Bio informatica Eline van Overbeeke

Maat: px
Weergave met pagina beginnen:

Download "Bio informatica Eline van Overbeeke 2011-2012"

Transcriptie

1 Bio informatica Eline van Overbeeke Biologische databanken = archieven met consistente data die worden opgeslagen op uniforme en efficiënte manier 2 soorten: Primaire / archiefdatabank Bevatten informatie en annotatie van DNA en proteïnesequenties, DNA en proteïnestructuren en DNA en proteïne expressieprofielen Secundaire / afgeleide databanken Bevatten resultaten van analyses op primaire bronnen, inclusief informatie over sequentiepatronen of motieven, polymorfismen en mutaties, en evolutionaire verwantschappen Data analyse = extraheren van betekenisvolle informatie uit massa gegevens Databanken Nucleotide sequence databases Nucleotide sequence databases = collectie van alle publiek beschikbare nucleotidesequenties Vb: EMBL, NCBI Flatfile Flatfile = tekstbestand met karakters zonder opmaak Genbank formaat 3 componenten: Header: algemene informatie Features: hoofdkenmerken CDS / Coding Sequence: join ( X Y ) geeft aantal exonen X = base waar exon start Y = base waar exon eindigt Sequentie Bevat ook vaak een tabel/grafiek 1

2 FASTA formaat 3 componenten: > : duidt aan waar nieuwe sequentie begint Sequence identifier: unieke code Sequentie NCBI NCBI = National Center for Biotechnology Information Exercise 1 NCBI-notepad-artemis Find publication in PubMed with ID Ga naar pubmed, laat database op pubmed staan en geef in. Geeft: Alternatively spliced transcripts from the Drosophila eif4e gene produce two different Cap-binding proteins. Go to nucleotide via links Klik rechts onderaan op nucleotide Geeft: Drosophila melanogaster eukaryotic initiation factor 4E (eif4e) gene, alternative splice products, complete cds GenBank: U Display Fasta, GenBank, and Graphics Te veranderen links boven aan bij siplay settings Download GenBank formatted flatfile Klik op send complete record, file, Genbank opslaanals txt file.. door bij computer dit file te selecteren en bij organize: change name Open NotePad++ (computers ghb: notepad) Open de file Visualize/edit/analyze a GenBank-formatted sequence file locally: Example: open the GenBank file with the Artemis software - launch Artemis using Java Web Start Google: artemis sanger eerste link Klik op download Artemis for windows Open nu de file door naar file manager te gaan en op all files te klikken, hierna kan je de file zoeken in je bastanden en openen. - Select CDS for product 4E-II and Create->Exon Features Nu boven aan: Select al CDS features Create exon features Artemis has some basic sequence analysis features - example: plot the GC Content (%) along the sequence Bovenaan: graph GC Content % 2

3 In Artemis you can also create new features and edit features Aanmaak nieuw exon feature van kleinste exon Create: New Feature Key: exon Location: EMBL EMBL = European Molecular Biology Laboratory Verschil met GenBank: indeling EMBL ook bruikbaar in Artemis Exercise 2 Find the corresponding record in the EMBL nucleotide sequence database Download in EMBL format Ga naar EMBL via google.. typ in de bovenste balk bij EMBL Klik op Nucleotides Sequences Klik op in EMBL format Weer opslaan als txt, kan weer openen in artemis What are the differences between GenBank and EMBL format? GENBANK EMBL 3

4 RefSeq RefSeq = gecureerde secundaire database met als doel een begrijpbare, geïntegreerde, non redundante set van sequenties aan te bieden Doel: referentiesequentie voor elk molecule in centraal dogma DNA, RNA en proteïnen Nucleotide en proteïnesequenties zijn expliciet gelinked Distinct accession number: 2 letters _ 6 cijfers 2 types: - NT / NM / NP: genomic contigs - XM / XP: voorspellingen = site van refseq, geeft ook informative over het gebruik. Exercise 3 Restrict Entrez query to RefSeq collection Use Limit in Entrez How many alternative transcripts are known today for Drosophila melanogaster eif-4e? Ga naar NCBI, database: gene. Geef in: eif-4e Ga naar limits: - include: enkel refseqs - D. Melanogaster search klik op eerste link - i.e., how many different RefSeqs? 7, helemaal onderaan te zien bij refseqs Go back to original publication of exercise 1 and use thelink RefSeq Pubmed: Klik onderaan op nucleotides(refseq) Ook 7 resultaten 4

5 Protein sequence databases Kunnen vertaald worden uit nucleotidesequenties Worden bekomen door translatie van nucleotidesequenties. Daarom zijn secundaire databanken. Er zijn 2 types : -sequence repositories ( sequentie opslagplaats) ; data ligt opgeslagen met weinig of geen manuele tussenkomst vb. GenPept -curated databases ; experts beheren de originele data door toevoegen van nieuwe informatie vb. RefSeq, Uniprot Uniprot Uniprot = eiwit - referentie Uniprot heeft 2 onderdelen: -Swiss-Prot: handmatig becommentarieerde verslagen, gebaseerd op informatie van de literatuur of beheerste, geëvalueerde computeranalyse. -TrEMBL: Computer analyse verslagen die nog handmatig becommentarieerd moeten worden. (info in verband met een proteïne in de databank bij dat proteïne zetten.) Exercise 4a Find the human hemoglobin alpha protein in Uniprot what is the entry name? Google: uniprot Laat UniProtKB staan query: human hemoglobin alpha protein Geeft lijst met overeenkomstige proteïnen Zoeken naar de juiste geeft: HBA_HUMAN Look at the different sections of information in Swiss-Prot Klik op de entry P69905 Names General annotation (comments) Ontologies Interactions Sequence annotation (Features) References Cross-references (e.g., to 3D structure, etc) Look at the flatfile ( Text ) Rechtsbovenaan staan de files: txt What other formats are available? Naast txt: xml, rdf/xml, gff en fasta 5

6 GFF format Vb. van GFF format Een GFF format telt 10 kolommen FASTA en GFF horen samen GFF = general feature format, gene-finding format en generic feature format GFF is een file formaat die wordt gebruikt voor het beschrijven van genen en andere kenmerken van DNA, RNA en eiwitsequenties. Men herkent deze documenten aan.gff. Exercise 4b Save FASTA sequence of human hemoglobin alpha protein from UniProt Zoek human hemoglobin alpha protein van UniProt en open in FASTA file, opslaan als.txt Save GFF formatted list of features Openen als GFF, opslaan als.txt Load FASTA into Artemis and add GFF features Use File->Read an entry.. Open de fasta file weer via file manager, all files Via read an entry de GFF file toevoegen Exercise 4c The DCC gene has a role in cellular differentiation and colorectal tumorigenesis (Hedrick et al. 1994) find the paper in PubMed Kopieren en plakken in pubmed based on the Swiss-Prot entry for the DCC precursor,which residues comprise the signal sequence? Klik op protein (refseq), hier staan nu onderaan overeenkomende eiwitten, Eiwitten met een P zijn swissprot eitwitten RecName: Full=Netrin receptor DCC; AltName: Full=Colorectal cancer suppressor; AltName: Full=Immunoglobulin superfamily DCC subclass member 1; AltName: Full=Tumor suppressor protein DCC; Flags: Precursor UniProtKB/Swiss-Prot: P

7 Specialized databases Entrez Gene Entrez Gene = centrale gendatabank waarin kenmerken van genen van verschillende organismen zijn opgeslagen Organismen: mens, muis, rat, fruitvlieg, zebravis Opbouw: Summary Beknopte informatie gen Grafische weergave Genomic context Genomic regions, transcripts, and products Bibliography GeneRIF / Gene Reference Into Functions: geeft zinnen weer die informatie bevatten over gen Interactions Interacties met andere genen General gene information Gene Ontology: - Function: moleculaire functie gen - Process: proces waarin gen betrokken is - Component: locatie gen 7

8 NCBI Reference Sequences (RefSeq) Aantal RefSeqs Model organism databases Model organism databases = specifieke databanken voor welbepaalde organismen Soorten: MGI / Mouse Genome Informatics RGD / Rat Genome Database FlyBase (Drosophila melanogaster) WormBase (C. Elegans) SGD / Saccharomyces Genome Database (Gist) Ecogene (E. coli) Gene Ontology Gene Ontology = beschrijving genproducten in termen van hun geassocieerde biologische processen, cellulaire componenten en moleculaire functies op een soort onafhankelijke manier annotation of genes and proteins in genomic and protein databases Gene Ontology: geen vlakke lijst biologische termen Termen zijn gerelateerd binnen hiërarchie DAG: Directed Acyclic Graph Termen kunnen meer dan 1 ouder hebben Termen kunnen 0, 1 of meer kinderen hebben Structuur: Cellular component Waar genproduct werkt Enzymcomplexen refereren naar plaatsen Niet naar activiteiten Molecular function Activiteiten genproduct Mogelijk meerdere functies Set van functies: biologisch proces Biological process Algemeen herkenbare serie van gebeurtenissen Annotatie = categorisatie genproducten 8

9 GO databases: - FlyBase (Drosophila) - MGI (Mouse) - SGD (S. cerevisae) - TAIR (Arabadopsis) - TIGR (microbes including prokaryotes) - SWISS-PROT (several thousand species inc. human) - PSU (P. falciparum) - ZFIN (zebrafish) - PAMGO (plant pathogens) GO is a member of OBO: An umbrella project for grouping different ontologies in biological/medical field - a repository for ontologies with defined set of standards - Available from a single source: To be part of OBO, ontologies must: - Be open, can be used by all without any constraint - Be in a common shared syntax - Not overlap with other ontologies in OBO - Share a unique identifier space - Include text definitions of their terms 9

10 GO exercise Find the GO annotation of the human PAX6 in UniProtKB, mouse Pax6 in MGI, and fly ey in Flybase. What is the function of PAX6/Pax6/ey? Is it conserved? Uniprot PAX6: Klik op het humane protein en ga helemaal onder aan naar GO Klik op Complete GO annotation... MGI mouse pax6: Ga naar MGI, zoek pax6 en klik op dit eerste, ga nu naar Gene Ontology(GO) classifications Flybase fly ey: ga naar flybase geef ey in en klik op genen.. klik op de eerste: Zoek nu Gene Ontology: Function, Process & Cellular Component ( 22 unique terms ) In which developmental process is PAX6/Pax6/ey involved? Is that also conserved? What is the cellular localization of PAX6/Pax6/ey? Search for PAX6 at which organism has the most associations? Via gene or protein name Rattus norvegicus Search for cardiac development at - What is the correct GO term and identifier? -zoek cardiac development op GO -correcte GO term (hier: heart development) en identifier zoeken (hier: ). -klik op view in tree en zet filters op homo sapiens voor mens en mus musculus voor muis - How many human gene products are known to be involved in cardiac development? And how many mouse gene products? 1. Filter lineage gene product counts: species H. sapiens: 238 gene products M. musculus: 295 gene products - How many GO terms are direct child terms of cardiac development? - Download all associations in a tab delimited text file 3119 gene product associations tab delimited file OMIM Exercise How many genes are associated with Huntington Disease (HD), with Alzheimer Disease (AD) and with Parkinson Disease (PD)? OMIM via pubmed MIM ID # ALZHEIMER DISEASE; AD 16 # HUNTINGTON DISEASE; HD 1 # PARKINSON DISEASE, LATE-ONSET; PD 4 10

11 Genomic databases UCSC UCSC Genome Browser: genomische annotatie in de vorm van tracks Elke track geeft ander kenmerk weer Vb: SNP s, genen, Sommige tracks: aanwezig voor alle species Vaak ook soort specifieke tracks Opzoekingen: Genome Browser / Genome Belangrijke eigenschappen: Breedste banden = exonen Dunste banden = intronen Kleurcodes: - Zwart: corresponderende PDB / Protein Data Bank entry - Donkerblauw: corresponderende gevalideerde sequentie - Lichtblauw: niet RefSeq sequentie Annotation track menu: opties Hide: verwijdert track uit beeld Dense: alle items worden op 1 regel geplaatst 11

12 Squish: elk item op een aparte regel, maar efficiënt gestapeld op 50 % van de grootte Pack: elk item op een aparte regel, maar efficiënt gestapeld op 100 % van de grootte Full: elk item op een aparte regel DNA sequentie: Genome Browser: DNA Bevat Extended Case / Color Options Genome Browser: track Description and Page Index: Sequence and Links Sequence and Links to Tools and Databases: Genomic Sequence Exercises UCSC Genomes Search for TP53, and download genomic sequence of longest transcript, including 5 UTR, CDS exons, 3 UTR, and introns (using DNA ) (UCSC tutorial) Zoek TP53 in UCSC.. klik op langste transcript, nu staat hier onder Sequence and Links to Tools and Databases: Genomic Sequence (chr17:7,571,720-7,590,863) Klik hierop, 5 UTR, CDS exons, 3 UTR, and introns laten staan. Selecteer all uppercase (alles in hoofdletters) Download nu Obtain 10kb upstream sequence of ADAM10 (Baxevanis) Doe hetzlefde als bij TP53, nu alleen upstream en downstream laten staan met Weer all upercase.. download goto location on chromosome 3 around 120,564, ,610,000 (Human Mar 2006 assembly) - which gene is located there? Begin op begin pagina van ucsc genomes.. typ daar chr3-120,564, ,610,000 en selecteer Mar 2006 CDGAP ligt hier 12

13 - which genes are upstream and downstream of this gene? Zoom out: TMEM39A en B4GALT4 Find Drosophila eif-4e from the previous class Insect, D.melanogaster, eif-4e - Can you find back the 7 RefSeqs? Ja bij refseq genes in tabel.. zijn er 7 - Are there UCSC genes annotated in the Drosophila genome? Nee More exercises Genome Browsing Find a coding exon of TP53 that is more than 250 bp long TP53, inzoomen op langste exon How many non-synonymous coding SNPs are known in this exon? 13

14 Retrieve the DNA sequence of this exon Klik op DNA, get DNA CCGTGCAAGTCACAGACTTGGCTGTCCCAGAATGCAAGAAGCCCAGACGG AAACCGTAGCTGCCCTGGTAGGTTTTCTGGGAAGGGACAGAAGATGACAG GGGCCAGGAGGGGGCTGGTGCAGGGGCCGCCGGTGTAGGAGCTGCTGGTG CAGGGGCCACGGGGGGAGCAGCCTCTGGCATTCTGGGAGCTTCATCTGGA CCTGGGTCTTCAGTGAACCATTGTTCAATATCGTCCGGGGACAGCATCAA ATCATCCATTGCTTGGGACGGCAAGGGGGACTGTA Design primers to amplify this exon using Primer3 Ga een stapje terug, klik op extended DNA Case/Color Options Ga naar primer3plus en plak sequentie hierin Klik rechtsbovenaan op pickprimers 14

15 Test whether these primers generate a unique amplicon, using in silico PCR ga naar UCSC en klik op PCR. Sequentie van forward en reverse primer er naar kopiëren En submit 15

16 More exercises Genome Browsing human PCNA how many different transcripts? 2 how many proteins? 9 any regulatory elements annotated? - use ORegAnno track (use hg18 assembly) ORegAnno track onder regulqtion op dense zetten Er zijn er 3 16

17 More exercises Genome Browsing Find the signal peptide sequence of human DCC and use BLAT to locate this sequence in the human genome Ga naar uniprot: zoek DCC, zoek human: P43146DCC_HUMAN how many hits does BLAT give? scroll naar beneden tot sequence annotation signal peptide (op 1-25 klikken) Ga nu naar UCSC kopieer de sequentie van uniprot naar BLAT van ucsc en klik op submit 1 hit Als je nu op browser klikt krijg je genome browser If you BLAT the same sequence against the mouse genome, do you also find a hit? Ga 1 klik terug vanaf je BLAT results, geef nu mouse in ipv human Ook 1 hit. 17

18 Ensembl Ensembl: onafhankelijke genannotatie Ensembl exercise Ensembl does independent gene annotation Ensembl genes (e.g., ENSG... for human) How many transcripts does Ensembl predict for the human gene ACHE? Ga naar ensemble, geef ACHe en human in 15 transcripts Ensembl is good for orthologue predictions (reciprocal BLAST, see later) Exercise: Find the mouse orthologue of the human SSBP4 Ensembl All species: SSBP4 By Feature Type Gene: Homo sapiens (1) Artikel: SSBP4 Zijbalk: Comparative Genomics Orthologues Zoeken naar Mouse: Ssbp4 Does this gene have paralogues? 2 18

19 Database structures 3 grote structuren: Flatfile indexing system Geïndexeerde opslag in directories Vb: GenBank Relational database SQL / Structured Query Language Vb: GO, UCSC GUI / Graphical User Interface Web based (HTML) en meer geavanceerde dynamische programmering Flatfile database Flatfile database = geordende verzameling van gelijkaardige files, meestal geconformeerd naar een standaardformaat voor hun inhoud Doel indexering: optimale snelheid en kwaliteit in zoeken Extraheren specifiek attribuut uit file Koppeling aan naam en locatie Voorbeeld Voorbeeld flatfile database: Probleem: enkel informatie in welk document woord voorkomt Geen informatie over frequentie / positie woord Boolean index Relational database Relational database = opslag informatie in verzameling tabellen (relations), waarbij reeksen overeenkomen met individuele records (tuples) en de kolommen met attributen Software: MySQL SQL / Structured Query Language = database computertaal ontworpen voor het ophalen en beheer data in relationele database managementsystemen, aanmaak en modificatie databaseschema s en database object access control management 19

20 3 tier architectuur 3 niveau s in architectuur: Client / Presentation tier Eigen computer / software Business Logic tier Presentation tier: informatie verkrijgen Data tier: informatie toevoegen / wijzigen Data tier UCSC Table Browser Table Browser: In the Human genome, search for simple repeats on a chromosome 4 location with copy number more than 10 and download the sequence. (UCSC tutorial) 1. UCSC Genome Browser Tables: Table Browser Eigenschappen: - Genome: Human - Group: Variation and Repeats - Track: Simple Repeats - Table: simplerepeat - Region Position: chr4 20

21 2. Filter: Create Filter on Fields from hg19.simplerepeat CopyNum: > 10 Submit 3. Output format: Sequence Get output: Simple Repeats Genomic Sequence Get sequence 21

22 Find simple repeats (copy number > 10) within known genes and download the sequence (UCSC tutorial) Intersection: Create Intersect with Simple Repeats All Simple Repeats records that have any overlap with UCSC genes Submit 22

23 Output format: Sequence Get output: Simple Repeats Genomic Sequence Get sequence 23

24 How many genes are located between the STS markers SWXD113 anddxs52? UCSC Genome Browser: SWXD113 Submit SWXD113: STS Marker SWXD113 Coördinaten opschrijven: chrx:138,543, ,744,169 24

25 UCSC Genome Browser: DXS52 Submit DXS52: STS Marker DXS7083 Coördinaten opschrijven: chrx:151,897, ,097,452 UCSC Genome Browser Tables: Table Browser Eigenschappen: - Group: Genes and Gene Prediction Tracks - Table: knowngene - Region Position: chrx: Summary / Statistics: UCSC Genes (knowngene) Summary Statistics Item count:

26 Table Browser Download FASTA file containing all human 3 UTR sequences UCSC Genome Browser Tables: Table Browser Eigenschappen: - Group: Genes and Gene Prediction Tracks - Table: knowngene - Region: genome - Output format: sequence Get output: Select sequence type for UCSC Genes Genomic: Submit UCSC Genes Genomic Sequence 3 UTR Exons: Get sequence Download FASTA file containing all human 1kb proximal promoters UCSC Genome Browser Tables: Table Browser Eigenschappen: - Group: Genes and Gene Prediction Tracks - Table: knowngene - Region: genome - Output format: sequence Get output: Select sequence type for UCSC Genes Genomic: Submit UCSC Genes Genomic Sequence Promot/upstream by 1000: Get sequence 26

27 Data analyse Classificaties Biologische classificatie Analysis at nucleotide level: Predictive methods using DNA sequences Predictive methods using RNA sequences SNP / Single Nucleotide Polymorphism Analysis at protein level: Predictive methods using protein sequences Analysis of biological networks Interfering relationships: Pairwise sequence similarity Multiple sequence alignment Phylogenetic analysis Comparative genomics DNA microarrays to assay gene expression Proteomics and protein identification Technische classificatie Web based tools Draaien op server en beschikbaar via HTML interface Stand alone tools 2 opties: - Lokaal downloaden en installeren - Direct starten vanaf webpagina door Java Web Start Vb: Artemis Command line scripts en programma s in Linux Bediening via CLI / Command Line Interface in Linux Vb: Emboss Spreadsheet software Vb: Microsoft Excel, OpenOffice Calc 27

28 OS / Operating System OS / Operating System: behandelt low level processen die hardware doen samenwerken Functies: Voorziet omgeving waarin programma s kunnen worden ontwikkeld / gebruikt Voorziet makkelijke toegang tot files en programma s Unix Unix = OS van het World Wide Web Multi user system: networking, multitasking, security Linux Linux = open source versie van Unix Principe: CLI / Command Line Interface Interactie met OS of software door typen commando s Functies CLI: Uitvoeren Command Line Programs / Scripts Ontleding tekstfiles Sorteren en knippen van informatie Programma s in batch runnen SSH / Secure Shell: verbonden aan Unix machine F Secure SSH Client (LUDIT) Inloggen: - IP adres: Username: user179 - Paswoord: user179 Thuis: inloggen op netwerk Link: Na login: connectie maken met Linux server 28

29 Belangrijke commando s Commando ls ls l ls lt cd Output Weergave inhoud directory Inhoud directory met informatie over naam, grootte, auteur Inhoud directory gesorteerd op datum van aanmaak Home directory van huidige directory cd.. Parent directory van huidige directory mkdir Creëert subdirectory in huidige directory cat Commando more head Weergave inhoud file Output Weergave inhoud file met pauze op einde vol scherm en vraag om op toets te drukken Weergave eerste aantal regels in file tail grep sort Weergave laatste aantal regels in file Selectie alle regels in file die zoekterm bevatten Alfabetische rangschikking sort n cut f man Numerieke rangschikking Knippen geselecteerde velden uit elke regel van file Linux manual Creatie complexere commando s q Quit clear Schoonvegen scherm wc l Telt woorden in file 29

30 1. F Secure SSH Client: man who ( q ) Output: manual entry voor who 2. F Secure SSH Client: clear Output: leeg scherm 3. F Secure SSH Client: echo 5+4 bc Output: oplossing berekening 30

31 Exercise linux Download a tab delimited file containing all annotated genes involved in the regulation of the cell cycle (using Gene Ontology), across species. Copy this file to your home account on the linux server: Use file transfer window (yellow button in F-Secure SSH client software) Note:from a terminal under linux or Mac OS use secure copy scp cellcyclegenes.txt : try in your home dir: cat cellcyclegenes.txt wc -l less cellcyclegenes.txt cat cellcyclegenes.txt grep MGI cat cellcyclegenes.txt grep Ccnd cat cellcyclegenes.txt grep -i Ccnd cat cellcyclegenes.txt grep MGI grep Ccnd > ccnd_mouse.txt cat cellcyclegenes.txt sort -k3 cat cellcyclegenes.txt cut -f7 sort -u cat cellcyclegenes.txt grep IDA grep MGI grep cyclin Gene Ontology GO term or ID: cell cycle Term Search Results GO: Artikel: cell cycle 31

32 Term Neighborhood for cell cycle GO: Filter lineage gene product counts Species: M. musculus Gene products Gene Product Associations to cell cycle: Gene Association Format Opslaan als.txt file F Secure SSH Client: New File Transfer Window Sleep bestand naar Linux F Secure SSH Client: cat cellcycle.txt wc l 32

33 F Secure SSH Client: less cellcycle.txt F Secure SSH Client: cat cellcycle.txt grep MGI F Secure SSH Client: cat cellcycle.txt grep Ccnd F Secure SSH Client: cat cellcycle.txt grep -i Ccnd Output: case insensitive zoekopdracht 33

34 F Secure SSH Client: cat cellcycle.txt grep MGI grep Ccnd > ccnd_mouse.txt Aanmaak file in directory F Secure SSH Client: cat cellcycle.txt sort k3 F Secure SSH Client: cat cellcycle.txt grep MGI cut f3 sort u wc l 34

35 Emboss EMBOSS = European Molecular Biology Open Software Suite Inloggen: F Secure SSH Client Web interface Link: Emboss exercise 1 accession L07770 download EMBL or GB formatted file, and name it xlrhodop.embl man seqret seqret (type seq then press tab key for tab completion) seqret xlrhodop.embl -outseq l07770.fasta -feature cat l07770.gff showfeat xlrhodop.embl: how many CDS features? infoseq xlrhodop.embl: how long, what is GC content? download EMBL or GB formatted file for accession number U23808 extract FASTA and GFF using seqret EMBL Nucleotide Sequence Database: accession number L07770 View in EMBL format Opslaan als.embl file 35

36 1 e manier: F Secure SSH Client F Secure SSH Client: seqret sequence L07770.embl outseq l07770.fasta feature F Secure SSH Client: cat l07770.gff F Secure SSH Client: cat l07770.fasta F Secure SSH Client: showfeat sequence L07770.embl outfile L07770_showfeat.txt F Secure SSH Client: cat L07770_showfeat.txt Aantal CDS features: 1684 F Secure SSH Client: infoseq sequence L07770.embl outfile L07770_infoseq.txt F Secure SSH Client: cat L07770_infoseq.txt GC content: 45, 72 % 36

37 2 e manier: EMBOSS Web Interface : google: emboss explorer EMBOSS Web Interface Edit: Seqret Upload L07770.embl Run Seqret EMBOSS Web Interface Display: Showfeat Upload L07770.embl Run Showfeat 37

38 EMBOSS Web Interface Information: Infoseq Upload L07770.embl Run Infoseq 38

39 Exercise emboss 2 retrieve the sequence of the last coding exon of C.elegans gene mec-8 translate this sequence using transeq (Emboss) how many nucleotides (use cat, pipe and wc) reverse complement this sequence (revseq) UCSC Genome Browser: mec 8 Clade: Nematode Genome: C. elegans Submit RefSeq Genes: mec 8 Inzoomen op laatste coderende exon DNA: Get DNA Opslaan als.txt file 39

40 Zorg ervoor dat je in notepad alles rond de sequentie weghaalt 1 e manier: F Secure SSH Client F Secure SSH Client: transeq sequence Mec8.txt outseq Mec8_transeq.pep F Secure SSH Client: cat Mec8_transeq.pep cat mec8_transeq.pep wc Dus 109 nucleotides F Secure SSH Client: revseq sequence mec8.txt outseq Mec8_revseq.txt F Secure SSH Client: cat Mec8_revseq.txt 40

41 1. 2 e manier: EMBOSS Web Interface EMBOSS Web Interface Nucleic Translation: Transeq Upload Mec8.txt Run Transeq 2. EMBOSS Web Interface Edit: Revseq Upload Mec8.txt Run Revseq 41

42 Predictive methods using DNA sequences Genoom sequenced en geassembleerd: lokaliseren proteïnecoderende genen Moeilijker in eukaryoten: Grotere afstanden tussen naburige genen Exon intronstructuur is moeilijk te voorspellen Huidige computermethodes: niet sterk genoeg Geen precieze voorspelling genstructuur grote sequentie Gevolg: terugvallen op compositional bias Indien geen bijkomende informatie: hypothetische voorspellingen Methodes Gene prediction = voorspellen locatie genen in genoomsequentie door combinatie 1 / meer methodes Methodes: Zoeken op signaal Zoeken op inhoud Homology based gene prediction Intrinsieke methoden Ab initio methoden: intrinsiek Zoeken op signaal en inhoud Geen vergelijking met andere sequenties Dynamic programming = veel exonvoorspellingen samenvoegen tot genstructuur Vb: GeneID HMM / Hidden Markov Model: hulpmiddel voor genpredictie Definiëring complexe patronen Extrinsieke methoden Homology based methoden: extrinsiek Soorten: BLASTX Vertaling nucleotiden vergelijken met proteïnedatabanken EST / Expressed Sequence Tags BLAT / BLASTN Comparative gene prediction Twee genomen vergelijken Geconserveerde domeinen zijn exonen Exon bepalende signalen Detectie: PMW / Position Weight Matrix Signalen: - Translation start site - 5 donor splice site - 3 acceptor splice site - Translation stop codon Voorspelling en score exonen 3 types: Initiële exonen Aanduiding ORF door startcodon en 5 donorsite Interne exonen Aanduiding ORF door 3 acceptorsite en 5 donorsite Terminale exonen Aanduiding ORF door 3 acceptorsite en stopcodon Coderende statistieken: gebruik andere codons in exonen en intronen 42

43 Exercise Retrieve sequence of the first megabase of human chromosome 20 (use hg18) in linux download chr20 from goldenpath/hg19/chromosomes/ - copy link of chr20 and use wget on linux (then gunzip to unzip the.gz file) or use /home/saerts/chr20/chr20.fa use extractseq EMBOSS program to extract the first 1Mb how to get the fasta sequence for this region using the UCSC Genome Browser, the UCSC Table Browser, or the Ensembl database? 1. Internet Explorer: File: chr20.fa.gz 2. F Secure SSH Client: gunzip chr20.fa.gz 3. F Secure SSH Client: extractseq sequence chr20.fa regions 1: outseq chr20_firstmb.fa 4. UCSC Genome Browser: chr20: Submit 43

44 5. DNA: Get DNA 6. UCSC Genome Browser Tables: Table Browser Region Position: chr20: Get output 44

45 ORF exercise getorf (Emboss) [what are the default settings for minsize and maxsize?] - for example, the complete chr21 has predicted ORFs - chr20: : how many ORFs? use grep and wc -l try plotorf (Emboss) - graphtype = png 1. F Secure SSH Client: getorf sequence chr20_firstmb.fa outseq ORFs.fa minsize F Secure SSH Client: cat ORFs.fa grep > wc l 3. F Secure SSH Client: plotorf sequence chr20_firstmb.fa graph png Openen door plotorf.1.png in gele mapje naar boven te slepen, hierna kan je het openen door naar mijn computer te gaan en dubbel te klikken. 45

46 Exercise coding statistics (1) use the same 1 exon gene use Emboss syco to calculate codon usage codon usage file for human: Ehum.cut (ls -l /usr/share/emboss/data/codons/*.cut ) 1. UCSC Genome Browser Tables: Table Browser Eigenschappen: - Track: RefSeq Genes - Table: refgene - Region Position: chr4 - Output format: hyperlinks to Genome Browser 2. Filter: Create Filter on Fields from hg19.refgene ExonCount = 1 3. Hyperlinks to Genome Browser: NM at chr4:

47 4. DNA: Get DNA Opslaan als.txt file 5. F Secure SSH Client: syco sequence ATOH1.txt cfile Ehum.cut graph png outfile ATOH1_syco.out 47

48 Exercise coding statistics (2) tcode combines codon usage with periodicity scores tcode -plot -graph cps tcode -sequence myseq.fasta -outfile tcode.out -window 200 -plot -graph png 1. F Secure SSH Client: tcode sequence ATOH1.txt window 200 outfile ATOH1.tcode graph png plot 48

49 GeneID GeneID = voorspelling genen in genomische sequenties see Hiërarchie: Splice sites / startcodon / stopcodons Building exons Scoring exons Finaal: samenstelling genstructuur GeneID see geneid -P human3iso.param chr20_firstmb.fa -G > chr20_firstmb_geneid.gff -G for GFF format -v verbose = display info messages -P parameter file - located in /home/saerts/software/geneid/param directory F Secure SSH Client: geneid P home/saerts/software/geneid/param/human3iso.param chr20_firstmb.fa G 49

50 a second geneid exercise Download 1Mb sequence around the human URO-D gene Genome browser: UROD Get DNA upstream en downstream -> 1 miljoen + gen Save als UROD.txt Use a gene prediction program (Geneid, or Genscan) to predict genes in this region Make a custom track file in BED or GFF format, from the gene prediction output, containing genomic coordinates of the gene predictions (e.g., using Excel) Upload this file to create a custom track, and visualize your predictions in relation with UCSC and RefSeq gene annotations, in this region 1. UCSC Genome Browser: chr1:44,977,830-45,977, DNA: Get DNA Opslaan als.txt file Bovenste regel Notepad ++ : chr1 50

51 3. F Secure SSH Client: File Transfer Window File uploaden F Secure SSH Client: geneid P home/saerts/software/geneid/param/human3iso.param G urod.fa > UROD_Mb_GeneID.gff 4. Excel: Openen Alle bestanden: UROD_Mb_GeneID.gff Wizard: Volgende Volgende Voltooien 5. Excel Gegevens: Sorteren Sorteren op kolom A 51

52 6. Excel: verwijder commentaren (#) 7. Excel kolom M: ingeven startpositie ( ) Kolom J: =D1+$M$1-1 Rechtsonder klikken en slepen naar onder Kolom K: =E1+$M$1-1 Rechtsonder klikken en slepen naar onder 8. Excel: kopieer kolom J en K Selecteer kolom D en E Start Plakken: Waarden plakken Verwijder kolom J, K en M 52

53 9. Opslaan als: Tekst Opslaan als.txt file 10. UCSC Genome Browser Tables: Table Browser Add Custom Tracks: Bladeren Submit 11. Manage Custom Tracks: Go to Genome Browser 12. Genomes UCSC Genome Browser: UROD 53

54 13. RefSeq Genes: UROD at chr1:

55 Oef.1 (slide 145) -Geneid is een programma om genen te voorspellen in een DNA sequentie. Gen voorspellen in UROD-seq: Zoeken op UCSC naar UROD, vervolgens 1 Mb errond met gen in het midden houden 500k naar links en 500k naar rechts via de position/searchs aanpassen zodat men exact 1Mbp heeft Vb. 1 Mb rond chr1: 45,250,417-45,252,835 44,750,000 tot 45,750,000 Of via alternatief via DNA en upstream/downstream aanduiden = 1 mil + URODgen dus meer dan 1 mil bp Genome browser: UROD Get DNA upstream en downstream -> 1 miljoen + gen Sequentie opvragen en vervolgens saven (save page as: text file): UROD_1Mb_flank.fa Is op toledo gezet Openen met WordPad Weten van waar tot waar het gen zit als referentie zie ID waar je het vandaan gehaald hebt. (Zie bovenaan voor de ID : chr1: ) 55

56 -lengte van sequentie = Secure Shell: cat (fasta file) grep-v Geneid web server -https://genome.imim.es/geneid.html 56

57 Deze webinterface draait niet op onze server maar ergens in Spanje. Enige wat eigenlijk moet gebeuren is file opvragen want we werken in human, we willen een GFF en de rest is onbelangrijk, na het ingeven van de fasta file via browse verkrijgen we deze gff file op de server in Spanje: Organisme: mens Strands: forward en reverse Output: GF Rest laten zoals t is Submit (net boven predictions options) Wat je krijgt => GFF Command: wat daar op linux server draait Geneid 2527kotnet => file -weergegeven in volgorde van kolommen: naam, source, beschrijving (first, terminal), start, stop, score, strand, frame, extra commentaar/naam. Na hekje: commentaar - deze GFFoutput saven als text file selecteren, copy en pasten in text editor (WinEdit) of excel (openen, kies: all files) 57

58 - Pasted in WinEdit file save as Saven: UROD_1MbFlank_geneid.gff Uploaden naar UCSC genome browser -naam en van tot veranderen 1000+begin en 2000+begin (begin: 44,750,417) 1 ste kolom moet chr1 komen te staan ipv hg bij locatie moet niet 1700 maar 1700 locatie van het gen! Dit doen we in Excel Excel: GFF hierin openen (all files selecteren onderaan bij open file) 58

59 - Melding op excel: Commando s: next, next, finish Excel zet file in kolommen - Formules: C4: =A4+B4 (op vakjes klikken) Kopiëren: rechtsonder hokje vastnemen en naar beneden slepen - GFF in Excel: Kolom D en E knippen en in N en O plakken (Start stop kolommen tijdelijk verplaatsen en formule intypen in originele plaats) 59

60 - Nieuwe getallen in D: Door de formule = naam rij/kolom (bv = N7-1), vervolgens 1 kolom naar rechts slepen, wordt de formule ingegeven. Daarna selecteren we de 2 formules en slepen we deze helemaal tot beneden. N7=1700 en -1, want anders 1 teveel (44,750,417 = 1 bij ons) Nieuwe getallen in E: kopiëren vanuit D (rechtsonder vastnemen en naar rechts slepen) Kopiëren in alle kolommen (rechtsonder vastnemen en naar beneden slepen) -Naam hg moet chr1 worden (maar eerst commentaren wegdoen, want storend) Links bovenaan (hoek tussen 1 en A): alles selecteren, data, sort, kolom ingeven (kolom N) Commentaarlijnen staan onderaan 60

61 Commentaarlijnen eruit knippen. - vervolgens deleten we de laagste (niet kolomwaarden) - in kolom A moet chr 1 staan wanneer je kopieert: chr2, chr3, in 2 de hokje ook chr1, beide selecteren en naar beneden slepen of ctrl D (kopieert je formule in alle hokjes) - Gedeelte dat we nodig hebben selecteren (kolom A tot I), ctrl+c, vervolgens ctrl+n: dit opent een nieuwe sheet en vervolgens klikken we op home dan paste en paste values want anders worden de formules mee gekopieerd en krijgen we foutieve waarden Formules niet pasten, want hokjes zijn anders dus zullen formules niet kloppen Links boven: paste values selecteren Save as type: Text (Tab ) UROD_1MBflank_geneid_genomiccoord.gff Verschillende meldingen: altijd op yes klikken 61

62 $-teken zorgt ervoor dat 1 bepaald vakje in de formule behouden blijft zodat men bv in heel de kolom N7 wordt opgeteld zet men deze tussen $-tekens - Omzetten naar text file door save as tekst save as text file tab delimited 62

63 Accuraatheid 3 maten: Sensitiviteit Percentage echte positieven die voorspeld zijn als positieven Formule: Specificiteit Percentage echte negatieven die voorspeld zijn als negatieven Formule: PPV / Positive Predictive Value Percentage voorspelde genen die true positives zijn Formule: Correlatie: combinatie SN en SP Tussen 1 en 1: - + 1: volledig correcte voorspelling - 1: volledig incorrecte voorspelling 63

64 Exercise on accuracy Use the intersections of tracks in the Table Browser to estimate the specificity and sensitivity of your own gene predictions compared to the UCSC gene track at the gene level (not at nucleotide or exon) how many geneid predicted genes overlap with UCSC genes (i.e., how many true positives?) how many and what kind of UCSC genes are missed by geneid (i.e., how many false negatives)? how many genes are predicted by geneid that are no UCSC genes? (i.e., how many false positives) Oefening S.183 Werkwijze: 1. UCSC Genome Browser Tables: Table Browser Intersection: Create 2. Intersect with User Track: All User Track records that have at least 80 % overlap with UCSC Genes Submit 3. Table Browser: Summary / Statistics 64

65 4. Tables: Table Browser Eigenschappen: - Group: Genes and Gene Prediction Tracks - Track: RefSeq Genes - Table: RefGene - Region Position: chr1:44,977,830-45,977,829 - Intersection: Clear 5. Table Browser: Summary / Statistics Volgens RefSeq: 39 genen in dat gebied 65

66 66

67 Biological classification Pairwise sequence similarity Pairwise sequence similarity = nagaan verband tussen 2 sequenties door vergelijking Pairwise alignment = 2 sequenties positie per positie vergelijken Similarity en homologie Similarity: kwantitatieve meting die weergeeft hoe gelijkend 2 sequenties zijn Basis: pairwise alignment Mechanisme: aantal gelijke residuen tellen Percent identity Hoog: gelijke functie / evolutionair verwante sequenties Homologie: hypothetische conclusie Basis: - Orthologe genen Gescheiden door vorming nieuwe species - Paraloge genen Gescheiden door duplicatie 3 types mutaties: Inserties AAGA wordt AAGTA Deleties AAGA wordt AGA Substituties AAGA wordt AACA Positieve score: Negatieve score: Perfect match Mismatch Indels Dotplots Dotplot: visuele manier van sequentievergelijking Dot: overeenkomst Identificatie regio s: verbinden bolletjes 67

68 Oefening S.195 Werkwijze: 1. PubMed Nucleotide: AAB08987 FASTA: opslaan als fasta file 2. PubMed Nucleotide: AAH02824 FASTA: opslaan als fasta file 3. 1 e manier: Google Dotlet Input: HMG1 sequentie ingeven Name: HMG1 Input: SOX10 sequentie ingeven Name: SOX10 68

69 4. Dotlet: overeenkomstige AZ naar 51 Compute 5. Dotlet:Greyscale aanpassen Diagonalen 6. 2 e manier: F Secure SSH Client File Transfer Window: HMG1.fa en SOX10.fa uploaden 7. F Secure SSH Client: dotmatcher asequence HMG1.fa bsequence SOX10.fa Graph type [x11]: png 69

70 70

71 Scoring matrices Scoring matrix: in rekening brengen positie overlap en eigenschappen residuen Belangrijk: Conservatie Frequentie Evolutie Nucleotide scoring matrix Normaal: alleen matches / mismatches Assumptie: 25 % kans op elke nucleotide A T G C A T G C Gaps en gap penalties Gaps in alignments: compensatie InDels tussen vergelijkende sequenties Regel: niet meer dan 1 per 20 residuen Affine gap penalty: Vaste vermindering score voor maken gap Bijkomende vermindering lengte gap Regel: G = gap opening penalty L = gap extension penalty n = lengte gap G > L : lange gap is beter dan vele kleine gaps Non affine gap penalty: Geen vermindering score voor maken gap Vaste mismatch vermindering per positie gap 71

72 Oefening S.201 Werkwijze: 1. 1 e manier: EMBOSS Web Interface EMBOSS Web Interface Alignment Global: Needle Sequenties ingeven 2. EMBOSS Web Interface Matrix File: EBLOSUM62 Eigenschappen: - Gap opening penalty: 11 - Gap extension penalty: 1 Run Needle 72

73 3. 2 e manier: F Secure SSH Client File Transfer Window: sequenties uploaden 4. F Secure SSH Client: needle asequence Gap_Sequence1.txt bsequence Gap_Sequence2.txt gapopen 11 gapextend 1 outfile Test_Needle.txt 73

74 Protein alignment Protein based searches: krachtiger dan nucleotide based searches Beter in: Bepalen similarity Bepalen homologie Alignment algoritmes Naïeve benadering: alle mogelijke alignments voor 2 sequenties genereren Alignment met hoogste score kiezen Probleem: te tijdrovend Alignment algoritmes = gebruik van dynamisch programmeren om alignment met hoogste score te vinden 2 soorten: Smith Waterman Lokaal Needleman Wunsch Globaal Globale vs. lokale sequentie alignments Globale alignment = lokaliseren beste alignment over volledige sequenties Lokale alignment = lokalisatie meest gelijkende regio s in delen sequenties Voordeel: subsequenties ontdekken BLAST BLAST / Basic Local Alignment Search Tool: meest gebruikte methode voor detective similarity Types: BLASTP Proteïnesequenties zoeken tegen proteïnedatabank BLASTN Nucleotidesequenties zoeken tegen nucleotidedatabank TBLASTN Proteïnesequenties zoeken tegen nucleotidedatabank BLASTX Nucleotidesequenties zoeken tegen proteïnedatabank Ruwe scores: afhankelijk van opbouw query, doelsequenties, Oplossing: berekening Expectation Value E / Expectation Value = aantal hoog scorende segmentparen die puur door kans verwacht worden 74

75 Oefening S.215 Werkwijze: 1. PubMed Protein: Drosophila Melanogaster prospero protein isoform F Filter your results: RefSeq (1) FASTA: opslaan als fastafile 2. Google BLAST: BLASTP 3. Bladeren: file uploaden Job Title: Prospero, isoform F BLAST 75

76 4. Protein Sequence (1703 letters) Graphic Summary: aantal hits 5. Homologie: Bits / E value Lager in lijst: minder homologie en meer gaps 76

77 DNA microarrays to assay gene expression Microarray data processing Microarray data processing = analyse genexpressie met behulp van microarrays Principe: aanmaak / binding oligonucleotiden op drager RNA: - Controle: groen - Patiënt: rood DNA: hybridisatie op plaat Competitie tussen controle en patiënt Resultaat: - Controle: groen - Patiënt: rood - Controle + patiënt: geel Meting: laser Gene set analyse Oefening S.230 Werkwijze: 1. PubMed: Warner Nature Methods Limits 2. Limits: Dates Published in the Last: Specify date range

78 Search 3. Images from this publication: Free Text Scroll naar beneden Supplementary Material: Supplementary Table 1 Opslaan als.xls file 4. Google: Ensembl Biomart Ensembl: Biomart Dataset: 78

79 - Ensembl Genes 62 - Homo sapiens genes (GRCh37.p3) 5. Filters: Gene ID List Limit: RefSeq DNA ID(s) [e.g. NR_003682] Plakken: NM_XXXXXX (Cluster 0) 6. Attributes Features: Gene Ensembl: alles uitvinken 79

80 7. Attributes Features: External External References: UniProt / SwissProt ID Results 8. Results: GO Opslaan als.txt file 80

81 9. Filters: Gene ID List Limit: EMBL ID(s) [e.g. AK090412] Plakken: overige Genbank / RefSeq ID s (Cluster 0) Results 10. Results: GO Opslaan als.txt file 11. Beide bestanden samenvoegen: Biomart_Export_EMBLRefSeq.txt 12. Google: Required Basic Input Options: Biomart_Export_EMBLRefSeq.txt uploaden 81

82 13. Choose annotation: GOA H. sapiens (Human) Search for GO Terms 82

83 Oefening S.238 Werkwijze: 1. Ensembl Biomart Ensembl: Biomart Dataset: - Ensembl Genes 62 - Homo sapiens genes (GRCh37.p3) 2. Filters: Gene ID List Limit: UniProt / SwissProt ID(s) [e.g. YA23_HUMAN] Plakken: Biomart_Export_EMBLRefSeq.txt 83

84 3. Attributes Homologs: Gene Ensembl: alles uitvinken 4. Attributes Homologs: Orthologs Mouse Orthologs: Mouse Ensembl Gene ID Results 5. Results: GO Opslaan als.txt file 84

85 6. Dataset: Ensembl Genes 62 Mus musculus genes (NCBIM37) 7. Filters: Gene ID List Limit: Ensembl Gene ID(s) [e.g. ENSG ] Plakken: Biomart_Export_Mouse.txt 8. Attributes Features: Gene Ensembl: alles uitvinken 85

86 9. Attributes Features: External External References: MGI ID Results 10. Results: GO Opslaan als.txt file 11. Google: Required Basic Input Options: Biomart_Export_Mouse_Homologs.txt uploaden 86

87 12. Choose annotation: MGI M. musculus (Mouse) Search for GO Terms 13. Drosophila melanogaster Mus musculus 87

88 Pattern matching Elke letter x : AZ residu Voorbeeld: Verklaring: x(4,7): Minimum 4 en maximum 7 residuen tussen beide AZ [NGH]: Enkel N, G of H tussen beide AZ x(2): Exact 2 residuen tussen beide AZ {GP}: Alle residuen behalve Gly en Pro tussen beide AZ 88

89 Oefening S.242 Werkwijze: 1. Toledo Bioinformatica: Course Documents 102 NFkappaB targets 2. Google: Ensembl Biomart Ensembl: Biomart Dataset: - Ensembl Genes 62 - Homo sapiens genes (GRCh37.p3) 3. Filters: Gene ID List Limit: RefSeq DNA ID(s) [e.g. ] Plakken: NF_KappaB_Targets.txt 89

90 4. Attributes Sequences: Sequences Sequences: Flank (Gene) Upstream flank: Attributes Sequences: Header Information Gene Information: - Ensembl Gene ID uitvinken - Associated Gene Name aanvinken 6. Attributes Sequences: Header Information Transcript information: Ensembl Transcript ID uitvinken Results 90

91 7. Results: GO Opslaan als.txt file 8. 1 e manier: EMBOSS Web Interface EMBOSS Web Interface Nucleic Motifs: Fuzznuc Upload Biomart_Export_NF_KappaB_Targets.txt Run Fuzznuc 91

92 9. 2 e manier: F Secure SSH Client F Secure SSH Client: fuzznuc sequence Biomart_Export_NF_KappaB_Targets.txt rformat gff outfile NF_KappaB_Fuzznuc.gff pmismatch 0 pattern GGGNNNNNCC complement 10. F Secure SSH Client: cat NF_KappaB_Fuzznuc.gff grep v ## wc l 11. Google: TOUCAN TOUCAN: Launch Now 12. TOUCAN File: Load Seq File Name: Biomart_Export_NF_KappaB_Targets.fasta 92

93 13. TOUCAN Annotation: Annotate GFF File Name: NF_KappaB_Fuzznuc.gff Blokje boven: + strand Blokje beneden: - strand 93

94 Oefening S.255 Werkwijze: 1. PubMed Protein: CTCF Artikel: CTCF [Homo Sapiens] FASTA: opslaan als fastafile 2. F Secure SSH Client: fuzzpro sequence CTCF_Human.fa outfile CTCF_human_ZincFinger.gff rformat gff pattern C x(2,4)cx(3)[livmfywc]x(8)hx(3,5)h 3. F Secure SSH Client: cat CTCF_Human_ZincFinger.gff grep v ## wc l 94

Het beheren van mijn Tungsten Network Portal account NL 1 Manage my Tungsten Network Portal account EN 14

Het beheren van mijn Tungsten Network Portal account NL 1 Manage my Tungsten Network Portal account EN 14 QUICK GUIDE C Het beheren van mijn Tungsten Network Portal account NL 1 Manage my Tungsten Network Portal account EN 14 Version 0.9 (June 2014) Per May 2014 OB10 has changed its name to Tungsten Network

Nadere informatie

DAR Approximate string matching Casus: biological sequence alignment

DAR Approximate string matching Casus: biological sequence alignment DAR Approximate string matching Casus: biological sequence alignment 1 Text search Approx string matching dynamic programming, edit distance example application: Google search Text indexing inverted list

Nadere informatie

Settings for the C100BRS4 MAC Address Spoofing with cable Internet.

Settings for the C100BRS4 MAC Address Spoofing with cable Internet. Settings for the C100BRS4 MAC Address Spoofing with cable Internet. General: Please use the latest firmware for the router. The firmware is available on http://www.conceptronic.net! Use Firmware version

Nadere informatie

Firewall van de Speedtouch 789wl volledig uitschakelen?

Firewall van de Speedtouch 789wl volledig uitschakelen? Firewall van de Speedtouch 789wl volledig uitschakelen? De firewall van de Speedtouch 789 (wl) kan niet volledig uitgeschakeld worden via de Web interface: De firewall blijft namelijk op stateful staan

Nadere informatie

Find Neighbor Polygons in a Layer

Find Neighbor Polygons in a Layer Find Neighbor Polygons in a Layer QGIS Tutorials and Tips Author Ujaval Gandhi http://google.com/+ujavalgandhi Translations by Dick Groskamp This work is licensed under a Creative Commons Attribution 4.0

Nadere informatie

How to install and use dictionaries on the ICARUS Illumina HD (E652BK)

How to install and use dictionaries on the ICARUS Illumina HD (E652BK) (for Dutch go to page 4) How to install and use dictionaries on the ICARUS Illumina HD (E652BK) The Illumina HD offers dictionary support for StarDict dictionaries.this is a (free) open source dictionary

Nadere informatie

Standard Parts Installatie Solid Edge ST3

Standard Parts Installatie Solid Edge ST3 Hamersveldseweg 65-1b 3833 GL LEUSDEN 033-457 33 22 033-457 33 25 info@caap.nl www.caap.nl Bank (Rabo): 10.54.52.173 KvK Utrecht: 32075127 BTW: 8081.46.543.B.01 Standard Parts Installatie Solid Edge ST3

Nadere informatie

Veel gestelde vragen nieuwe webloginpagina

Veel gestelde vragen nieuwe webloginpagina Veel gestelde vragen nieuwe webloginpagina Op deze pagina treft u een aantal veel gestelde vragen aan over het opstarten van de nieuwe webloginpagina http://weblogin.tudelft.nl: 1. Ik krijg de melding

Nadere informatie

ICARUS Illumina E653BK on Windows 8 (upgraded) how to install USB drivers

ICARUS Illumina E653BK on Windows 8 (upgraded) how to install USB drivers ICARUS Illumina E653BK on Windows 8 (upgraded) how to install USB drivers English Instructions Windows 8 out-of-the-box supports the ICARUS Illumina (E653) e-reader. However, when users upgrade their Windows

Nadere informatie

Hoe met Windows 8 te verbinden met NDI Remote Office (NDIRO) How to connect With Windows 8 to NDI Remote Office (NDIRO

Hoe met Windows 8 te verbinden met NDI Remote Office (NDIRO) How to connect With Windows 8 to NDI Remote Office (NDIRO Handleiding/Manual Hoe met Windows 8 te verbinden met NDI Remote Office (NDIRO) How to connect With Windows 8 to NDI Remote Office (NDIRO Inhoudsopgave / Table of Contents 1 Verbinden met het gebruik van

Nadere informatie

Zo kan je linken maken tussen je verschillende groepen van gegevens.

Zo kan je linken maken tussen je verschillende groepen van gegevens. 1 1. Entity Reference Entity Reference zal ook een onderdeel zijn van Drupal 8. Het is een module van het type veld. Het is een heel krachtige module die toelaat om referenties te maken tussen verschillende

Nadere informatie

Om de toegang te krijgen tot de. download het programma. http://retroshare.sourceforge.net/downloads.html

Om de toegang te krijgen tot de. download het programma. http://retroshare.sourceforge.net/downloads.html www.vhn-online.nl Om de toegang te krijgen tot de download het programma http://retroshare.sourceforge.net/downloads.html Na het downloaden installeer en open het programma. Aan u wordt gevraagd: Create

Nadere informatie

Intermax backup exclusion files

Intermax backup exclusion files Intermax backup exclusion files Document type: Referentienummer: Versienummer : Documentatie 1.0 Datum publicatie: Datum laatste wijziging: Auteur: 24-2-2011 24-2-2011 Anton van der Linden Onderwerp: Documentclassificatie:

Nadere informatie

ATOS Viewer for Dental Frameworks User Manual

ATOS Viewer for Dental Frameworks User Manual ATOS Viewer for Dental Frameworks User Manual www.dentwise.eu Inhoud Content NEDERLANDS... 2 1. Installatie... 2 2. Algemene Functies... 2 3. Afstanden Meten... 3 4. Doorsneden Maken... 4 5. Weergave Aanpassen...

Nadere informatie

Handleiding Installatie ADS

Handleiding Installatie ADS Handleiding Installatie ADS Versie: 1.0 Versiedatum: 19-03-2014 Inleiding Deze handleiding helpt u met de installatie van Advantage Database Server. Zorg ervoor dat u bij de aanvang van de installatie

Nadere informatie

SPSS VOOR DUMMIES+ Werken met de NSE: enkele handige basisbeginselen. Gebaseerd op SPSS21.0 & Benchmarkbestand NSE 2014

SPSS VOOR DUMMIES+ Werken met de NSE: enkele handige basisbeginselen. Gebaseerd op SPSS21.0 & Benchmarkbestand NSE 2014 SPSS VOOR DUMMIES+ Werken met de NSE: enkele handige basisbeginselen Gebaseerd op SPSS21.0 & Benchmarkbestand NSE 2014 Huidig kennis- en ervaringsniveau?????? Beginners Gevorderden 2 Inhoud 1. Wat doe

Nadere informatie

Blackboard Toetsvragen maken in Word

Blackboard Toetsvragen maken in Word Blackboard Toetsvragen maken in Word Inleiding We gaan vragen maken in een Word en deze vragen via kopiëren en plakken vertalen naar een tekstbestand (.txt) wat Blackboard begrijpt. Opmerking: Dit is iets

Nadere informatie

Y.S. Lubbers en W. Witvoet

Y.S. Lubbers en W. Witvoet WEBDESIGN Eigen Site Evaluatie door: Y.S. Lubbers en W. Witvoet 1 Summary Summary Prefix 1. Content en structuur gescheiden houden 2. Grammaticaal correcte en beschrijvende markup 3. Kopregels 4. Client-

Nadere informatie

Installatie instructies

Installatie instructies OpenIMS CE Versie 4.2 Installatie instructies OpenSesame ICT BV Inhoudsopgave 1 INLEIDING... 3 2 INSTALLATIE INSTRUCTIES... 4 3 OPENIMS SITECOLLECTIE CONFIGURATIE... 6 OpenIMS CE Installatie instructies

Nadere informatie

Selenium IDE Webdriver. Introductie

Selenium IDE Webdriver. Introductie Selenium IDE Webdriver Het Wielsem 10, 5231 BW s- Hertogenbosch, telefoon 073-6409311 e- mail info@testwork.nl internet http://www.testwork.nl 1 Inhoudsopgave 1 Inhoudsopgave... 2 2 Selenium IDE... 3 3

Nadere informatie

EmbroideryDesign Store

EmbroideryDesign Store EmbroideryDesign Store Wat kan ik met Buzztools? 1 Bekijken en afdrukken van je borduurpatronen (van vele merkenborduurbestanden) vanaf harde schijf of cd rom. Ook alle ingezipte patronen kunnen bekeken

Nadere informatie

Denit Backup instellen op een Linux server

Denit Backup instellen op een Linux server Denit Backup instellen op een Linux server Deze handleiding beschrijft de stappen om de back-up software van Ahsay in te stellen. AANMAKEN BACK-UP SET... 2 DE SCHEDULER INSTELLEN... 4 HET FILTER INSTELLEN...

Nadere informatie

DBMS. DataBase Management System. Op dit moment gebruiken bijna alle DBMS'en het relationele model. Deze worden RDBMS'en genoemd.

DBMS. DataBase Management System. Op dit moment gebruiken bijna alle DBMS'en het relationele model. Deze worden RDBMS'en genoemd. SQL Inleiding relationele databases DBMS DataBase Management System!hiërarchische databases.!netwerk databases.!relationele databases.!semantische databases.!object oriënted databases. Relationele databases

Nadere informatie

ARCHIEFBEHEER. Basis gebruikersgids. > RS-Web

ARCHIEFBEHEER. Basis gebruikersgids. > RS-Web Basis gebruikersgids > RS-Web >> Januari 2011 > Inhoud Toegang tot RS-Web 1. Home 1a. Intro 1b. My Preferences 1c. Change Password 1d. User Admin 2. Meest gebruikte functies 2a. Doos laten ophalen ter

Nadere informatie

PubMed MyNCBI attendering en andere functies

PubMed MyNCBI attendering en andere functies MedLib-manual PubMed MyNCBI 1 / 6 PubMed MyNCBI attendering en andere functies English http://www-fgg.eur.nl/medbib/manuals/m202e_pubmed-myncbi.pdf Medische Bibliotheek Erasmus MC (AV) versie 29-03-2011

Nadere informatie

Technische nota AbiFire5 Rapporten maken via ODBC

Technische nota AbiFire5 Rapporten maken via ODBC Technische nota AbiFire5 Rapporten maken via ODBC Laatste revisie: 29 juli 2009 Inhoudsopgave Inleiding... 2 1 Installatie ODBC driver... 2 2 Systeeminstellingen in AbiFire5... 3 2.1 Aanmaken extern profiel...

Nadere informatie

6.8 Lijsten: oefeningen

6.8 Lijsten: oefeningen 6.8 Lijsten: oefeningen Opgaven 44.: Records zoeken Open het document "Autokosten". Klik in de lijst. Kies de opdracht 'Data - Formulier' [Data - Form]. Klik de knop 'Criteria' [Criteria]. Vul als zoekcriterium

Nadere informatie

Auteur boek: Vera Lukassen Titel boek: Excel Gevorderden 2010 Engels

Auteur boek: Vera Lukassen Titel boek: Excel Gevorderden 2010 Engels Auteur boek: Vera Lukassen Titel boek: Excel Gevorderden 2010 Engels 2011, Serasta Uitgegeven in eigen beheer info@serasta.nl 1ste druk: september 2015 ISBN: Dit boek is gedrukt op een papiersoort die

Nadere informatie

Databank - Basis 1. Inhoud. Computervaardigheden en Programmatie. Hoofdstuk 4 Databank - Basis. Terminologie. Navigeren door een Venster

Databank - Basis 1. Inhoud. Computervaardigheden en Programmatie. Hoofdstuk 4 Databank - Basis. Terminologie. Navigeren door een Venster 4. 4. Inhoud rste BAC Toegepaste Biologische Wetenschappen Hoofdstuk 4 Databank Terminologie, Navigeren, Importeren Tabellen Records/Velden manipuleren Queries (Vragen) [Ook in SQL] sorteren filter volgens

Nadere informatie

Programmeren. Cursus Python

Programmeren. Cursus Python Programmeren Cursus Python Cursus Python Omschrijving In deze cursus leren de deelnemers te programmeren in de objectgeoriënteerde programmeertaal Python. Python is een taal die vaak wordt gebruikt voor

Nadere informatie

Bitrix Site Manager gebruikershandleiding BureauZuid

Bitrix Site Manager gebruikershandleiding BureauZuid Bitrix Site Manager gebruikershandleiding BureauZuid Introductie Deze gebruikershandleiding geeft gedetailleerde basisinformatie over hoe te werken met Bitrix Site Manager. Deze handleiding is bedoeld

Nadere informatie

Deel 2: Endnote bibliografische software gebruiken als databasemanager en editor

Deel 2: Endnote bibliografische software gebruiken als databasemanager en editor Deel 2: Endnote bibliografische software gebruiken als databasemanager en editor Versie feb. 2015 pag. 38 Endnote output: 1. Organiseer je database 2. Doorzoek de referenties in je database 3. Publiceren,

Nadere informatie

Databases - Inleiding

Databases - Inleiding Databases Databases - Inleiding Een database is een verzameling van een aantal gegevens over een bepaald onderwerp: een ledenbestand van een vereniging, een forum, login gegevens. In een database worden

Nadere informatie

Stap 1: Registreer via de link op de G-schijf beschikbaar na inloggen met de teken-account, verzend via Submit. Nadien krijg je een bevestiging op

Stap 1: Registreer via de link op de G-schijf beschikbaar na inloggen met de teken-account, verzend via Submit. Nadien krijg je een bevestiging op Stap 1: Registreer via de link op de G-schijf beschikbaar na inloggen met de teken-account, verzend via Submit. Nadien krijg je een bevestiging op het scherm met de melding dat de registratie compleet

Nadere informatie

Plotten. technisch tekenwerk AUTOCAD 2000

Plotten. technisch tekenwerk AUTOCAD 2000 Inleiding Voor het plotten van uw bent u bij Lifoka aan het juiste adres. Snel, betrouwbaar en dat in grote of kleine oplagen. Niet alleen het plotten, maar ook vergaren en verzenden kan Lifoka voor u

Nadere informatie

CENTEXBEL CLIENT WEB

CENTEXBEL CLIENT WEB CENTEXBEL CLIENT WEB Table of Contents Wat is de Centexbel Client web?... 2 Hoe een account activeren in het programma?... 2 Schermen... 4 Log in... 4 Wat als er een personeelslid met de account gegevens

Nadere informatie

Bio-informatica Similariteit Searches. Peter De Rijk

Bio-informatica Similariteit Searches. Peter De Rijk Bio-informatica Similariteit Searches Peter De Rijk 6 Similariteit searches Zoeken naar gelijkende sequenties in sequentie databanken Korte sequentie (b.v. EST) waar we meer van willen weten Andere korte

Nadere informatie

NCTS - INFORMATIE INZAKE NIEUWIGHEDEN VOOR 2010

NCTS - INFORMATIE INZAKE NIEUWIGHEDEN VOOR 2010 NCTS - INFORMATIE INZAKE NIEUWIGHEDEN VOOR 2010 Op basis van het nieuwe artikel 365, lid 4 (NCTS) en het nieuwe artikel 455bis, lid 4 (NCTS-TIR) van het Communautair Toepassingswetboek inzake douane 1

Nadere informatie

ETS 4.1 Beveiliging & ETS app concept

ETS 4.1 Beveiliging & ETS app concept ETS 4.1 Beveiliging & ETS app concept 7 juni 2012 KNX Professionals bijeenkomst Nieuwegein Annemieke van Dorland KNX trainingscentrum ABB Ede (in collaboration with KNX Association) 12/06/12 Folie 1 ETS

Nadere informatie

Hoe kun je je op RSS-Feeds abonneren? En hoe deze te lezen. Be updated! For friends and family door : Sander van de Pol ( mei 2007 ).

Hoe kun je je op RSS-Feeds abonneren? En hoe deze te lezen. Be updated! For friends and family door : Sander van de Pol ( mei 2007 ). Hoe kun je je op RSS-Feeds abonneren? En hoe deze te lezen. Be updated! For friends and family door : Sander van de Pol ( mei 2007 ). Ik wil hier 3 manieren bespreken : - via Internet Explorer 7 - via

Nadere informatie

1. Voor het installeren wordt geadviseerd een backup te maken van uw database en bestanden.

1. Voor het installeren wordt geadviseerd een backup te maken van uw database en bestanden. NL: KiyOh.nl gebruikers kunnen met deze plug in automatisch klantbeoordelingen verzamelen, publiceren en delen in social media. Wanneer een klant een bestelling heeft gemaakt in uw Magento Shop, wordt

Nadere informatie

beginnen met bloggen (kleine workshop Wordpress)

beginnen met bloggen (kleine workshop Wordpress) beginnen met bloggen (kleine workshop Wordpress) Een weblog is van oorsprongeen lijstje linktips met een stukje tekst. Oorspongvan het weblog Jorn Barger is an American blogger, best known as editor of

Nadere informatie

studievaardigheden studentassistent: Alice de Vries alice-de-vries@hotmail werkcollege / practicum

studievaardigheden studentassistent: Alice de Vries alice-de-vries@hotmail werkcollege / practicum studievaardigheden studentassistent: Alice de Vries alice-de-vries@hotmail werkcollege / practicum Hendrik Jan Hoogeboom h.j.hoogeboom@liacs.leidenuniv paleistuin (computers) tijd 10.45 15.00 studievaardigheden

Nadere informatie

Gebruikers handleiding. Lizard Configuration Manager ToolTip. Installatie. Instellen. Initieel instellen

Gebruikers handleiding. Lizard Configuration Manager ToolTip. Installatie. Instellen. Initieel instellen Gebruikers handleiding Lizard Configuration Manager ToolTip Installatie Installeer eerst het volgende: Installeer python 2.5.2; zie de map Breda\Tooltip\lcm\install\python-2.5.2.msi Ga naar dos (run/uitvoeren

Nadere informatie

FOR DUTCH STUDENTS! ENGLISH VERSION NEXT PAGE. Toets Inleiding Kansrekening 1 22 februari 2013

FOR DUTCH STUDENTS! ENGLISH VERSION NEXT PAGE. Toets Inleiding Kansrekening 1 22 februari 2013 FOR DUTCH STUDENTS! ENGLISH VERSION NEXT PAGE Toets Inleiding Kansrekening 1 22 februari 2013 Voeg aan het antwoord van een opgave altijd het bewijs, de berekening of de argumentatie toe. Als je een onderdeel

Nadere informatie

Handleiding DirectAdmin

Handleiding DirectAdmin Handleiding DirectAdmin Heeft uw hostingpakket het control panel DirectAdmin dan leest u in deze sectie hoe u uw pakket kunt beheren. Dat doet u via : http://www.uwdomein.nl:2222. Handleiding DirectAdmin

Nadere informatie

Badge it. Inhoudsopgave. 1. Installatie... 3

Badge it. Inhoudsopgave. 1. Installatie... 3 Badge it voor Windows 95/98/NT/2000/XP Inhoudsopgave 1. Installatie... 3 2. Start... 4 2.1. Nieuwe database maken... 5 2.2. De geselecteerde database openen... 5 2.3. De naam van de geselecteerde database

Nadere informatie

Multi user Setup. Firebird database op een windows (server)

Multi user Setup. Firebird database op een windows (server) Multi user Setup Firebird database op een windows (server) Inhoudsopgave osfinancials multi user setup...3 Installeeren van de firebird database...3 Testing van de connectie met FlameRobin...5 Instellen

Nadere informatie

WWW.EMINENT-ONLINE.COM

WWW.EMINENT-ONLINE.COM WWW.EMINENT-OINE.COM HNDLEIDING USERS MNUL EM1016 HNDLEIDING EM1016 USB NR SERIEEL CONVERTER INHOUDSOPGVE: PGIN 1.0 Introductie.... 2 1.1 Functies en kenmerken.... 2 1.2 Inhoud van de verpakking.... 2

Nadere informatie

Handleiding DirectAdmin

Handleiding DirectAdmin Handleiding DirectAdmin Heeft uw hostingpakket het control panel DirectAdmin dan leest u in deze sectie hoe u uw pakket kunt beheren. Dat doet u via : http://www.uwdomein.nl:2222. 1 Inloggen Voordat u

Nadere informatie

Handout Workshop Open Refine

Handout Workshop Open Refine Handout Workshop Open Refine Adlibgebruikersgroep 30.04.2015 Alina Saenko PACKED vzw Inge van Stokkom Rijksmuseum Inhoud: Deel 1. Introductie... 2 1.1 Installeren... 2 1.2 Dataset importeren in Open Refine...

Nadere informatie

Hoe te werken met Word en SmarTeam?

Hoe te werken met Word en SmarTeam? Hoe te werken met Word en SmarTeam? Nikhef number: Item number: Date: 09/09/2010 Page: 1 of 17 23001-MT-00008 AA1330 Status: In Work Revision: A.4 Project: Bedrijf Intern Technical Departments Department:

Nadere informatie

Datum 15 juni 2006 Versie 1.0.6. Exchange Online. Handleiding voor gebruiker Release 1.0

Datum 15 juni 2006 Versie 1.0.6. Exchange Online. Handleiding voor gebruiker Release 1.0 Datum 1.0.6 Exchange Online Handleiding voor gebruiker Release 1.0 1.0.6 Inhoudsopgave 1 Instellingen e-mail clients 2 1.1 Gebruik via Outlook 2003 2 1.2 Gebruik via ActiveSync 15 1.3 Gebruik via andere

Nadere informatie

MA!N Rapportages en Analyses

MA!N Rapportages en Analyses MA!N Rapportages en Analyses Auteur Versie CE-iT 1.2 Inhoud 1 Inleiding... 3 2 Microsoft Excel Pivot analyses... 4 2.1 Verbinding met database... 4 2.2 Data analyseren... 5 2.3 Analyses verversen... 6

Nadere informatie

LDA Topic Modeling. Informa5ekunde als hulpwetenschap. 9 maart 2015

LDA Topic Modeling. Informa5ekunde als hulpwetenschap. 9 maart 2015 LDA Topic Modeling Informa5ekunde als hulpwetenschap 9 maart 2015 LDA Voor de pauze: Wat is LDA? Wat kan je er mee? Hoe werkt het (Gibbs sampling)? Na de pauze Achterliggende concepten à Dirichlet distribu5e

Nadere informatie

Solcon Online Backup. Aan de slag handleiding voor Linux

Solcon Online Backup. Aan de slag handleiding voor Linux Version 1 September 2007 Installatie: 1. Download het setup bestand (obm-nix.tar.gz) van de website. 2. Voor de volgende stappen dient u root te zijn. 3. Doorloop de volgende stappen voor het uitpakken

Nadere informatie

SQL is opgebouwd rond een basisinstructie waaraan één of meerdere componenten worden toegevoegd.

SQL is opgebouwd rond een basisinstructie waaraan één of meerdere componenten worden toegevoegd. BASISINSTRUCTIES SQL SQL : Structured Query Language is een taal gericht op het ondervragen van een relationele database en die aan veel klassieke databasemanagementsystemen kan worden gekoppeld. SQL is

Nadere informatie

TaskCentre Web Service Connector: Creëren van requests in Synergy Enterprise

TaskCentre Web Service Connector: Creëren van requests in Synergy Enterprise TaskCentre Web Service Connector: Creëren van requests in Synergy Enterprise Inhoudsopgave 1. Voorbereiding... 4 2. Web Service Connector tool configuratie... 5 3. TaskCentre taak voor het aanmaken van

Nadere informatie

Inhoudsopgave: Whisper380-computerhulp

Inhoudsopgave: Whisper380-computerhulp Versie: 1.0 Gemaakt door: Whisper380 Eigenaar: Datum: 17-10-2010 Inhoudsopgave: Inhoudsopgave:... 2 Het programma downloaden.... 3 Het programma downloaden... 4 De installatie van het programma... 6 Het

Nadere informatie

Tools voor itemanalyse

Tools voor itemanalyse Tools voor itemanalyse Wido La Heij Cognitieve Psychologie laheij@fsw.leidenuniv.nl Klazine Verdonschot ICT en Onderwijscoach kverdonschot@fsw.leidenuniv.nl De weg naar het Grade Center Menu van de toetskolom

Nadere informatie

Icoon/Icon Betekenis Description. Change scheduling Online. Gaat offline op (datum/tijd) Online. Going offline on (date/time)

Icoon/Icon Betekenis Description. Change scheduling Online. Gaat offline op (datum/tijd) Online. Going offline on (date/time) Algemeen/General Gepubliceerd maar gewijzigd Published but changed Meer acties op geselecteerde content More actions on selected content Gepubliceerd en niet gewijzigd Published and not changed Terugdraaien

Nadere informatie

Automating Complex Workflows using Processing Modeler

Automating Complex Workflows using Processing Modeler Automating Complex Workflows using Processing Modeler QGIS Tutorials and Tips Author Ujaval Gandhi http://google.com/+ujavalgandhi Translations by Dick Groskamp This work is licensed under a Creative Commons

Nadere informatie

INHOUDSOPGAVE...2 YAHOO!...3

INHOUDSOPGAVE...2 YAHOO!...3 INHOUDSOPGAVE INHOUDSOPGAVE...2 YAHOO!...3 U HEEFT AL EEN YAHOO! ACCOUNT...3 YAHOO! ACCOUNT VOOR FLICKR AANMAKEN...3 U heeft Geen Yahoo! account maar wel Google account...3 Yahoo! account aanmaken...4

Nadere informatie

Wat is nieuw in Enterprise Guide

Wat is nieuw in Enterprise Guide Enterprise Guide 42 4.2 Lieve Goedhuys Copyright 2009 SAS Institute Inc. All rights reserved. Wat is nieuw in Enterprise Guide Vereenvoudigde interface Gebruikersinterface i Project recovery Conditionele

Nadere informatie

Handleiding beheer lijst.hva.nl. See page 11 for Instruction in English

Handleiding beheer lijst.hva.nl. See page 11 for Instruction in English Handleiding beheer lijst.hva.nl See page 11 for Instruction in English Maillijsten voor medewerkers van de Hogeschool van Amsterdam Iedereen met een HvA-ID kan maillijsten aanmaken bij lijst.hva.nl. Het

Nadere informatie

Hieronder volgt een overzicht van relevante contactpersonen binnen KPN Telecom.

Hieronder volgt een overzicht van relevante contactpersonen binnen KPN Telecom. 1. Contact personen 2. Rent-a-Switch service 3. Validaties 4. Afhandeling Rent-a-Switch orders 5. Foutmeldingen 1. Contact personen Hieronder volgt een overzicht van relevante contactpersonen binnen KPN

Nadere informatie

Netwerkprinter Dell 1320C installeren op Ubuntu 10.04 LTS - Lucid Lynx

Netwerkprinter Dell 1320C installeren op Ubuntu 10.04 LTS - Lucid Lynx Netwerkprinter Dell 1320C installeren op Ubuntu 10.04 LTS - Lucid Lynx Er is geen Linux driver voor deze printer, maar het werkt ook met de driver van de Fuji Xerox DocuPrint C525A Direct link to Linux

Nadere informatie

db-direct internet EU

db-direct internet EU Deutsche Bank Global Transaction Banking db-direct internet EU 4 Aan de slag met de db-direct internet EU App in Autobahn App Market www.db.com Aan de slag met de db-direct internet EU applicatie in Autobahn

Nadere informatie

The Nanny Personeel. Lokaal inloggen

The Nanny Personeel. Lokaal inloggen The Nanny Personeel Lokaal inloggen Inleiding Binnen uw organisatie wordt gebruik gemaakt van The Nanny Personeel. The Nanny Personeel is een webapplicatie. Echter, in tegenstelling tot de meeste websites,

Nadere informatie

Access. Accomplish. Share. Tips voor het gebruik van Office 365: tools voor email, web, en samenwerking

Access. Accomplish. Share. Tips voor het gebruik van Office 365: tools voor email, web, en samenwerking Access. Accomplish. Share. Tips voor het gebruik van Office 365: tools voor email, web, en samenwerking Werk samen, beter Stel uw team in op succes 2 Zie wie online is Communiceer snel met uw team Team

Nadere informatie

Bioinformatica tentamen D2 voor 2MNW op maandag 30/05/2005 van 13:30-16:30 in Q105

Bioinformatica tentamen D2 voor 2MNW op maandag 30/05/2005 van 13:30-16:30 in Q105 Bioinformatica tentamen D2 voor 2MNW op maandag 30/05/2005 van 13:30-16:30 in Q105 Naam: Studentnummer: NB: er zijn extra vellen achteraan bijgevoegd die je kunt gebruiken om antwoorden verder uit te werken,

Nadere informatie

Webapplicatie-generatie NIOC 2013

Webapplicatie-generatie NIOC 2013 Webapplicatie-generatie NIOC 2013 Eddy Luursema, Misja Nabben, Arnoud van Bers Research Group Model Based Information Systems Presentation Introduction M-BIS Data intensive systems Requirements Generation

Nadere informatie

EndNote X7 Quick Start guide Medische Bibliotheek september 2015

EndNote X7 Quick Start guide Medische Bibliotheek september 2015 EndNote X7 Quick Start guide Medische Bibliotheek september 2015 Een up-to-date versie is beschikbaar via www.ru.nl/ubn/endnoteumc 1 EndNote installeren... 1 2 EndNote Library... 1 3 Library vullen...

Nadere informatie

De plug-in is heel eenvoudig te installeren met een setup-programma. Waarna je een aantal menu opties in het tools menu er bij krijgt.

De plug-in is heel eenvoudig te installeren met een setup-programma. Waarna je een aantal menu opties in het tools menu er bij krijgt. Plsqldoc Genereer je documentatie Beeklaan 444 2562 BK Den Haag www.darwin-it.nl info@darwin-it.nl KvK 27283780 ING 65.35.40.663 Technical Architect Net als (vrijwel) elke ontwikkelaar vind ik het documenteren

Nadere informatie

Leerlingenhandleiding

Leerlingenhandleiding Leerlingenhandleiding Afsluitende module Op zoek naar een gen in een databank Op zoek naar een gen in een databank Tijdens het DNA-lab Lees de taal van de tumor hebben jullie drie genen onderzocht. Welke

Nadere informatie

Installatie SQL: Server 2008R2

Installatie SQL: Server 2008R2 Installatie SQL: Server 2008R2 Download de SQL Server 2008.exe van onze site: www.2work.nl Ga naar het tabblad: Downloads en meld aan met: klant2work en als wachtwoord: xs4customer Let op! Indien u een

Nadere informatie

Instructie SCAN-Office. uit. Automatisering helpt Agrarisch Natuurbeheer. Uitgevoerd door collectieven

Instructie SCAN-Office. uit. Automatisering helpt Agrarisch Natuurbeheer. Uitgevoerd door collectieven uit Instructie SCAN-Office Automatisering helpt Agrarisch Natuurbeheer Uitgevoerd door collectieven Stichting Collectieven Agrarisch Natuurbeheer, SCAN Uitgevoerd door: SCAN Gerard van Drooge Bert Wiekema

Nadere informatie

Maillijsten voor medewerkers van de Universiteit van Amsterdam

Maillijsten voor medewerkers van de Universiteit van Amsterdam See page 11 for Instruction in English Maillijsten voor medewerkers van de Universiteit van Amsterdam Iedereen met een UvAnetID kan maillijsten aanmaken bij list.uva.nl. Het gebruik van de lijsten van

Nadere informatie

Uitleg site maken. Stap 2) Nu kiezen we de lay-out. Je kunt het aantal kolommen kiezen. Je kiest nu de eerste. Maar dit kun je later veranderen

Uitleg site maken. Stap 2) Nu kiezen we de lay-out. Je kunt het aantal kolommen kiezen. Je kiest nu de eerste. Maar dit kun je later veranderen Uitleg site maken Hier vind je een uitleg hoe je bij Google een site kunt maken. Maak eerst een map bij je Favorieten en zet daar onderstaande sites in. Later zet je daar ook je eigen site in. Handig om

Nadere informatie

User accounts maken in een Wandy Hotspot, d.m.v. een batch.

User accounts maken in een Wandy Hotspot, d.m.v. een batch. User accounts maken in een Wandy Hotspot, d.m.v. een batch. Bij het in gebruik nemen van een Wandy Hotspot is het aanmaken van gebruikers een tijdrovende klus. Om snel veel accounts aan te maken hebben

Nadere informatie

Leeftijdcheck (NL) Age Check (EN)

Leeftijdcheck (NL) Age Check (EN) Leeftijdcheck (NL) Age Check (EN) [Type text] NL: Verkoopt u producten die niet aan jonge bezoekers verkocht mogen worden of heeft uw webwinkel andere (wettige) toelatingscriteria? De Webshophelpers.nl

Nadere informatie

Leerlingenhandleiding

Leerlingenhandleiding Leerlingenhandleiding Zelfstandige module Op zoek naar een gen in een databank Op zoek naar een gen in een databank Met behulp van databanken kun je informatie opzoeken over genen. Een databank is een

Nadere informatie

SQL datadefinitietaal

SQL datadefinitietaal SQL datadefinitietaal We kunnen er het schema van de database mee bepalen: metadata toevoegen, wijzigen en verwijderen uit een database. Basiscommando's: CREATE : toevoegen van metagegevens DROP : verwijderen

Nadere informatie

Zimplit is een CMS (content management system). Dat betekend dat je een website kunt ontwerpen en veranderen terwijl die online staat.

Zimplit is een CMS (content management system). Dat betekend dat je een website kunt ontwerpen en veranderen terwijl die online staat. Een website maken met ZIMPLIT. Geen kennis van html nodig. www.acc.dds.nl/lesonline/zimplit/ Download Zimplit handleiding pdf Download de Zimplit bestanden Zimplit CMS Handleiding Zimplit is een CMS (content

Nadere informatie

Handleiding Invoeren van een Catia V5R19 document in SmarTeam

Handleiding Invoeren van een Catia V5R19 document in SmarTeam Handleiding Invoeren van een Catia V5R19 document in SmarTeam Versie: 1 Rev. 1 Datum: 08-12- 09 1. Maak een part, product (= assembly) of tekening in Catia. Bij het aanmaken van Part en Product in Catia

Nadere informatie

[BP-ebMS-H-000] Welke versie van Hermes moet er gebruikt worden?

[BP-ebMS-H-000] Welke versie van Hermes moet er gebruikt worden? [BP-ebMS-H-000] Welke versie van Hermes moet er gebruikt worden? Gebruik altijd de laatste versie omdat er serieuse bug-fixes in kunnen zitten. Check altijd de release notes en openstaande bugs. Er is

Nadere informatie

Deel 1: starten met Endnote, mogelijkheden van bibliografische software

Deel 1: starten met Endnote, mogelijkheden van bibliografische software Deel 1: starten met Endnote, mogelijkheden van bibliografische software Versie feb. 2015 pag. 1 Bibliografische software? Endnote, Reference Manager, RefWorks, Zotero, Mendeley zijn bibliografische softwarepakketten

Nadere informatie

! GeoNetwork INSPIRE Atom!

! GeoNetwork INSPIRE Atom! GeoNetwork INSPIRE Atom GeoNetwork INSPIRE Atom 1 Configuration 2 Metadata editor 3 Services 3 Page 1 of 7 Configuration To configure the INSPIRE Atom go to Administration > System configuration and enable

Nadere informatie

Inloggen op studentenmailbox sinds 5 april

Inloggen op studentenmailbox sinds 5 april Inloggen op studentenmailbox sinds 5 april 1. Surf naar https://www.outlook.com/student.kdg.be 2. Login met je KdG e-mailadres (@student.kdg.be) als gebruikersnaam en je wachtwoord voor Blackboard en e-studentservice

Nadere informatie

Admin handleiding. Essentius Dropbox handleiding. Pagina 1

Admin handleiding. Essentius Dropbox handleiding. Pagina 1 Admin handleiding Dropbox kun je vanaf elke computer met een internetverbinding gebruiken. Met behulp van een e- mailadres maak je je eigen dropbox aan. Dropbox stelt gratis 2 gb opslagruimte ter beschikking,

Nadere informatie

Tentamen Bioinformatic Data Analysis (1/3 deel van de cursus Systems Biology) April 9 th 2015, 17:00-20:00, Educatorium Gamma

Tentamen Bioinformatic Data Analysis (1/3 deel van de cursus Systems Biology) April 9 th 2015, 17:00-20:00, Educatorium Gamma Tentamen Bioinformatic Data Analysis (1/3 deel van de cursus Systems Biology) April 9 th 2015, 17:00-20:00, Educatorium Gamma Cursuscode: B B1SYSB09 Enkele regels van orde (niet uitputtend): - De eerste

Nadere informatie

WHITE PAPER. by Default Reasoning

WHITE PAPER. by Default Reasoning Title: Migratie van Windows 2003 naar Windows 2008 domain Authors: Marek Version: Final Date: 05 april 2009 Categories: Windows Server 2008 defaultreasoning.wordpress.com Page 1 Scenario: Een Windows Server

Nadere informatie

Informatievaardigheden Introductie EndNote

Informatievaardigheden Introductie EndNote Informatievaardigheden Introductie EndNote TU Delft Library Delft University of Technology Challenge the future TU Delft Library HowInformatievaardigheden to find and use scientific / EndNote information

Nadere informatie

ISW Presents Debian Homeserver Workshop

ISW Presents Debian Homeserver Workshop ISW Presents Debian Homeserver Workshop Lucas Kauffman Vincent Andries Debian Homeserver Voorzitter ISW lucas@isw.student.khleuven.be serveradmin ISW goose@isw.student.khleuven.be Debian Homeserver Installatie

Nadere informatie

Multimedia Information Retrieval

Multimedia Information Retrieval Doel Multimedia Information Retrieval Opdracht 2: Text analysis versie 0.6, 25 november 2008 Onderzoeken van de kwantitatieve eigenschappen van een aantal teksten; het uitvoeren van een kwantitatieve tekstanalyse;

Nadere informatie

- Plan Zo kun je een. website bouwen!

- Plan Zo kun je een. website bouwen! - Plan Zo kun je een website bouwen! BoekjeHoeKanJeEenWebsiteBouwen.i1 1 8-7-2008 17:23:14 BoekjeHoeKanJeEenWebsiteBouwen.i2 2 8-7-2008 17:23:15 In dit boekje staat de uitgebreide versie van hoe je een

Nadere informatie

ExpressShipper. 1 Configuratiehandleiding. Documentatie ExpressShipper Page 1 of 20

ExpressShipper. 1 Configuratiehandleiding. Documentatie ExpressShipper Page 1 of 20 ExpressShipper Documentatie ExpressShipper Page 1 of 20 1 Inleiding 3 2 Instellingen 4 2.1 Add consignment range 4 2.2 Metrische of empirische (metric of Imperial) waarden 5 2.3 Adres Import 6 2.4 Document

Nadere informatie

HTS applicatie: digitaal testen via uw eigen pc met het Hogrefe TestSystem (HTS)

HTS applicatie: digitaal testen via uw eigen pc met het Hogrefe TestSystem (HTS) HTS applicatie: digitaal testen via uw eigen pc met het Hogrefe TestSystem (HTS) Na de installatie van het programma vindt u een icoon voor HTS op uw desktop, onder Start en in uw Programma folder. Wanneer

Nadere informatie

Absentie Presentie Server Migratie

Absentie Presentie Server Migratie Absentie Presentie Server Migratie Auteur A. Boerkamp Versie V1.2 Datum 11-08-2010 Status Voor Intern / Extern gebruik Pincash International, 3066GS Rotterdam, Anthonetta Kuijlstraat 43-45, 010-2868000

Nadere informatie

Chapter 4. eenvoudige webserver opzetten

Chapter 4. eenvoudige webserver opzetten Chapter 4. eenvoudige webserver opzetten Table of Contents 4.1. overzicht... 44 4.2. software beheren op Linux... 44 4.3. vi... 45 4.4. html... 45 4.5. apache2... 45 4.6. twee extra websites op de apache

Nadere informatie