Epigenetica Theorie en mogelijke implicaties. Dr. Marco Boks Dr. Bart Rutten

Maat: px

Weergave met pagina beginnen:

Download "Epigenetica Theorie en mogelijke implicaties. Dr. Marco Boks Dr. Bart Rutten"

Brecht Christiaens
8 jaren geleden
Aantal bezoeken:

1 Epigenetica Theorie en mogelijke implicaties Dr. Marco Boks Dr. Bart Rutten

2 Disclosure Bart Rutten Speaker fees received from: Lundbeck Positions held on Advisory Boards: No Grants and sponsoring: No

3 Disclosure Marco Boks Speaker fees received from: - Astra Zenica - Lundbeck Positions held on Advisory Boards: - Geen Grants and sponsoring: - Geen

4 Stellingen 1. Alleen de DNA sequentie (i.e. genetische factoren) is overerfbaar 2. Het epigenetisch profiel van een individu is stabiel over de tijd 3. Epigenetische mechanismen medieren de persistentie van de invloeden van omgevingsinvloeden op phenotypes

6 Development of the number of citations including the term epigenetic. Gräff J et al. Physiol Rev 2011;91: by American Physiological Society

7 From epidemiology to neuroscience Hersenen Van Os, Kenis, Rutten. Nature. 2010

8 EPIGENETICS X X X DNA mutation no DNA mutation Genotype unchanged Phenotype unchanged Genotype changed Phenotype changed Genotype unchanged Phenotype changed

9 Epigenetic Mechanisms DNA methylation histone tail alterations microrna, etc 2 meters DNA per cell millions of neurons

10 ENVIRONMENT` Epigenetics & the environment = changes in phenotype and/or gene expression by mechanisms other than changes in the DNA sequence itself

11 DNA Methylation Gene Transcription MTHFR, DNMT1, DNMT3a, DNMT3b I. blocks transcription factors methyl gene promoter exon 1 exon 2 II. attracts gene repressing molecules quantity * e.g. MeCP2, mutations in MeCP2 -> Rett syndrome Pishva et al. Translational Neuroscience. 2012

attracts gene repressing molecules quantity * e.g. MeCP2, mutations in MeCP2 -> Rett syndrome Pishva et al.

12 Agouti ACATATACGCGCGCGCGCGCGCGATATATCTGTCAA Agouti-gen promoter exon 1 exon 2 Jirtle et al. NRG 2007

13 Identical genotype Agouti X X = methyl pregnancy Jirtle et al. NRG 2007

14 Postnatal environment methyl administration Low maternal care High maternal care methyl glucocorticoid receptor gene promoter exon 1 exon 2 RNA of glucocorticoid receptor in hippocampus

15 Epigenetics and childhood trauma in human brain Glucocorticoid receptor methylation Glucocorticoid receptor mrna expression McGowan et al. Nature Neuroscience 2009

16 DNA methylation in psychosis

17 Histone Tail Alterations Tsankova et al. NRN 2007

18 Social Stress bdnf gene bdnf bdnf Hippocampus protein no stress chronic stress bdnf bdnf bdnf BDNF BDNF bdnf bdnf bdnf chronic stress chronic TCA BDNF Tsankova et al. NRN 2007

19 Genes regulating chromatin & bipolar disorder? Genetic variations in genes involved in H3K4 methylation show associations with bipolar disorder

20 Transgenerational Epigenetics pregnant female Altered DNA methylation Several generations: Identical genetic sequence Identical environment Altered DNA methylation Altered phenotype F4 Anyway et al. Science 2005 Jirtle et al. NRG 2007

sequence Identical environment Altered DNA methylation

21 History repeating? Jean-Baptiste Lamarck Theory: Heritability of acquired traits Lamarckism 1920s, William McDougall: training rats in a maze Offspring of trained rats >> offspring of non-trained rats

22 DNA Environment gene SNP/mutation promoter exon 1 exon 2 EPIGENETIC RNA Inheritable Protein quantity quality Cell functions

23 Working model Subclinical experiences Prodromal state Disorder Paternal age Maternal infection Childhood trauma Cannabis Perinatal events Maternal stress Urban environment Stress Nutrition Rearing environment Migration Hypoxia Rutten & Mill. Schiz Bull. 2009

24 Epigenetica: theorie en mogelijke implicaties Deel II Marco Boks Bart Rutten

25 Stelling Epigenetische veranderingen zijn zeldzaam

26 Relatie met psychiatrische aandoeningen Relatie met medicatie Omgevingsinvloed Quiz

27 Wat is interessant aan epigenetica? Erfelijk Omgeving Trans generationele leer effecten Belangrijk in ontwikkeling Beïnvloedbaar door medicatie en dieet

28 Uitdagingen Invloed leeftijd en geslacht Invloed van DNA sequence variatie Invloed van medicatie Weefsel type

29 Correlatie tussen bloed en brein voor methylation levels onder invloed van leeftijd Horvath et al. Genome Biology :R97

30 Sample plot of methylation levels by genotype groups Boks MP et al. The relationship of DNA methylation with age, gender and genotype in twins and healthy controls. PLoS One

31 Cis and Trans correlations between DNA methylation and gene expression van Eijk KR, de Jong S, Boks MP, et albmc Genomics Nov 17;13(1):636.

32 Stelling Epigenetische medicijnen zijn volop in ontwikkeling

33 MPM Boks et al, Epigenetics, 2012

34 Boks MP, de Jong NM, Kas MJ, Vinkers CH, Fernandes C, Kahn RS, Mill J, Ophoff RA. Current status and future prospects for epigenetic psychopharmacology. Epigenetics Jan 1;7(1)

35 Stelling De belangrijkste invloed op epigenetica is voor de geboorte

36 Omgevingsinvloed Prenatal nutrition Prenatal exposure to alcohol Other drugs of abuse Prenatal stress Maternal care Traumatic early life experiences Environmental enrichment

37 Kofink, Boks, Kas, Neuroscience and Biobehavioral Reviews, in press

38 Psychiatrische aandoeningen Depressie Autisme Schizofrenie Bipolaire stoornis Cocaïne afhankelijkheid Alcoholisme Alzheimer

40 Bunnik Angry Bird Epigenetics Award 12 stellingen Rechterhand omhoog is JUIST Bij fout antwoord gaan zitten

41 Vragen Er zijn meer dan 25 epigenetische mechanismen Honger voor de geboorte heeft effect op de epigenetische status van het kind Met de leeftijd neemt DNA methylatie af (alles wordt minder). Er zijn geen medicijnen die direct op DNA methylatie werken

42 Natriumvalproaat is een HDAC inhibitor DNA methylatie verlaagd de expressie van genen

43 Vragen?

44 Universiteit Maastricht Bart Rutten UMC Utrecht Marco Boks

Vergelijkbare documenten

Voor bijeenkomst mogelijk relevante relaties met bedrijven

Disclosure belangen spreker (potentiële) belangenverstrengeling Geen Voor bijeenkomst mogelijk relevante relaties met bedrijven Bedrijfsnamen Sponsoring of onderzoeksgeld Honorarium of andere (financiële)