Supplementary Figures for Sciuscio et al.

Maat: px
Weergave met pagina beginnen:

Download "Supplementary Figures for Sciuscio et al."

Transcriptie

1 Supplementary Figures for Sciuscio et al. Extent and Patterns of Promoter Methylation in Glioblastoma and Respective Derived Spheres What Matters?

2 Figure S GBM GS GBM GS GBM GS GBM GS GBM GS U M U M U M U M U M U M U M U M U M U M GBM GS GBM GS U M U M U M U M 2638 GBM GS U M U M 2108 GBM GS U M U M 1871 GBM GS U M U M

3 Figure S2 CpG MS primers A B GBM GS GBM GS C 2638 GBM GS D Cell lines LN18 LN229

4 Figure S3 A PBL * 2683 LN 229 LN18 H2O U M U M U M U M U M U M U M B CpG MS primers GBM 2558

5 Figure S4 10 GS 2207 GS 2540 GS 2288 GS 2669 GS

6 Figure S p53 A 2683 H&E C B GS nude mouse GS nude mouse D Human GBM

7 Figure S6 7.4 Log2_204880_at_ Meth_ Unmeth_ Brain Glioblastoma

8 Table S1 Gene/application Forward primer Reverse primer Amplicon Anealing Temp. NOTES /MSP 1 st step GGATATGTTGGGATAGTT CCAAAAACCCCAAACCC 289 bp 52 C Palmisano WA et al. Cancer Res 2000; 60: /MSP 2 nd step (meth) TTTCGACGTTCGTAGGTTT TCGC GCACTCTTCCGAAAACGAA ACG 81 bp 62 C Esteller M et al. N Engl J Med 2000; 343: /MSP 2 nd step (unmeth) TTTGTGTTTTGATGTTTGT AGGTTTTTGT AACTCCACACTCTTCCAAAA ACAAAACA 93 bp 62 C Esteller et al. N Engl J Med 2000; 343: /q MSP AGCGATGCGTTCGAGCAT CGCUTTTCGACGTTCGTAG GTTTTCGC CTCGAAACTACCACCGTCC CGA 136 bp 62 C Vlassenbroeck et al. J Mol Diagn 2008; 10: ACTB /q MSP AGCGATGCGTTCGAGCAT CGCUTAGGGAGTATATAG GTTGGGGAAGTT AACACACAATAACAAACAC AAATTCAC 125 bp 62 C Vlassenbroeck et al. J Mol Diagn 2008; 10: /q RT PCR CAC CGT TTG CGA CTT GGT ACT T AGA CCC TGC TCA CAA CCA GAC A 110 bp 60 C Rood et al. Neuro Oncol 2004; 6: GAPDH /q RT PCR AGG TGA AGG TCG GAG TCA ACG CGT TCT CAG CCT TGA CGG TG 186 bp 60 C Andreeff et al. Leukemia 2008; 22: /q ChIP AAA AGG TAC GGG CCA TTT G CAG TCT GCG CAT CCT CG 171 bp 60 C Ji et al. Carcinogenesis 2008; 29: GAPDH /q ChIP TACTAGCGGTTTTACGGGC G TCGAACAGGAGGAGCAGA GAGCGA 166 bp 60 C EZ ChIP, Chromatin Immunoprecipitation Kit. Uspstate (Millipore), Billerica, MA MYOD1 /q ChIP CCGCCTGAGCAAAGTAAA TGA GGCAACCGCTGGTTTGG 75 bp 60 C Taniguchi H et al. J Pathol 2007; 213:

9 Supplementary Information Sciuscio et al. Legends for Supplementary Figures Figure S1. Methylation Specific PCR Methylation specific PCR (MSP) on glioblastoma derived sphere (GS) fractions and respective parental tumor tissues (GBM). U, unmethylated; M, methylated. Of note, the weak unmethylated bands obtained by MSP in the samples GS_2288 and GS_2207 are in apparent contradiction to the MS-clone sequencing as shown in Fig. 1. This is likely due to the primer location. Looking at the methylation pattern (MS_clone sequencing, Fig. 1) it is evident that the MSP primers are interrogating a less densely methylated region that with some infidelity of the assay will give rise to some amplification even if not all CpGs are unmethylated. Due to the relatively low number of clones analyzed we did not detect these rarely methylated/unmethylated alleles. Conversely the amplifying power of the PCR is able to reveal also underrepresented populations of sparsely methylated/unmethylated alleles that presumably gave rise to this band. In contrast, the two bands present for GS_2683, are in agreement with clone sequencing and acgh that support the presence of a methylated and an unmethylated allele as discussed in the text. A full gel including positive and negative controls is shown in Figure S3. Figure S2. Methylation Specific Sequencing of the promoter Methylation specific sequencing (Sanger method) of paired samples of glioblastoma (GBM) and respective glioblastoma derived spheres (GS) reveals that the promoter is unmethylated (A, B and C). The glioblastoma cell lines LN18 and LN229 serve as negative and positive controls for methylation, respectively (D). The location of the CpGs interrogated by either gel based MSP (yellow/yellow) or qmsp (yellow/blue) are indicated. Black square, methylated CpG; white square, unmethylated CpG; green square, methylated and unmethylated CpG site; grey square, undetermined due to unreadable sequence. Figure S3. methylation pattern of glioblastoma 2558 (A) Methylation specific PCR (MSP) of GBM_2558. The detection of methylated is at the limit of detection using this qualitative MSP assay. Two out of four experiments yielded a visible band on a gel (marked with an arrow), two independent 1

10 Supplementary Information Sciuscio et al. experiments are shown here. The glioblastoma cell lines LN229 and LN18 with known methylation status are included as exclusively methylated or unmethylated controls, respectively (see also Fig. S2). PBL, peripheral blood lymphocytes (unmethylated); H 2 O, no template control. (U, unmethylated; M, methylated) (B) Methylation specific clone sequencing of GBM_2558 visualizes a relative low density methylation in a subpopulation of cells. The tumor content as estimated by H&E was 85%, but only 60% when considering CD68 immunostaining. Only FFPE tissue was available for this sample. The location of the CpGs interrogated by either gel based MSP (yellow/yellow) or qmsp (yellow/blue) are indicated. The pattern of methylation in the sample is in accordance with the difficulty to detect methylation by either MSP or qmsp in this sample. Black squares, methylated CpGs, white squares, unmethylated; grey squares undetermined due to unreadable sequence. Figure S4. ArrayCGH Representation of acgh data on chromosome 10 for selected glioblastoma derived spheres. The chromosomal location of the gene is indicated. The inserts show a magnification of the region with the 6 probes for. Deviation from the baseline (0) represents amplification (right shift, +1) or deletion (left shift, -1). Monosomy of chromosome 10 is detected in GS_2540, and GS_2669, exerts a deletion of 10pter to 10q22.2. The other GS display a normal chromosome 10 copy number. Figure S5. Characteristics of GS-induced intracranial tumors. The GS_2540 derived intracranial tumor that carries a p53-missense mutation (codon 248, CGG to TGG) was stained for p53 (A). The p53-positve tumor cells migrating along the corpus callosum to the opposite hemisphere demonstrate the highly invasive properties of these GS_2540 derived human tumor cells. (B) Higher magnification. (C) The hematoxilin and eosin stained intracranial tumor derived from GS_2683 displays an oligodendroglial component with the characteristic feature of cells displaying nuclear halo (fried egg appearance). This morphologic feature was also present in part of the patient s tumor (D) together with the classic chicken-wire pattern of the tumor vasculature, accordingly the patient s tumors had been classified as glioblastoma with an oligodendroglial component. 2

11 Supplementary Information Sciuscio et al. Figure S6. Differential expression in glioblastoma depending on status Box plot visualization of gene expression [log2] based on probe _at [Affymetrix HG-133Plus2.0 GeneChips (Affymetrix, Santa Clara, CA)] in a cohort of glioblastoma patients for whom gene expression profiles have been reported previously (Murat et al. 2008). There is a significant difference of expression between methylated (n=43) and unmethylated (n=35) glioblastoma (p<0.002; Mann-Whitney test), and between non-neoplastic brain (n=4) and unmethylated glioblastoma (p=0.025), but not between unmethylated cases and brain tissue (p=0.5). 3

SUPPLEMENTARY FIGURES AND TABLES

SUPPLEMENTARY FIGURES AND TABLES Altered RECQL5 expression in urothelial bladder carcinoma increases cellular proliferation and makes RECQL5 helicase activity a novel target for chemotherapy SUPPLEMENTARY FIGURES AND TABLES Supplementary

Nadere informatie

CHL1 hypermethylation as a potential biomarker of poor prognosis in breast cancer

CHL1 hypermethylation as a potential biomarker of poor prognosis in breast cancer www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2017 CHL1 hypermethylation as a potential biomarker of poor prognosis in breast cancer SUPPLEMENTARY FIGURES AND TABLES Supplementary

Nadere informatie

Torres et al. Supplementary Figure 1

Torres et al. Supplementary Figure 1 Torres et al. Supplementary Figure 1 A 9 tetrahydrocannabinol (THC) B Cannabidiol (CBD) C Temozolomide (TMZ) Supplementary Figure 1. Chemical structures of THC, CBD and TMZ. A 3 TMZ (μm) Torres et al.

Nadere informatie

Small molecule epigenetic screen identifies novel EZH2 and HDAC inhibitors that target glioblastoma brain tumor-initiating cells

Small molecule epigenetic screen identifies novel EZH2 and HDAC inhibitors that target glioblastoma brain tumor-initiating cells Small molecule epigenetic screen identifies novel EZH2 and HDAC inhibitors that target glioblastoma brain tumor-initiating cells SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure 1: UNC1999 inhibits

Nadere informatie

Meetkunde en Lineaire Algebra

Meetkunde en Lineaire Algebra Hoofdstuk 1 Meetkunde en Lineaire Algebra Vraag 1.1 Het trapoppervlak is een afwikkelbaar oppervlak met oneindig veel singuliere punten. Vraag 1.2 Het schroefoppervlak is een afwikkelbaar oppervlak met

Nadere informatie

Laboratory report. Independent testing of material surfaces. Analysis of leaching substances in treated wood samples conform guide line EU 10/2011

Laboratory report. Independent testing of material surfaces. Analysis of leaching substances in treated wood samples conform guide line EU 10/2011 Independent testing of material surfaces Laboratory report Analysis of leaching substances in treated wood samples conform guide line EU 10/2011 Customer Wasziederij De Vesting BV Trasweg 12 5712 BB Someren-Eind

Nadere informatie

Meetkunde en Lineaire Algebra

Meetkunde en Lineaire Algebra Hoofdstuk 1 Meetkunde en Lineaire Algebra Vraag 1.1 Het trapoppervlak is een afwikkelbaar oppervlak met oneindig veel singuliere punten. vals Vraag 1.2 Het schroefoppervlak is een afwikkelbaar oppervlak

Nadere informatie

FRAME [UPRIGHT MODEL] / [DEPTH] / [HEIGHT] / [FINISH] TYPE OF BASEPLATE P Base plate BP80 / E alternatives: ZINC finish in all cases

FRAME [UPRIGHT MODEL] / [DEPTH] / [HEIGHT] / [FINISH] TYPE OF BASEPLATE P Base plate BP80 / E alternatives: ZINC finish in all cases FRAME XS UPRIGHT BASE PLATE UPRIGHT HORIZONTAL PROFILE DIAGONAL PROFILE DESCRIPTION A vertical structure consisting of 2 uprights, joined by a system of bracing profiles, and base plates intended to support

Nadere informatie

SAMPLE 11 = + 11 = + + Exploring Combinations of Ten + + = = + + = + = = + = = 11. Step Up. Step Ahead

SAMPLE 11 = + 11 = + + Exploring Combinations of Ten + + = = + + = + = = + = = 11. Step Up. Step Ahead 7.1 Exploring Combinations of Ten Look at these cubes. 2. Color some of the cubes to make three parts. Then write a matching sentence. 10 What addition sentence matches the picture? How else could you

Nadere informatie

Het Effect van Verschil in Sociale Invloed van Ouders en Vrienden op het Alcoholgebruik van Adolescenten.

Het Effect van Verschil in Sociale Invloed van Ouders en Vrienden op het Alcoholgebruik van Adolescenten. Het Effect van Verschil in Sociale Invloed van Ouders en Vrienden op het Alcoholgebruik van Adolescenten. The Effect of Difference in Peer and Parent Social Influences on Adolescent Alcohol Use. Nadine

Nadere informatie

Settings for the C100BRS4 MAC Address Spoofing with cable Internet.

Settings for the C100BRS4 MAC Address Spoofing with cable Internet. Settings for the C100BRS4 MAC Address Spoofing with cable Internet. General: Please use the latest firmware for the router. The firmware is available on http://www.conceptronic.net! Use Firmware version

Nadere informatie

What to include in an array report?

What to include in an array report? What to include in an array report? December 17-19, 2007 Nicole de Leeuw, PhD Department of Human Genetics Radboud University Nijmegen Medical Centre The Netherlands Array analyse criteria a) SNP call

Nadere informatie

2019 SUNEXCHANGE USER GUIDE LAST UPDATED

2019 SUNEXCHANGE USER GUIDE LAST UPDATED 2019 SUNEXCHANGE USER GUIDE LAST UPDATED 0 - -19 1 WELCOME TO SUNEX DISTRIBUTOR PORTAL This user manual will cover all the screens and functions of our site. MAIN SCREEN: Welcome message. 2 LOGIN SCREEN:

Nadere informatie

Figure 1 Shares of Students in Basic, Middle, and Academic Track of Secondary School Academic Track Middle Track Basic Track 29 Figure 2 Number of Years Spent in School by Basic Track Students 9.5 Length

Nadere informatie

Het is geen open boek tentamen. Wel mag gebruik gemaakt worden van een A4- tje met eigen aantekeningen.

Het is geen open boek tentamen. Wel mag gebruik gemaakt worden van een A4- tje met eigen aantekeningen. Examen ET1205-D1 Elektronische Circuits deel 1, 5 April 2011, 9-12 uur Het is geen open boek tentamen. Wel mag gebruik gemaakt worden van een A4- tje met eigen aantekeningen. Indien, bij het multiple choice

Nadere informatie

FOR DUTCH STUDENTS! ENGLISH VERSION NEXT PAGE. Toets Inleiding Kansrekening 1 8 februari 2010

FOR DUTCH STUDENTS! ENGLISH VERSION NEXT PAGE. Toets Inleiding Kansrekening 1 8 februari 2010 FOR DUTCH STUDENTS! ENGLISH VERSION NEXT PAGE Toets Inleiding Kansrekening 1 8 februari 2010 Voeg aan het antwoord van een opgave altijd het bewijs, de berekening of de argumentatie toe. Als je een onderdeel

Nadere informatie

The relationship between social support and loneliness and depressive symptoms in Turkish elderly: the mediating role of the ability to cope

The relationship between social support and loneliness and depressive symptoms in Turkish elderly: the mediating role of the ability to cope The relationship between social support and loneliness and depressive symptoms in Turkish elderly: the mediating role of the ability to cope Een onderzoek naar de relatie tussen sociale steun en depressieve-

Nadere informatie

B1 Woordkennis: Spelling

B1 Woordkennis: Spelling B1 Woordkennis: Spelling Bestuderen Inleiding Op B1 niveau gaan we wat meer aandacht schenken aan spelling. Je mag niet meer zoveel fouten maken als op A1 en A2 niveau. We bespreken een aantal belangrijke

Nadere informatie

CEACAM6 is upregulated by Helicobacter pylori CagA and is a biomarker for early gastric cancer

CEACAM6 is upregulated by Helicobacter pylori CagA and is a biomarker for early gastric cancer CEACAM6 is upregulated by Helicobacter pylori CagA and is a biomarker for early gastric cancer SUPPLEMENTARY INFORMATION Supplementary Figure 1: A. Western blot demonstrating an increase in CagA protein

Nadere informatie

01/ M-Way. cables

01/ M-Way. cables 01/ 2015 M-Way cables M-WaY Cables There are many ways to connect devices and speakers together but only few will connect you to the music. My Way of connecting is just one of many but proved it self over

Nadere informatie

CHROMA STANDAARDREEKS

CHROMA STANDAARDREEKS CHROMA STANDAARDREEKS Chroma-onderzoeken Een chroma geeft een beeld over de kwaliteit van bijvoorbeeld een bodem of compost. Een chroma bestaat uit 4 zones. Uit elke zone is een bepaald kwaliteitsaspect

Nadere informatie

Cambridge Assessment International Education Cambridge International General Certificate of Secondary Education. Published

Cambridge Assessment International Education Cambridge International General Certificate of Secondary Education. Published Cambridge Assessment International Education Cambridge International General Certificate of Secondary Education DUTCH 055/02 Paper 2 Reading MARK SCHEME Maximum Mark: 45 Published This mark scheme is published

Nadere informatie

Prognostische toepassing van flowcytometrie bij het myelodysplastisch syndroom

Prognostische toepassing van flowcytometrie bij het myelodysplastisch syndroom Workshop Flowcytometrie in MDS 5 september 2012 Prognostische toepassing van flowcytometrie bij het myelodysplastisch syndroom Canan Alhan VU Medisch Centrum Cancer Center Amsterdam Klinische prognostische

Nadere informatie

Ontpopping. ORGACOM Thuis in het Museum

Ontpopping. ORGACOM Thuis in het Museum Ontpopping Veel deelnemende bezoekers zijn dit jaar nog maar één keer in het Van Abbemuseum geweest. De vragenlijst van deze mensen hangt Orgacom in een honingraatpatroon. Bezoekers die vaker komen worden

Nadere informatie

The first line of the input contains an integer $t \in \mathbb{n}$. This is followed by $t$ lines of text. This text consists of:

The first line of the input contains an integer $t \in \mathbb{n}$. This is followed by $t$ lines of text. This text consists of: Document properties Most word processors show some properties of the text in a document, such as the number of words or the number of letters in that document. Write a program that can determine some of

Nadere informatie

FOR DUTCH STUDENTS! ENGLISH VERSION NEXT PAGE. Toets Inleiding Kansrekening 1 22 februari 2013

FOR DUTCH STUDENTS! ENGLISH VERSION NEXT PAGE. Toets Inleiding Kansrekening 1 22 februari 2013 FOR DUTCH STUDENTS! ENGLISH VERSION NEXT PAGE Toets Inleiding Kansrekening 1 22 februari 2013 Voeg aan het antwoord van een opgave altijd het bewijs, de berekening of de argumentatie toe. Als je een onderdeel

Nadere informatie

STIGMATISERING VAN PATIENTEN MET LONGKANKER 1. Stigmatisering van Patiënten met Longkanker: De Rol van Persoonlijke Relevantie voor de Waarnemer

STIGMATISERING VAN PATIENTEN MET LONGKANKER 1. Stigmatisering van Patiënten met Longkanker: De Rol van Persoonlijke Relevantie voor de Waarnemer STIGMATISERING VAN PATIENTEN MET LONGKANKER 1 Stigmatisering van Patiënten met Longkanker: De Rol van Persoonlijke Relevantie voor de Waarnemer Stigmatization of Patients with Lung Cancer: The Role of

Nadere informatie

FOR DUTCH STUDENTS! ENGLISH VERSION NEXT PAGE

FOR DUTCH STUDENTS! ENGLISH VERSION NEXT PAGE FOR DUTCH STUDENTS! ENGLISH VERSION NEXT PAGE Tentamen Analyse 6 januari 203, duur 3 uur. Voeg aan het antwoord van een opgave altijd het bewijs, de berekening of de argumentatie toe. Als je een onderdeel

Nadere informatie

Eye Feature Detection Towards Automatic Strabismus Screening

Eye Feature Detection Towards Automatic Strabismus Screening Eye Feature Detection Towards Automatic Strabismus Screening Ken Allen, Khanh Nguyen Gettysburg College What is strabismus? Eye defect that causes eyes to look in two different directions If left untreated,

Nadere informatie

Classification of triangles

Classification of triangles Classification of triangles A triangle is a geometrical shape that is formed when 3 non-collinear points are joined. The joining line segments are the sides of the triangle. The angles in between the sides

Nadere informatie

WISB134 Modellen & Simulatie. Lecture 4 - Scalaire recursies

WISB134 Modellen & Simulatie. Lecture 4 - Scalaire recursies WISB34 Modellen & Simulatie Lecture 4 - Scalaire recursies Overzicht van ModSim Meeste aandacht (t/m apr.) Basisbegrippen dynamische modellen Definities recursies, DVs, numerieke methoden Oplossingen DVs

Nadere informatie

AE1103 Statics. 25 January h h. Answer sheets. Last name and initials:

AE1103 Statics. 25 January h h. Answer sheets. Last name and initials: Space above not to be filled in by the student AE1103 Statics 09.00h - 12.00h Answer sheets Last name and initials: Student no.: Only hand in the answer sheets! Other sheets will not be accepted Write

Nadere informatie

Bioinformatica tentamen D1 voor 2MNW op woensdag 30 maart 2005 van 9.30-12.30 uur in zaal Q105

Bioinformatica tentamen D1 voor 2MNW op woensdag 30 maart 2005 van 9.30-12.30 uur in zaal Q105 Bioinformatica tentamen D1 voor 2MNW op woensdag 30 maart 2005 van 9.30-12.30 uur in zaal Q105 Naam: Studentnummer: NB: er zijn extra vellen achteraan bijgevoegd die je kunt gebruiken om antwoorden verder

Nadere informatie

Global TV Canada s Pulse 2011

Global TV Canada s Pulse 2011 Global TV Canada s Pulse 2011 Winnipeg Nobody s Unpredictable Methodology These are the findings of an Ipsos Reid poll conducted between August 26 to September 1, 2011 on behalf of Global Television. For

Nadere informatie

Preschool Kindergarten

Preschool Kindergarten Preschool Kindergarten Objectives Students will recognize the values of numerals 1 to 10. Students will use objects to solve addition problems with sums from 1 to 10. Materials Needed Large number cards

Nadere informatie

MyDHL+ Global Mail zending aanmaken

MyDHL+ Global Mail zending aanmaken MyDHL+ Global Mail zending aanmaken Global Mail zending aanmaken In MyDHL+ is het aanmaken van een Global Mail zending zo eenvoudig mogelijk gemaakt. De website en deze handleiding zal u stap voor stap

Nadere informatie

FOR DUTCH STUDENTS! ENGLISH VERSION NEXT PAGE. Toets Inleiding Kansrekening 1 7 februari 2011

FOR DUTCH STUDENTS! ENGLISH VERSION NEXT PAGE. Toets Inleiding Kansrekening 1 7 februari 2011 FOR DUTCH STUDENTS! ENGLISH VERSION NEXT PAGE Toets Inleiding Kansrekening 1 7 februari 2011 Voeg aan het antwoord van een opgave altijd het bewijs, de berekening of de argumentatie toe. Als je een onderdeel

Nadere informatie

MVA Flu. Figuur 1: A: Middels homologe recombinatie (op basis van de homologie van de Del III flanks in het MVA

MVA Flu. Figuur 1: A: Middels homologe recombinatie (op basis van de homologie van de Del III flanks in het MVA Figuur 1: A: Middels homologe recombinatie (op basis van de homologie van de Del III flanks in het MVA genoom en het plasmide) in CEF cellen wordt in de geïnfecteerde+getransfecteerde cel de regio tussen

Nadere informatie

De Relatie Tussen de Gehanteerde Copingstijl en Pesten op het Werk. The Relation Between the Used Coping Style and Bullying at Work.

De Relatie Tussen de Gehanteerde Copingstijl en Pesten op het Werk. The Relation Between the Used Coping Style and Bullying at Work. De Relatie Tussen de Gehanteerde Copingstijl en Pesten op het Werk The Relation Between the Used Coping Style and Bullying at Work Merijn Daerden Studentnummer: 850225144 Werkstuk: Empirisch afstudeeronderzoek:

Nadere informatie

Themaweek dikke darmkanker

Themaweek dikke darmkanker Themaweek dikke darmkanker AZ Sint-Lucas Gent Workshop 4 De artsen van AZ Sint-Lucas hebben deze presentatie met zorg opgemaakt. De inhoud ervan is echter algemeen en indicatief. AZ Sint-Lucas en de artsen

Nadere informatie

Quality requirements concerning the packaging of oak lumber of Houthandel Wijers vof (09.09.14)

Quality requirements concerning the packaging of oak lumber of Houthandel Wijers vof (09.09.14) Quality requirements concerning the packaging of oak lumber of (09.09.14) Content: 1. Requirements on sticks 2. Requirements on placing sticks 3. Requirements on construction pallets 4. Stick length and

Nadere informatie

GOVERNMENT NOTICE. STAATSKOERANT, 18 AUGUSTUS 2017 No NATIONAL TREASURY. National Treasury/ Nasionale Tesourie NO AUGUST

GOVERNMENT NOTICE. STAATSKOERANT, 18 AUGUSTUS 2017 No NATIONAL TREASURY. National Treasury/ Nasionale Tesourie NO AUGUST National Treasury/ Nasionale Tesourie 838 Local Government: Municipal Finance Management Act (56/2003): Draft Amendments to Municipal Regulations on Minimum Competency Levels, 2017 41047 GOVERNMENT NOTICE

Nadere informatie

S e v e n P h o t o s f o r O A S E. K r i j n d e K o n i n g

S e v e n P h o t o s f o r O A S E. K r i j n d e K o n i n g S e v e n P h o t o s f o r O A S E K r i j n d e K o n i n g Even with the most fundamental of truths, we can have big questions. And especially truths that at first sight are concrete, tangible and proven

Nadere informatie

Supplement. Treatment Letter

Supplement. Treatment Letter Supplement Appendix A: Original Experimental Materials in Dutch Van: Project De Open Gemeente *[requester name] Bijlhouwerstraat 6 3511 ZC Utrecht Onderwerp: Wob-Verzoek Utrecht, 25 september 2017 Geachte

Nadere informatie

NCTS - INFORMATIE INZAKE NIEUWIGHEDEN VOOR 2010

NCTS - INFORMATIE INZAKE NIEUWIGHEDEN VOOR 2010 NCTS - INFORMATIE INZAKE NIEUWIGHEDEN VOOR 2010 Op basis van het nieuwe artikel 365, lid 4 (NCTS) en het nieuwe artikel 455bis, lid 4 (NCTS-TIR) van het Communautair Toepassingswetboek inzake douane 1

Nadere informatie

Zin of onzin van moleculaire onco-hematologie in een perifeer labo

Zin of onzin van moleculaire onco-hematologie in een perifeer labo Zin of onzin van moleculaire onco-hematologie in een perifeer labo een kwestie van service! 06 januari 2004 Pieter De Schouwer 1 periferie??? Waar is het centrum? 06 januari 2004 Pieter De Schouwer 2 Leuven?

Nadere informatie

Positieve, Negatieve en Depressieve Subklinische Psychotische Symptomen en het Effect van Stress en Sekse op deze Subklinische Psychotische Symptomen

Positieve, Negatieve en Depressieve Subklinische Psychotische Symptomen en het Effect van Stress en Sekse op deze Subklinische Psychotische Symptomen Positieve, Negatieve en Depressieve Subklinische Psychotische Symptomen en het Effect van Stress en Sekse op deze Subklinische Psychotische Symptomen Positive, Negative and Depressive Subclinical Psychotic

Nadere informatie

Data Handling Ron van Lammeren - Wageningen UR

Data Handling Ron van Lammeren - Wageningen UR Data Handling 1 2010-2011 Ron van Lammeren - Wageningen UR Can I answer my scientific questions? Geo-data cycle Data handling / introduction classes of data handling data action models (ISAC) Queries (data

Nadere informatie

The genesis of the game is unclear. Possibly, dominoes originates from China and the stones were brought here by Marco Polo, but this is uncertain.

The genesis of the game is unclear. Possibly, dominoes originates from China and the stones were brought here by Marco Polo, but this is uncertain. Domino tiles Dominoes is a game played with rectangular domino 'tiles'. Today the tiles are often made of plastic or wood, but in the past, they were made of real stone or ivory. They have a rectangle

Nadere informatie

2000 Volkswagen Passat GLS

2000 Volkswagen Passat GLS REAR DOOR WINDOW Rear door window, assembly overview Fig. 304: Exploded View Of Rear Door Window 1 - Door Removing and installing: --> Rear door, removing and installing 2 - Spring nut Qty 2 3 - Screw

Nadere informatie

Introductie in flowcharts

Introductie in flowcharts Introductie in flowcharts Flow Charts Een flow chart kan gebruikt worden om: Processen definieren en analyseren. Een beeld vormen van een proces voor analyse, discussie of communicatie. Het definieren,

Nadere informatie

Online Resource 1. Title: Implementing the flipped classroom: An exploration of study behaviour and student performance

Online Resource 1. Title: Implementing the flipped classroom: An exploration of study behaviour and student performance Online Resource 1 Title: Implementing the flipped classroom: An exploration of study behaviour and student performance Journal: Higher Education Authors: Anja J. Boevé, Rob R. Meijer, Roel J. Bosker, Jorien

Nadere informatie

Four-card problem. Input

Four-card problem. Input Four-card problem The four-card problem (also known as the Wason selection task) is a logic puzzle devised by Peter Cathcart Wason in 1966. It is one of the most famous tasks in the study of deductive

Nadere informatie

University of Groningen

University of Groningen University of Groningen De ontwikkeling van prikkelverwerking bij mensen met een Autisme Spectrum Stoornis en de invloed van hulp en begeleiding gedurende het leven. Fortuin, Marret; Landsman-Dijkstra,

Nadere informatie

de Rol van Persoonlijkheid Eating: the Role of Personality

de Rol van Persoonlijkheid Eating: the Role of Personality De Relatie tussen Dagelijkse Stress en Emotioneel Eten: de Rol van Persoonlijkheid The Relationship between Daily Stress and Emotional Eating: the Role of Personality Arlette Nierich Open Universiteit

Nadere informatie

8+ 60 MIN Alleen te spelen in combinatie met het RIFUGIO basisspel. Only to be played in combination with the RIFUGIO basicgame.

8+ 60 MIN Alleen te spelen in combinatie met het RIFUGIO basisspel. Only to be played in combination with the RIFUGIO basicgame. 8+ 60 MIN. 2-5 Alleen te spelen in combinatie met het RIFUGIO basisspel. Only to be played in combination with the RIFUGIO basicgame. HELICOPTER SPEL VOORBEREIDING: Doe alles precies hetzelfde als bij

Nadere informatie

TE HUUR: Prinsengracht 731 D 1017 JX Amsterdam P/M. Super luxury apartment in top location. Netland Makelaars

TE HUUR: Prinsengracht 731 D 1017 JX Amsterdam P/M. Super luxury apartment in top location. Netland Makelaars TE HUUR: Prinsengracht 731 D 1017 JX Amsterdam 2.750 P/M Super luxury apartment in top location Netland Makelaars 2 netlandmakelaars.nl INLEIDING Super luxury apartment of ca 105 m² with six windows to

Nadere informatie

Microdata Services. Documentatie Volgtijdelijk vergelijkbare Persoon_id's van personen (VTVPERSOONTAB)

Microdata Services. Documentatie Volgtijdelijk vergelijkbare Persoon_id's van personen (VTVPERSOONTAB) Documentatie Volgtijdelijk vergelijkbare Persoon_id's van personen (VTVPERSOONTAB) Datum: 11 april 2019 Bronvermelding Publicatie van uitkomsten geschiedt door de onderzoeksinstelling of de opdrachtgever

Nadere informatie

Esther Lee-Varisco Matt Zhang

Esther Lee-Varisco Matt Zhang Esther Lee-Varisco Matt Zhang Want to build a wine cellar Surface temperature varies daily, seasonally, and geologically Need reasonable depth to build the cellar for lessened temperature variations Building

Nadere informatie

Karen J. Rosier - Brattinga. Eerste begeleider: dr. Arjan Bos Tweede begeleider: dr. Ellin Simon

Karen J. Rosier - Brattinga. Eerste begeleider: dr. Arjan Bos Tweede begeleider: dr. Ellin Simon Zelfwaardering en Angst bij Kinderen: Zijn Globale en Contingente Zelfwaardering Aanvullende Voorspellers van Angst bovenop Extraversie, Neuroticisme en Gedragsinhibitie? Self-Esteem and Fear or Anxiety

Nadere informatie

Gebruiksaanwijzing WAARSCHUWING VERPAKKINGEN. LET OP: De maximale belasting van de Deskbike is 100 kilo.

Gebruiksaanwijzing WAARSCHUWING VERPAKKINGEN. LET OP: De maximale belasting van de Deskbike is 100 kilo. Gebruiksaanwijzing WAARSCHUWING Volg de gebruiksaanwijzing om gevaar voor de menselijke gezondheid te voorkomen. De Deskbike wordt gebruikt om het lichaam te trainen. De Deskbike behoort niet tot Medische

Nadere informatie

Монгол page 1 and 2, Nederlands blz 3 en 4 English page 5 and 6. Jaarverslag / Auditor s report 2011

Монгол page 1 and 2, Nederlands blz 3 en 4 English page 5 and 6. Jaarverslag / Auditor s report 2011 Монгол page 1 and 2, Nederlands blz 3 en 4 English page 5 and 6 Jaarverslag / Auditor s report 2011 1 2 Het bestuur van de NGO All for Children heeft op 26 mei 2012 het volgende jaarverslag vastgesteld

Nadere informatie

Running head: OPVOEDSTIJL, EXTERNALISEREND PROLEEMGEDRAG EN ZELFBEELD

Running head: OPVOEDSTIJL, EXTERNALISEREND PROLEEMGEDRAG EN ZELFBEELD 1 Opvoedstijl en Externaliserend Probleemgedrag en de Mediërende Rol van het Zelfbeeld bij Dak- en Thuisloze Jongeren in Utrecht Parenting Style and Externalizing Problem Behaviour and the Mediational

Nadere informatie

COGNITIEVE DISSONANTIE EN ROKERS COGNITIVE DISSONANCE AND SMOKERS

COGNITIEVE DISSONANTIE EN ROKERS COGNITIVE DISSONANCE AND SMOKERS COGNITIEVE DISSONANTIE EN ROKERS Gezondheidsgedrag als compensatie voor de schadelijke gevolgen van roken COGNITIVE DISSONANCE AND SMOKERS Health behaviour as compensation for the harmful effects of smoking

Nadere informatie

Functioneel Ontwerp / Wireframes:

Functioneel Ontwerp / Wireframes: Functioneel Ontwerp / Wireframes: Het functioneel ontwerp van de ilands applicatie voor op de iphone is gebaseerd op het iphone Human Interface Guidelines handboek geschreven door Apple Inc 2007. Rounded-Rectangle

Nadere informatie

Pure Bending. A beam satisfying above given requirements are shown below: Why this surface is called neutral will be explained later in the lecture.

Pure Bending. A beam satisfying above given requirements are shown below: Why this surface is called neutral will be explained later in the lecture. In this section we will derive a formula to analyze a the deformation and stress distribution of a beam under flexural action. Theformulatobederivedinthis section will be used for straight beams with sections

Nadere informatie

De Relatie tussen Werkdruk, Pesten op het Werk, Gezondheidsklachten en Verzuim

De Relatie tussen Werkdruk, Pesten op het Werk, Gezondheidsklachten en Verzuim De Relatie tussen Werkdruk, Pesten op het Werk, Gezondheidsklachten en Verzuim The Relationship between Work Pressure, Mobbing at Work, Health Complaints and Absenteeism Agnes van der Schuur Eerste begeleider:

Nadere informatie

Tentamen T1 Chemische Analysemethoden 6 maart 2014

Tentamen T1 Chemische Analysemethoden 6 maart 2014 Tentamen T1 Chemische Analysemethoden 6 maart 2014 Naam: Student nummer: Geef uw antwoord op dit papier. U mag uw tekstboek, aantekeningen, liniaal en een rekenmachine gebruiken. 1) De stralingsdosis van

Nadere informatie

FOR DUTCH STUDENTS! ENGLISH VERSION NEXT PAGE

FOR DUTCH STUDENTS! ENGLISH VERSION NEXT PAGE FOR DUTCH STUDENTS! ENGLISH VERSION NEXT PAGE Tentamen Bewijzen en Technieken 1 7 januari 211, duur 3 uur. Voeg aan het antwoord van een opgave altijd het bewijs, de berekening of de argumentatie toe.

Nadere informatie

Leeftijdcheck (NL) Age Check (EN)

Leeftijdcheck (NL) Age Check (EN) Leeftijdcheck (NL) Age Check (EN) [Type text] NL: Verkoopt u producten die niet aan jonge bezoekers verkocht mogen worden of heeft uw webwinkel andere (wettige) toelatingscriteria? De Webshophelpers.nl

Nadere informatie

2006 Volkswagen Jetta TDI

2006 Volkswagen Jetta TDI Door handle and door lock, assembly overview The illustration shows the left side. The right side is derived accordingly from this. Fig. 99: Door Handle And Door Lock, Assembly Overview 1 - Cable For disengaging

Nadere informatie

CSRQ Center Rapport over onderwijsondersteunende organisaties: Samenvatting voor onderwijsgevenden

CSRQ Center Rapport over onderwijsondersteunende organisaties: Samenvatting voor onderwijsgevenden CSRQ Center Rapport over onderwijsondersteunende organisaties: Samenvatting voor onderwijsgevenden Laatst bijgewerkt op 25 november 2008 Nederlandse samenvatting door TIER op 5 juli 2011 Onderwijsondersteunende

Nadere informatie

EM7680 Firmware Update by OTA

EM7680 Firmware Update by OTA EM7680 Firmware Update by OTA 2 NEDERLANDS/ENGLISH EM7680 Firmware update by OTA Table of contents 1.0 (NL) Introductie... 3 2.0 (NL) Firmware installeren... 3 3.0 (NL) Release notes:... 3 4.0 (NL) Overige

Nadere informatie

Kennerschap en juridische haken en ogen. Vereniging van Nederlandse Kunsthistorici Amsterdam, 10 juni 2016 R.J.Q. Klomp

Kennerschap en juridische haken en ogen. Vereniging van Nederlandse Kunsthistorici Amsterdam, 10 juni 2016 R.J.Q. Klomp Kennerschap en juridische haken en ogen Vereniging van Nederlandse Kunsthistorici Amsterdam, 10 juni 2016 R.J.Q. Klomp De Emmaüsgangers () Lucas 24, 13-35 Juridische haken en ogen Wat te doen als koper

Nadere informatie

Add the standing fingers to get the tens and multiply the closed fingers to get the units.

Add the standing fingers to get the tens and multiply the closed fingers to get the units. Digit work Here's a useful system of finger reckoning from the Middle Ages. To multiply $6 \times 9$, hold up one finger to represent the difference between the five fingers on that hand and the first

Nadere informatie

De Samenhang tussen Dagelijkse Stress en Depressieve Symptomen en de Mediërende Invloed van Controle en Zelfwaardering

De Samenhang tussen Dagelijkse Stress en Depressieve Symptomen en de Mediërende Invloed van Controle en Zelfwaardering De Samenhang tussen Dagelijkse Stress en Depressieve Symptomen en de Mediërende Invloed van Controle en Zelfwaardering The Relationship between Daily Hassles and Depressive Symptoms and the Mediating Influence

Nadere informatie

Intermax backup exclusion files

Intermax backup exclusion files Intermax backup exclusion files Document type: Referentienummer: Versienummer : Documentatie 1.0 Datum publicatie: Datum laatste wijziging: Auteur: 24-2-2011 24-2-2011 Anton van der Linden Onderwerp: Documentclassificatie:

Nadere informatie

Het handboek van KDE Screen Ruler. Lauri Watts Vertaling van het handboek: Niels Reedijk Vertaler/Nalezer: Alexander S. Koning

Het handboek van KDE Screen Ruler. Lauri Watts Vertaling van het handboek: Niels Reedijk Vertaler/Nalezer: Alexander S. Koning Lauri Watts Vertaling van het handboek: Niels Reedijk Vertaler/Nalezer: Alexander S. Koning 2 Inhoudsopgave 1 Inleiding 5 2 Menubeschrijvingen 6 3 Dankbetuigingen en licentie 8 Samenvatting KDE Screen

Nadere informatie

Chromosomal crossover

Chromosomal crossover Chromosomal crossover As one of the last steps of genetic recombination two homologous chromosomes can exchange genetic material during meiosis in a process that is referred to as synapsis. Because of

Nadere informatie

ESBLAT Symposium Veilig voedsel produceren. Similariteitsanalyse. Dick Heederik IRAS UU

ESBLAT Symposium Veilig voedsel produceren. Similariteitsanalyse. Dick Heederik IRAS UU ESBLAT Symposium 2018 Similariteitsanalyse Veilig voedsel produceren Dick Heederik IRAS UU Aanleiding voor dit project Opzet van het project Identificeren van alle beschikbare Nederlandse studies Identificeren

Nadere informatie

Interface tussen Stuurbediening en Sony autoaudio

Interface tussen Stuurbediening en Sony autoaudio The information in this document is in Dutch, English version follows later in this document Interface tussen Stuurbediening en Sony autoaudio LET OP! HOEWEL DE UITERSTE ZORGVULDIGHEID IS BETRACHT BIJ

Nadere informatie

Translocatie Detectie Met Behulp Van Targeted Next Generation Sequencing In FFPE Weefsels. Tom van Wezel Pathologie LUMC

Translocatie Detectie Met Behulp Van Targeted Next Generation Sequencing In FFPE Weefsels. Tom van Wezel Pathologie LUMC Translocatie Detectie Met Behulp Van Targeted Next Generation Sequencing In FFPE Weefsels Tom van Wezel Pathologie LUMC Tom van Wezel 14-Mar-16 Gene fusions in cancer The emerging complexity of gene fusions

Nadere informatie

3.C.1 Communicatieplan CO2-reductiesysteem

3.C.1 Communicatieplan CO2-reductiesysteem 3.C.1 Communicatieplan systeem General Document approval by: John Waltman (Europe) Classification: Approved for External / 3rd Party Use Document version: 5.0 Approval status: Approved NON-DISCLOSURE OF

Nadere informatie

Martin Storey Knit Along. Stage 4 - Lace Tree Square

Martin Storey Knit Along. Stage 4 - Lace Tree Square Martin Storey Stage 4 - Lace Tree Square www.knitrowan.com Martin Storey Stage 4 Lace Tree Square Make six squares YARN Pure Wool Superwash Worsted (for yarn requirements please see shopping list) Calm

Nadere informatie

Ae Table 1: Aircraft data. In horizontal steady flight, the equations of motion are L = W and T = D.

Ae Table 1: Aircraft data. In horizontal steady flight, the equations of motion are L = W and T = D. English Question 1 Flight mechanics (3 points) A subsonic jet aircraft is flying at sea level in the International Standard Atmosphere ( = 1.5 kg/m 3 ). It is assumed that thrust is independent of the

Nadere informatie

APPROACHING THE FAMILY

APPROACHING THE FAMILY 1 Journalists Workshop Organ Donation and Transplantation APPROACHING THE FAMILY COLENBIE LUC TRANSPLANTATION COORDINATION 9 October 2012 2 Everybody arriving hospital Start the fight for saving life Family

Nadere informatie

WATERFILTERS HANDMATIG EN DISC-FILTRATIE. Tuinbouwtechniek & -benodigdheden. KaRo BV Tulpenmarkt PK Zwaagdijk

WATERFILTERS HANDMATIG EN DISC-FILTRATIE. Tuinbouwtechniek & -benodigdheden. KaRo BV Tulpenmarkt PK Zwaagdijk Arkal's filtration systems use a specially designed disc filtration technology. Color-coded Polypropylene or Nylon discs are grooved on both sides to a specific micron size. A series of these discs are

Nadere informatie

Beïnvloedt Gentle Teaching Vaardigheden van Begeleiders en Companionship en Angst bij Verstandelijk Beperkte Cliënten?

Beïnvloedt Gentle Teaching Vaardigheden van Begeleiders en Companionship en Angst bij Verstandelijk Beperkte Cliënten? Beïnvloedt Gentle Teaching Vaardigheden van Begeleiders en Companionship en Angst bij Verstandelijk Beperkte Cliënten? Does Gentle Teaching have Effect on Skills of Caregivers and Companionship and Anxiety

Nadere informatie

Genetic code. Assignment

Genetic code. Assignment Genetic code The genetic code consists of a number of lines that determine how living cells translate the information coded in genetic material (DNA or RNA sequences) to proteins (amino acid sequences).

Nadere informatie

Bioinformatica tentamen D1 voor MNW2 op 23 maart 2004 van uur in S111. DEEL A: MEERKEUZE VRAGEN omcirkel het juiste antwoord

Bioinformatica tentamen D1 voor MNW2 op 23 maart 2004 van uur in S111. DEEL A: MEERKEUZE VRAGEN omcirkel het juiste antwoord Bioinformatica tentamen D1 voor MNW2 op 23 maart 2004 van 9.30-12.30 uur in S111 Naam: Studentnummer: DEEL A: MEERKEUZE VRAGEN omcirkel het juiste antwoord 1. De belangrijkste factor voor het ontstaan

Nadere informatie

Handleiding Zuludesk Parent

Handleiding Zuludesk Parent Handleiding Zuludesk Parent Handleiding Zuludesk Parent Met Zuludesk Parent kunt u buiten schooltijden de ipad van uw kind beheren. Hieronder vind u een korte handleiding met de mogelijkheden. Gebruik

Nadere informatie

ALGORITMIEK: answers exercise class 7

ALGORITMIEK: answers exercise class 7 Problem 1. See slides 2 4 of lecture 8. Problem 2. See slides 4 6 of lecture 8. ALGORITMIEK: answers exercise class 7 Problem 5. a. Als we twee negatieve (< 0) getallen bij elkaar optellen is het antwoord

Nadere informatie

Melanoom Niet één diagnose, niet één standaardbehandeling

Melanoom Niet één diagnose, niet één standaardbehandeling Melanoom Niet één diagnose, niet één standaardbehandeling Wolter J. Mooi VU medisch centrum Amsterdam Melanoomclassificatie Superficieel spreidend melanoom Nodulair melanoom Acrolentigineus melanoom Lentigo

Nadere informatie

Pilot vragenlijst communicatieve redzaamheid

Pilot vragenlijst communicatieve redzaamheid Pilot vragenlijst communicatieve redzaamheid Het instrument Communicatieve redzaamheid kan worden opgevat als een vermogen om wederkerig te communiceren met behulp van woorden, gebaren of symbolen. Communicatief

Nadere informatie

HLA-B*27 diagnostiek: is sequentie analyse the way to go?

HLA-B*27 diagnostiek: is sequentie analyse the way to go? HLA-B*27 diagnostiek: is sequentie analyse the way to go? 14 juni 2011 Bouke Hepkema Transplantatie-Immunologie Laboratoriumgeneeskunde UMCG Kwaliteit in Harmonisatie of Harmonisatie in Kwaliteit UMCG

Nadere informatie

L.Net s88sd16-n aansluitingen en programmering.

L.Net s88sd16-n aansluitingen en programmering. De L.Net s88sd16-n wordt via één van de L.Net aansluitingen aangesloten op de LocoNet aansluiting van de centrale, bij een Intellibox of Twin-Center is dat de LocoNet-T aansluiting. L.Net s88sd16-n aansluitingen

Nadere informatie

3.D.1. Sector- en keteninitiatieven

3.D.1. Sector- en keteninitiatieven 3.D.1. Sector- en keteninitiatieven General Document approval by: John Waltman (Europe) Classification: Approved for External / 3rd Party Use Document version: 4.0 Approval status: Approved NON-DISCLOSURE

Nadere informatie

Engels op Niveau A2 Workshops Woordkennis 1

Engels op Niveau A2 Workshops Woordkennis 1 A2 Workshops Woordkennis 1 A2 Workshops Woordkennis 1 A2 Woordkennis 1 Bestuderen Hoe leer je 2000 woorden? Als je een nieuwe taal wilt spreken en schrijven, heb je vooral veel nieuwe woorden nodig. Je

Nadere informatie

Het Verband Tussen Negatieve Levensgebeurtenissen, 5-HTTLPR en Reactieve. Agressie. Pien S. Martens. Open Universiteit Heerlen

Het Verband Tussen Negatieve Levensgebeurtenissen, 5-HTTLPR en Reactieve. Agressie. Pien S. Martens. Open Universiteit Heerlen REACTIEVE AGRESSIE Het Verband Tussen Negatieve Levensgebeurtenissen, 5-HTTLPR en Reactieve Agressie Pien S. Martens Open Universiteit Heerlen Naam student: Pien Sophie Martens Studentnummer: 850945172

Nadere informatie