mogelijkheden, nieuwe uitdagingen

Niet-Invasieve Prenatale Test (NIPT): Nieuwe mogelijkheden, nieuwe uitdagingen Niet-Invasieve Prenatale Test (NIPT): Nieuwe mogelijkheden, nieuwe uitdagingen Bachelorproef aangeboden tot het verkrijgen van het diploma bachelor vroedkunde Caroline Sleewagen Interne promotor: Loes

Nadere informatie

De Vruchtwaterpunctie

De Vruchtwaterpunctie 12 De Vruchtwaterpunctie Aangepaste informatie van folders geproduceerd door Guy s and St Thomas Hospital, Londen; Royal College of Obstetricians and Gynaecologists www.rcog.org.uk/index.asp?pageid=625

Nadere informatie

Echo onderzoek tijdens de zwangerschap De termijnecho, combinatietest en de 20 weken echo

Echo onderzoek tijdens de zwangerschap De termijnecho, combinatietest en de 20 weken echo Echo onderzoek tijdens de zwangerschap De termijnecho, combinatietest en de 20 weken echo Elke zwangere in Almere mag gebruik maken van 2 echo-onderzoeken: een termijnecho in het begin van de zwangerschap

Nadere informatie

Copyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

Copyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings De meeste organismen hebben een twee sets chromosomen, met daarop informatie voor alle eigenschappen van dat organisme (diploid) Deze erfelijke informatie noemen we het genotype Hoe deze erfelijke informatie

Nadere informatie

De Vruchtwaterpunctie

De Vruchtwaterpunctie 12 De Vruchtwaterpunctie Aangepaste informatie van folders geproduceerd door Guy s and St Thomas Hospital, Londen; Royal College of Obstetricians and Gynaecologists www.rcog.org.uk/index.asp?pageid=625

Nadere informatie

Opsporen van afwijkingen bij de baby in het eerste trimester van de zwangerschap PATIËNTENINFO. Gynaecologie

Opsporen van afwijkingen bij de baby in het eerste trimester van de zwangerschap PATIËNTENINFO. Gynaecologie PATIËNTENINFO Opsporen van afwijkingen bij de baby in het eerste trimester van de zwangerschap 12-weken-echografie (met nekplooimeting) en NIPT Gynaecologie INHOUD CONTACTGEGEVENS 1. Soorten afwijkingen

Nadere informatie

Screening van pasgeborenen

Screening van pasgeborenen Screening van pasgeborenen Algemeen en prenataal Arjan Lock, arts M&G 6 november 2014 Disclosure belangen spreker (Potentiële) belangenverstrengeling Voor bijeenkomst mogelijk relevante relaties met bedrijven

Nadere informatie

NIPT: dynamiek & ethiek van prenatale screening. 31 maart 2014 SPSZN - Rotterdam dr mr Antina de Jong - Health, Ethics & Society

NIPT: dynamiek & ethiek van prenatale screening. 31 maart 2014 SPSZN - Rotterdam dr mr Antina de Jong - Health, Ethics & Society NIPT: dynamiek & ethiek van prenatale screening 31 maart 2014 SPSZN - Rotterdam dr mr Antina de Jong - Inhoud Context prenatale screening NIPT: 3 scenario s Dubbele doelstelling prenatale screening De

Nadere informatie

Samenvatting. Huidig programma en criteria voor screening

Samenvatting. Huidig programma en criteria voor screening Samenvatting Technologische ontwikkelingen maken het in toenemende mate mogelijk om al vroeg in de zwangerschap eventuele afwijkingen bij de foetus op te sporen. Ook zijn nieuwe testen beschikbaar die

Nadere informatie

In het kort. Welke testen zijn er mogelijk bij prenatale screening? Wat is prenatale screening?

In het kort. Welke testen zijn er mogelijk bij prenatale screening? Wat is prenatale screening? prenatale screening Inhoudsopgave In het kort 3 Wat is prenatale screening? 3 Welke testen zijn er mogelijk bij prenatale screening? 3 Bij welke zwangerschapsduur vindt prenatale screening plaats? 3 Wie

Nadere informatie

Prenatale screening. Gynaecologie en verloskunde

Prenatale screening. Gynaecologie en verloskunde Prenatale screening Gynaecologie en verloskunde Wat is prenatale screening? De meeste kinderen worden gezond geboren. Een klein percentage (3 4 %) heeft echter bij de geboorte een aangeboren aandoening.

Nadere informatie