Data Mining: Data kwaliteit, Preprocessing

Save this PDF as:
 WORD  PNG  TXT  JPG

Maat: px
Weergave met pagina beginnen:

Download "Data Mining: Data kwaliteit, Preprocessing"

Transcriptie

1 Data Mining: Data kwaliteit, Preprocessing docent: dr. Toon Calders Gebaseerd op slides van Tan, Steinbach, and Kumar. Introduction to Data Mining Herhaling: definitie Data Mining is: Extractie van interessante (niet-triviale, impliciete, vooraf ongekende en mogelijk bruikbare) patronen of kennis uit grote hoeveelheden data 1

2 Herhaling: data mining technieken Beschrijvende (descriptieve) technieken: Clustering Outlier detection Associatie regels, sequentiele patronen Predictieve methodes Classificatie Regressie Herhaling: Classificatie Gebaseerd op gelabelde data: Leer model van de data Met als doel nieuwe objecten correct te kunnen classificeren Soorten modellen: Beslissingsboom Dataset zelf (Nearest neighbors) 2

3 Herhaling: Classificatie Gebaseerd op een set van gelabelde objecten: Leer model van de data Met als doel nieuwe objecten correct te kunnen classificeren leeftijd <30 30 geslacht M V HOOG type auto Herhaling: Associatie regels Gegeven een transactie database Vind associaties tussen sets van items Hoge support en confidence => 3

4 Herhaling: Clustering Gegeven een set van objecten Deel de objecten op in homogene groepen (mogelijk overlappend) Vraag Welke methode sluit het beste aan bij volgende problemen: Een Search Company wil zoekresultaten weergeven gegroepeerd per topic. Welke zoektermen komen vaak samen voor in zoekopdrachten? Ontwerp een spam-filter die ongewenste s tegen houdt. Welke kenmerken zijn karakteristiek voor spam-mails? 4

5 Inhoud van deze les Evaluatie Relevant Data voor de taak Data Mining Data Warehouse Selectie Opschonen Data integratie Databanken Overzicht Voorbereiden van de data voor data mining Types van data Data kwaliteit Pre-processing Maten voor afstand en similariteit 5

6 10 Overzicht Voorbereiden van de data voor data mining Types van data Soorten attributen Karakteristieken van datasets Data kwaliteit Pre-processing Maten voor afstand en similariteit Wat is Data? Collectie data objecten en hun attributen Een attribuut is een eigenschap of karakteristiek van een object Vb.: haarkleur van een persoon, etc. Objecten Attributen Tid Refund Marital Status Taxable Income 1 Yes Single 125K No 2 No Married 100K No 3 No Single 70K No 4 Yes Married 120K No Cheat 5 No Divorced 95K Yes 6 No Married 60K No 7 Yes Divorced 220K No 8 No Single 85K Yes 9 No Married 75K No 10 No Single 90K Yes Een verzameling attributen beschrijft een object 6

7 Soorten Attributen Nominaal: ID nummer, kleur, zip-code Ordinaal: rankings (hoog-medium-laag) Interval: kalender data, temperatuur in C of F. Ratio: temperaturen in K Eigenschappen van attributen Het type hangt af van welke van de volgende operaties ondersteund worden: Ongelijkheid: = Volgorde: < > Optelling: + - Vermenigvuldiging: * / 7

8 Attribuut Niveau Transformatie Commentaar Categorisch/kwalitatief Numeriek\quantitatief Nominaal Elke permutatie van de waarden Als alle werknemers nummers opnieuw toegekend worden, maakt dit een verschil? Ordinaal Interval Elke transformatie die de volgorde bewaart, bvb., new_value =a * old_value + b met a en b constanten Slecht-Gemiddeld-Goed kan gecodeerd worden als 1, 2, 3 of als -1, 0, 1, of als F en C kunnen in elkaar worden omgezet zonder verlies aan betekenis Ratio new_value = a * old_value Het is zinvol om te spreken over 2xlengte. Discreet en Continue variabelen Discrete Attributen Eindig of aftelbaar aantal attributen Voorbeeld: aantallen, huisnummers, verzameling van woorden in een document Kan m.b.v. integers voorgesteld worden. Merk op: binaire attributen zijn een speciaal geval Continue Attributen Reele getallen als waarden Voorbeelden: temperatuur, gewicht, lengte, 8

9 Vraag: Geef voorbeelden van Discreet Continu Nominaal Ordinaal Interval Ratio Vraag: Geef voorbeelden van Discreet Continu Nominaal Ordinaal Student IDs Goed-Slecht Interval Datums Tijdstippen Ratio Aantallen Lengte 9

10 Types van data sets Record data Data Matrix Document Data Transaction Data Graaf data World Wide Web Molecular Structures Geordende data Spatial Data Temporal Data Sequential Data Genetic Sequence Data Belangrijke karakteristieken van data Dimensie Curse of Dimensionality Sparsity Symmetrisch/assymmetrisch Resolutie Patronen afhankelijk van schaal 10

11 10 Record Data Data bestaat uit een collectie van records, elk met een vast aantal attributen Tid Refund Marital Status Taxable Income 1 Yes Single 125K No 2 No Married 100K No 3 No Single 70K No 4 Yes Married 120K No Cheat 5 No Divorced 95K Yes 6 No Married 60K No 7 Yes Divorced 220K No 8 No Single 85K Yes 9 No Married 75K No 10 No Single 90K Yes Data Matrix Objecten met een vast aantal attributen kunnen gezien worden als punten in een multi-dimensionele ruimte m x n matrix, voor elk van de m objecten is er een rij, voor elk van de n attributen is er een kolom. Projection of x Load Projection of y load Distance Load Thickness

12 Document data Elk document voorgesteld door een term vector, season timeout lost wi n game score ball pla y coach team Transactie Data Speciaal type van record data Elk record is een verzameling. Vb: supermarkt; de verzameling producten van een klant tijdens 1 bezoek aan de supermarkt komt overeen met 1 transactie TID Items 1 Bread, Coke, Milk 2 Beer, Bread 3 Beer, Coke, Diaper, Milk 4 Beer, Bread, Diaper, Milk 5 Coke, Diaper, Milk 12

13 Graaf data: een grote graaf Vb: HTML Links <a href="papers/papers.html#bbbb"> Data Mining </a> <li> <a href="papers/papers.html#aaaa"> Graph Partitioning </a> <li> <a href="papers/papers.html#aaaa"> Parallel Solution of Sparse Linear System of Equations </a> <li> <a href="papers/papers.html#ffff"> N-Body Computation and Dense Linear System Solvers Graaf data: afzonderlijke grafen Benzene Molecule: C 6 H 6 13

14 Geordende data Sequenties van transactions Items/gebeurtenissen Een element in de sequentie Geordende data Genoomsequenties GGTTCCGCCTTCAGCCCCGCGCC CGCAGGGCCCGCCCCGCGCCGTC GAGAAGGGCCCGCCTGGCGGGCG GGGGGAGGCGGGGCCGCCCGAGC CCAACCGAGTCCGACCAGGTGCC CCCTCTGCTCGGCCTAGACCTGA GCTCATTAGGCGGCAGCGGACAG GCCAAGTAGAACACGCGAAGCGC TGGGCTGCCTGCTGCGACCAGGG 14

15 Geordende data Spatio- Temporele Data Gemiddelde maandtemperatuur Overzicht Voorbereiden van de data voor data mining Types van data Data kwaliteit Welke problemen? Hoe ontdekken? Wat er aan doen? Pre-processing Maten voor afstand en similariteit 15

16 Data kwaliteit Soorten problemen: Ruis en outliers Ontbrekende waarden duplicaten Ruis Ruis Two Sine Waves Two Sine Waves + Noise 16

17 Outliers Outliers zijn data objecten met significant afwijkende karakteristieken Ontbrekende waarden Oorzaken Informatie was niet beschikbaar (Vb. Sommige mensen willen hun leeftijd of gewicht niet opgeven) Niet alle attributen van toepassing op alle objecten (vb. Jaarinkomen bij kinderen) Hoe er mee omgaan? Elimineren van objecten met ontbrekende waarden Schatten van de waarden Negeer de ontbrekende waarden Vervang met alle mogelijkheden + waarschijnlijkheidsdistributie 17

18 Duplicaten Typisch probleem wanneer we data uit verschillende bronnen combineren Voorbeelden: Persoon heeft meerdere -adressen Data cleaning Proces van het wegwerken van duplicaten Overzicht Klaarmaken van de data voor data mining Types van data Data kwaliteit Pre-processing Maten voor afstand en similariteit 18

19 Data Pre-processing Objecten Aggregatie Sampling Attributen Dimensionality Reduction Feature subset selectie Feature creatie Discretizatie and Binarizatie Attribuut Transformatie Data Pre-processing Objecten Aggregatie Sampling Attributen Dimensionality Reduction Feature subset selectie Feature creatie Discretizatie and Binarizatie Attribuut Transformatie 19

20 Aggregatie Combineren van twee of meer attributen/objecten in een enkel attribuut/object Doel Data reductie Schaalgrootte aanpassen Steden geaggregeerd in regios, landen, Stabielere data Geagregeerde data heeft minder variabiliteit (in het algemeen) Aggregatie Variatie van neerslag in Australie Gemiddelde maandelijkse neerslag Gemiddelde jaarlijkse neerslag 20

21 Data Pre-processing Objecten Aggregatie Sampling Attributen Dimensionality Reduction Feature subset selectie Feature creatie Discretizatie and Binarizatie Attribuut Transformatie Sampling De belangrijkste data selectie techniek. Vaak gebruikt bij een eerste analyse van de data. Sampeling heeft verschillende doelen Statistiek: data van volledige populatie is niet beschikbaar (steekproef) Data mining: de data is wel bechikbaar, maar de algoritmes schalen niet goed met de beschikbare data 21

22 Sampling Belangrijkste principes: Als de data representatief is, dan werkt sampling over het algemeen genomen even goed als het gebruiken van de volledige dataset. Een sample is representatief als de eigenschappen die van belang zijn voor de analyse hetzelfde zijn in de sample als in de oorspronkelijke data. Types van Sampling Simple Random Sampling Gelijke kans voor elk object om geselecteerd te worden Sampling zonder teruglegging Elk object kan slechts 1 maal geselecteerd worden Sampling met teruglegging Objecten kunnen meermaals geselecteerd worden Stratified sampling Data wordt verdeeld over verschillende partities en de partities worden afzonderlijk gesampled 22

23 Sample grootte 8000 points 2000 Points 500 Points Vraag: welke sample-grootte is nodig om uit elk van de 10 groepen minstens 1 object te hebben? 23

24 Data Pre-processing Objecten Aggregatie Sampling Attributen Dimensionality Reduction Feature subset selectie Feature creatie Discretizatie and Binarizatie Attribuut Transformatie Curse of Dimensionality Wanneer de dimensie van data toeneemt, wordt de ruimte leger Dichtheid en afstand verliezen hun betekenis Zijn kritisch voor clustering 500 random gegenereerde punten Bereken het relatieve verschil tussen de maximum en minumum afstand over alle paren van punten 24

25 Data Pre-processing Objecten Aggregatie Sampling Attributen Dimensionality Reduction Feature subset selectie Feature creatie Discretizatie and Binarizatie Attribuut Transformatie Dimensionality Reduction Doel: Vermijd curse of dimensionality Reduceer berekeningstijd van data mining algoritmes Betere visualisatie Kan ruis en irrelevante factoren verwijderen Technieken Principle Component Analysis Singular Value Decomposition Anderen: gesuperviseerde en niet-lineaire technieken 25

26 Dimensionality Reduction: PCA Doel is een projectie te vinden die de grootste variabiliteit van de data vat. x 2 e x 1 Dimensionality Reduction: PCA Zoek de eigenvectoren van de covariantie-matrix De eigenvectoren vormen de nieuwe basis x 2 e x 1 26

27 Data Pre-processing Objecten Aggregatie Sampling Attributen Dimensionality Reduction Feature subset selectie Feature creatie Discretizatie and Binarizatie Attribuut Transformatie Feature Subset Selectie Andere manier om het aantal dimensies te reduceren Redundante features Dupliceren veel van de informatie in de andere attributen Vb: prijs van een produkt en de hoeveelheid taksen betaald op dat produkt Irrelevante features Bevat geen informatie voor de data mining taak Vb: studentnummer, haarkleur hebben weinig relatie met de studieresultaten van studenten. 27

28 Feature Subset Selectie Technieken: Brute-force: Probeer alle mogelijkheden Embedded: Ingebouwd in het algoritme Filter: Vooraf, voor de data mining algoritmes worden uitgevoerd Wrapper: Gebruik het data mining algoritme als een black box om verschillende feature sets te evalueren Data Pre-processing Objecten Aggregatie Sampling Attributen Dimensionality Reduction Feature subset selectie Feature creatie Discretizatie and Binarizatie Attribuut Transformatie 28

29 Feature Creatie Creeer nieuwe attributen die relevant zijn voor de huidige data mining taak Drie algemene methodologieen: Feature Extraction Data transformeren naar een nieuwe ruimte Feature Construction Data transformeren naar een nieuwe ruimte Fourier transformatie Wavelet transformatie 2 sinussen Superpositie + ruis Frequenties 29

30 Data Pre-processing Objecten Aggregatie Sampling Attributen Dimensionality Reduction Feature subset selectie Feature creatie Discretisatie and Binarisatie Attribuut Transformatie Discretiseren met behulp van Class Labels Vaak gebaseerd op entropie 3 categories for both x and y 5 categories for both x and y 30

31 Discretiseren zonder Class Labels Data Gelijke interval breedte Gelijke frequentie K-means Overzicht Klaarmaken van de data voor data mining Types van data Data kwaliteit Pre-processing Maten voor afstand en similariteit (Verplaatst naar les 3) 31

2. Geef een voorbeeld van hoe datamining gebruikt kan worden om frauduleuze geldtransacties te identificeren.

2. Geef een voorbeeld van hoe datamining gebruikt kan worden om frauduleuze geldtransacties te identificeren. 1. Veronderstel dat je als datamining consultant werkt voor een Internet Search Engine bedrijf. Beschrijf hoe datamining het bedrijf kan helpen door voorbeelden te geven van specifieke toepassingen van

Nadere informatie

Data Mining: Classificatie

Data Mining: Classificatie Data Mining: Classificatie docent: dr. Toon Calders Gebaseerd op slides van Tan, Steinbach, and Kumar. Introduction to Data Mining Overzicht Wat is classificatie? Leren van een beslissingsboom. Problemen

Nadere informatie

Data Mining: Inleiding

Data Mining: Inleiding Data Mining: Inleiding docent: dr. Toon Calders Gebaseerd op slides van Tan, Steinbach, and Kumar. Introduction to Data Mining 2II15: Data mining en kennissystemen Lessen: maandag 7de en 8ste uur in Auditorium

Nadere informatie

Oplossingen Datamining 2II15 Juni 2008

Oplossingen Datamining 2II15 Juni 2008 Oplossingen Datamining II1 Juni 008 1. (Associatieregels) (a) Zijn de volgende beweringen juist of fout? Geef een korte verklaring voor alle juiste beweringen en een tegenvoorbeeld voor alle foute be-weringen:

Nadere informatie

Data Mining: Clustering

Data Mining: Clustering Data Mining: Clustering docent: dr. Toon Calders Gebaseerd op slides van Tan, Steinbach, and Kumar. Introduction to Data Mining Wat is clustering? Het onderverdelen van de objecten in een database in homogene

Nadere informatie

Data Mining: Classificatie

Data Mining: Classificatie Data Mining: lassificatie docent: dr. Toon alders Gebaseerd op slides van Tan, Steinbach, and Kumar. Introduction to Data Mining Vorige les lassificatie: Het groeperen van objecten in voorgedefinieerde

Nadere informatie

Data Mining: similariteit en visuele data exploratie

Data Mining: similariteit en visuele data exploratie Data Mining: similariteit en visuele data exploratie docent: dr. Toon Calders Gebaseerd op slides van Tan, Steinbach, and Kumar. Introduction to Data Mining Overzicht: wat zagen we vorige les? Data karakteristieken

Nadere informatie

Inleiding tot de meettheorie

Inleiding tot de meettheorie Inleiding tot de meettheorie Meten is het toekennen van cijfers aan voorwerpen. Koeien Koeien in een kudde, studenten in een auditorium, mensen met een bepaalde stoornis, leerlingen met meer dan 15 in

Nadere informatie

Uitwerking Tentamen Datamining (2II15) 26/06/09

Uitwerking Tentamen Datamining (2II15) 26/06/09 Uitwerking Tentamen Datamining (2II15) 26/06/09 1. (3p) (Clustering) Welke van de volgende uitspraken zijn correct? Voor de correcte uitspraken: leg uit, voor de incorrecte: geef een tegenvoorbeeld. (a)

Nadere informatie

Classification - Prediction

Classification - Prediction Classification - Prediction Tot hiertoe: vooral classification Naive Bayes k-nearest Neighbours... Op basis van predictor variabelen X 1, X 2,..., X p klasse Y (= discreet) proberen te bepalen. Training

Nadere informatie

Tentamen Data Mining

Tentamen Data Mining Tentamen Data Mining Algemene Opmerkingen Dit is geen open boek tentamen, noch mogen er aantekeningen gebruikt worden. Laat bij het uitvoeren van berekeningen zien hoe je aan een antwoord gekomen bent.

Nadere informatie

lengte aantal sportende broers/zussen

lengte aantal sportende broers/zussen Oefening 1 Alvorens opgenomen te worden in een speciaal begeleidingsprogramma s voor jonge talentvolle lopers, worden jonge atleten eerst onderworpen aan een aantal vragenlijsten en onderzoeken. Uit het

Nadere informatie

A. Week 1: Introductie in de statistiek.

A. Week 1: Introductie in de statistiek. A. Week 1: Introductie in de statistiek. Populatie en steekproef. In dit vak leren we de basis van de statistiek. In de statistiek probeert men erachter te komen hoe we de populatie het beste kunnen observeren.

Nadere informatie

SPSS Introductiecursus. Sanne Hoeks Mattie Lenzen

SPSS Introductiecursus. Sanne Hoeks Mattie Lenzen SPSS Introductiecursus Sanne Hoeks Mattie Lenzen Statistiek, waarom? Doel van het onderzoek om nieuwe feiten van de werkelijkheid vast te stellen door middel van systematisch onderzoek en empirische verzamelen

Nadere informatie

Continuous Learning in Computer Vision S.L. Pintea

Continuous Learning in Computer Vision S.L. Pintea Continuous Learning in Computer Vision S.L. Pintea Continuous Learning in Computer Vision Natura non facit saltus. Gottfried Leibniz Silvia-Laura Pintea Intelligent Sensory Information Systems University

Nadere informatie

Data mining Van boodschappenmandjes tot bio-informatica

Data mining Van boodschappenmandjes tot bio-informatica Data mining Van boodschappenmandjes tot bio-informatica Walter Kosters Informatica, Universiteit Leiden donderdag 6 april 2006 http://www.liacs.nl/home/kosters/ 1 Wat is Data mining? Data mining probeert

Nadere informatie

Tentamen Data Mining. Algemene Opmerkingen. Opgave L. Korte vragen (L6 punten) Tijd: 14:00-17:00. Datum: 4januai20l6

Tentamen Data Mining. Algemene Opmerkingen. Opgave L. Korte vragen (L6 punten) Tijd: 14:00-17:00. Datum: 4januai20l6 Tentamen Data Mining Datum: 4januai2l6 Tijd: 4: - 7: Algemene Opmerkingen e Dit is geen open boek tentamen, noch mogen er aantekeningen gebruikt worden. o Laat bij het uitvoeren van berekeningen zien hoeje

Nadere informatie

Toets deel 2 Data-analyse en retrieval Vrijdag 1 Juli 2016:

Toets deel 2 Data-analyse en retrieval Vrijdag 1 Juli 2016: Toets deel 2 Data-analyse en retrieval Vrijdag 1 Juli 2016: 11.00-13.00 Algemene aanwijzingen 1. Het is toegestaan een aan beide zijden beschreven A4 met aantekeningen te raadplegen. 2. Het is toegestaan

Nadere informatie

Statistiek. Beschrijvend statistiek

Statistiek. Beschrijvend statistiek Statistiek Beschrijvend statistiek Verzameling van gegevens en beschrijvingen Populatie, steekproef Populatie = o de gehele groep ondervragen o parameter is een kerngetal Steekproef = o een onderdeel van

Nadere informatie

Herkansing Inleiding Intelligente Data Analyse Datum: Tijd: , BBL 508 Dit is geen open boek tentamen.

Herkansing Inleiding Intelligente Data Analyse Datum: Tijd: , BBL 508 Dit is geen open boek tentamen. Herkansing Inleiding Intelligente Data Analyse Datum: 3-3-2003 Tijd: 14.00-17.00, BBL 508 Dit is geen open boek tentamen. Algemene aanwijzingen 1. U mag ten hoogste één A4 met aantekeningen raadplegen.

Nadere informatie

5.0 Voorkennis. Er zijn verschillende manieren om gegevens op een grafische wijze weer te geven: 1. Staafdiagram:

5.0 Voorkennis. Er zijn verschillende manieren om gegevens op een grafische wijze weer te geven: 1. Staafdiagram: 5.0 Voorkennis Er zijn verschillende manieren om gegevens op een grafische wijze weer te geven: 1. Staafdiagram: De lengte van de staven komt overeen met de hoeveelheid; De staven staan meestal los van

Nadere informatie

4 Domein STATISTIEK - versie 1.2

4 Domein STATISTIEK - versie 1.2 USolv-IT - Boomstructuur DOMEIN STATISTIEK - versie 1.2 - c Copyrighted 42 4 Domein STATISTIEK - versie 1.2 (Op initiatief van USolv-IT werd deze boomstructuur mede in overleg met het Universitair Centrum

Nadere informatie

Hoorcollege 1 datavisualisatie 21-11-12

Hoorcollege 1 datavisualisatie 21-11-12 Hoorcollege 1 21-11-12 docenten! http://vimeo.com/31244010#at=10 hoorcollege 1 introductie HVA CMD V2 21 november 2012!! justus sturkenboom! j.p.sturkenboom@hva.nl! yuri westplat! y.westplat@hva.nl! vandaag

Nadere informatie

Kansrekening en Statistiek

Kansrekening en Statistiek Kansrekening en Statistiek College 9 Woensdag 7 Oktober 1 / 51 Kansrekening en Statistiek? Bevordert luieren de fantasie? Psychologie 2 / 51 Kansrekening en Statistiek? Bevordert luieren de fantasie? Psychologie

Nadere informatie

Data analyse Inleiding statistiek

Data analyse Inleiding statistiek Data analyse Inleiding statistiek 1 Doel Beheersen van elementaire statistische technieken Toepassen van deze technieken op aardwetenschappelijke data 2 1 Leerstof Boek: : Introductory Statistics, door

Nadere informatie

DOS-oefening 2. lengte Aantal sportende broers/zussen

DOS-oefening 2. lengte Aantal sportende broers/zussen DOS-oefening 2 Oefening 1: meetniveaus Alvorens opgenomen te worden in een speciaal begeleidingsprogramma s voor jonge talentvolle lopers, worden jonge atleten eerst onderworpen aan een aantal vragenlijsten

Nadere informatie

studie waarmee we de principes van de analyse willen demonstreren. Een volledig beschrijving van de algoritmen en de resultaten zijn te vinden in

studie waarmee we de principes van de analyse willen demonstreren. Een volledig beschrijving van de algoritmen en de resultaten zijn te vinden in Bio-informatica kan omschreven worden als het toepassen van algoritmen om meerwaarde te verkrijgen uit data afkomstig van biomedisch en/of biologisch onderzoek. In bio-informatica wordt onderzoek gedaan

Nadere informatie

DATA MINING (TI2730-C)

DATA MINING (TI2730-C) Technische Universiteit Delft Elektrotechniek, Wiskunde en Informatica Secties: Pattern Recognition & Bioinformatics & Multimedia Signal Processing DATA MINING (TI2730-C) Schriftelijk (her)tentomen. Dinsdag

Nadere informatie

Opdracht 5a ----------- Kruistabellen

Opdracht 5a ----------- Kruistabellen Opdracht 5a ----------- Kruistabellen Aan elk van 36 studenten werd gevraagd of zij alcohol drinken, en zo ja, welke soort alcoholische drank de voorkeur heeft. Tevens werd voor elke student de leeftijd

Nadere informatie

3.1 Procenten [1] In 1994 zijn er 3070 groentewinkels in Nederland. In 2004 zijn dit er nog 1625.

3.1 Procenten [1] In 1994 zijn er 3070 groentewinkels in Nederland. In 2004 zijn dit er nog 1625. 3.1 Procenten [1] In 1994 zijn er 3070 groentewinkels in Nederland. In 2004 zijn dit er nog 1625. Absolute verandering = Aantal 2004 Aantal 1994 = 1625 3070 = -1445 Relatieve verandering = Nieuw Oud Aantal

Nadere informatie

Matrices en Grafen (wi1110ee)

Matrices en Grafen (wi1110ee) Matrices en Grafen (wi1110ee) Electrical Engineering TUDelft September 1, 2010 September 1, 2010 Inleiding Mekelweg 4, kamer 4.240 tel : (015 27)86408 e-mail : I.A.M.Goddijn@TUDelft.nl homepage : http:

Nadere informatie

Data analyse Inleiding statistiek

Data analyse Inleiding statistiek Data analyse Inleiding statistiek 1 Terugblik - Inductieve statistiek Afleiden van eigenschappen van een populatie op basis van een beperkt aantal metingen (steekproef) Kennis gemaakt met kans & kansverdelingen»

Nadere informatie

Statistiek met Excel. Schoolexamen en Uitbreidingsopdrachten. Dit materiaal is gemaakt binnen de Leergang Wiskunde schooljaar 2013/14

Statistiek met Excel. Schoolexamen en Uitbreidingsopdrachten. Dit materiaal is gemaakt binnen de Leergang Wiskunde schooljaar 2013/14 Statistiek met Excel Schoolexamen en Uitbreidingsopdrachten 2 Inhoudsopgave Achtergrondinformatie... 4 Schoolexamen Wiskunde VWO: Statistiek met grote datasets... 5 Uibreidingsopdrachten vwo 5... 6 Schoolexamen

Nadere informatie

Zelftest Inleiding Programmeren

Zelftest Inleiding Programmeren Zelftest Inleiding Programmeren Document: n0824test.fm 22/01/2013 ABIS Training & Consulting P.O. Box 220 B-3000 Leuven Belgium TRAINING & CONSULTING INLEIDING BIJ DE ZELFTEST INLEIDING PROGRAMMEREN Deze

Nadere informatie

CTB1002 deel 1 - Lineaire algebra 1

CTB1002 deel 1 - Lineaire algebra 1 CTB100 deel 1 - Lineaire algebra 1 College 5 5 februari 014 1 Opbouw college Vandaag behandelen we hoofdstuk 1.7 en deel van 1.8 Voor de pauze: hoofdstuk 1.7 Na de pauze: hoofdstuk 1.8 Verschillende notaties

Nadere informatie

introductie Wilcoxon s rank sum toets Wilcoxon s signed rank toets introductie Wilcoxon s rank sum toets Wilcoxon s signed rank toets

introductie Wilcoxon s rank sum toets Wilcoxon s signed rank toets introductie Wilcoxon s rank sum toets Wilcoxon s signed rank toets toetsende statistiek week 1: kansen en random variabelen week : de steekproevenverdeling week 3: schatten en toetsen: de z-toets week : het toetsen van gemiddelden: de t-toets week 5: het toetsen van varianties:

Nadere informatie

TW2020 Optimalisering

TW2020 Optimalisering TW2020 Optimalisering Hoorcollege 8 Leo van Iersel Technische Universiteit Delft 28 oktober 2015 Leo van Iersel (TUD) TW2020 Optimalisering 28 oktober 2015 1 / 25 Definitie Een boom is een samenhangende

Nadere informatie

waarin de op dit moment relevante bron data als ook de analyse technieken worden geintegreerd.

waarin de op dit moment relevante bron data als ook de analyse technieken worden geintegreerd. 129 Samenvatting Bioinformatica is een interdisciplinair onderzoeksveld waarbij methoden uit de computer wetenschappen, wiskunde en statistiek worden gebruikt met het specifieke doel betekenis te geven

Nadere informatie

3.1 Opsomming data type

3.1 Opsomming data type Deel I Hoofdstuk 3: Klasse Model - gevorderd 2005 Prof Dr. O. De Troyer Klasse Model - gevorderd pag. 1 3.1 Opsomming data type Opsomming (enumeration) data type Data type waarvan de verzameling waarden

Nadere informatie

HAVO 4 wiskunde A. Een checklist is een opsomming van de dingen die je moet kennen en kunnen....

HAVO 4 wiskunde A. Een checklist is een opsomming van de dingen die je moet kennen en kunnen.... HAVO 4 wiskunde A Een checklist is een opsomming van de dingen die je moet kennen en kunnen.... 1. rekenregels en verhoudingen Ik kan breuken vermenigvuldigen en delen. Ik ken de rekenregel breuk Ik kan

Nadere informatie

We berekenen nog de effectgrootte aan de hand van formule 4.2 en rapporteren:

We berekenen nog de effectgrootte aan de hand van formule 4.2 en rapporteren: INDUCTIEVE STATISTIEK VOOR DE GEDRAGSWETENSCHAPPEN OPLOSSINGEN BIJ HOOFDSTUK 4 1. Toets met behulp van SPSS de hypothese van Evelien in verband met de baardlengte van metalfans. Ga na of je dezelfde conclusies

Nadere informatie

Hoofdstuk 2 : Grafische beschrijving van data. Marnix Van Daele. Vakgroep Toegepaste Wiskunde en Informatica Universiteit Gent

Hoofdstuk 2 : Grafische beschrijving van data. Marnix Van Daele. Vakgroep Toegepaste Wiskunde en Informatica Universiteit Gent Hoofdstuk 2 : Grafische beschrijving van data Marnix Van Daele Marnix.VanDaele@UGent.be Vakgroep Toegepaste Wiskunde en Informatica Universiteit Gent Grafische beschrijving van data p. 1/35 Soorten meetwaarden

Nadere informatie

ONBETWIST ONderwijs verbeteren met WISkunde Toetsen Voorbeeldtoetsen Lineaire Algebra Deliverable 3.10 Henk van der Kooij ONBETWIST Deliverable 3.

ONBETWIST ONderwijs verbeteren met WISkunde Toetsen Voorbeeldtoetsen Lineaire Algebra Deliverable 3.10 Henk van der Kooij ONBETWIST Deliverable 3. ONBETWIST ONderwijs verbeteren met WISkunde Toetsen Voorbeeldtoetsen Lineaire Algebra Deliverable 3.10 Henk van der Kooij ONBETWIST Deliverable 3.8 ONBETWIST ONderwijs verbeteren met WISkunde Toetsen Inleiding

Nadere informatie

Onderzoeksmethoden: Statistiek 1

Onderzoeksmethoden: Statistiek 1 0 123458898391081904749010998490849 074907079`794793784908`094389983.. Onderzoeksmethoden: Statistiek 1 Joepie, ons computerprogramma levert output Wat doen we hiermee? Marjan van den Akker 1 2 Output

Nadere informatie

Lineaire Algebra TW1205TI. I.A.M. Goddijn, Faculteit EWI 12 februari 2014

Lineaire Algebra TW1205TI. I.A.M. Goddijn, Faculteit EWI 12 februari 2014 Lineaire Algebra TW1205TI, 12 februari 2014 Contactgegevens Mekelweg 4, kamer 4.240 tel : (015 27)86408 e-mail : I.A.M.Goddijn@TUDelft.nl homepage : http: //fa.its.tudelft.nl/ goddijn blackboard : http:

Nadere informatie

Parking Surveillance. foreground/background segmentation - objectherkenning. Examen Beeldverwerking Pieter Vancoillie

Parking Surveillance. foreground/background segmentation - objectherkenning. Examen Beeldverwerking Pieter Vancoillie Parking Surveillance foreground/background segmentation - objectherkenning Examen Beeldverwerking Pieter Vancoillie Doel van het (deel)project Uit beelden van een camera voetgangers, fietsers en auto s

Nadere informatie

twee partijen zijn. Aangezien het bij data mining gaat om grote hoeveelheden data is het belangrijk om praktische oplossingen te hebben.

twee partijen zijn. Aangezien het bij data mining gaat om grote hoeveelheden data is het belangrijk om praktische oplossingen te hebben. Samenvatting Deze thesis handelt over privacy preserving data mining. Data mining is een tak van de wetenschap waarin men grote hoeveelheden data onderzoekt met de bedoeling er bepaalde patronen in te

Nadere informatie

Anomaliedetectie en patroonherkenning

Anomaliedetectie en patroonherkenning Digitale overheid van de Toekomst, 28 september 2016 Anomaliedetectie en patroonherkenning binnen de loonaangifteketen Dr. Ralph Foorthuis Voorstelrondje Werkervaring Sr. enterprise architect bij UWV Werkzaam

Nadere informatie

Ruimtewiskunde. college. Stelsels lineaire vergelijkingen. Vandaag UNIVERSITEIT TWENTE. Stelsels lineaire vergelijkingen.

Ruimtewiskunde. college. Stelsels lineaire vergelijkingen. Vandaag UNIVERSITEIT TWENTE. Stelsels lineaire vergelijkingen. college 4 collegejaar college build slides Vandaag : : : : 16-17 4 29 maart 217 38 1 2 3.16-17[4] 1 vandaag Vectoren De notatie (x 1, x 2,..., x n ) wordt gebruikt voor het punt P met coördinaten (x 1,

Nadere informatie

Examen G0N34 Statistiek

Examen G0N34 Statistiek Naam: Richting: Examen G0N34 Statistiek 8 september 2010 Enkele richtlijnen : Wie de vragen aanneemt en bekijkt, moet minstens 1 uur blijven zitten. Je mag gebruik maken van een rekenmachine, het formularium

Nadere informatie

TW2020 Optimalisering

TW2020 Optimalisering TW2020 Optimalisering Hoorcollege 8 Leo van Iersel Technische Universiteit Delft 2 november 2016 Leo van Iersel (TUD) TW2020 Optimalisering 2 november 2016 1 / 28 Minimum Opspannende Boom (Minimum Spanning

Nadere informatie

Kansrekening en Statistiek

Kansrekening en Statistiek Kansrekening en Statistiek College 10 Donderdag 14 Oktober 1 / 71 1 Kansrekening Indeling: Bayesiaans leren 2 / 71 Bayesiaans leren 3 / 71 Bayesiaans leren: spelletje Vb. Twee enveloppen met kralen, waarvan

Nadere informatie

Eindtermen Lineaire Algebra voor E vor VKO (2DE01)

Eindtermen Lineaire Algebra voor E vor VKO (2DE01) Eindtermen Lineaire Algebra voor E vor VKO (2DE01) dr. G.R. Pellikaan 1 Voorkennis Middelbare school stof van wiskunde en natuurkunde. Eerste gedeelte (Blok A) van Lineaire Algebra voor E (2DE04). 2 Globale

Nadere informatie

Inleiding Applicatie Software - Statgraphics

Inleiding Applicatie Software - Statgraphics Inleiding Applicatie Software - Statgraphics Beschrijvende Statistiek /k 1/35 OPDRACHT OVER BESCHRIJVENDE STATISTIEK Beleggen Door een erfenis heeft een vriend van u onverwacht de beschikking over een

Nadere informatie

Statistiek voor Natuurkunde Opgavenserie 1: Kansrekening

Statistiek voor Natuurkunde Opgavenserie 1: Kansrekening Statistiek voor Natuurkunde Opgavenserie 1: Kansrekening Inleveren: 12 januari 2011, VOOR het college Afspraken Serie 1 mag gemaakt en ingeleverd worden in tweetallen. Schrijf duidelijk je naam, e-mail

Nadere informatie

Antwoorden op de theoretische vragen in de examen voorbereiding

Antwoorden op de theoretische vragen in de examen voorbereiding Antwoorden op de theoretische vragen in de examen voorbereiding Theorie vraag Zij A een m n-matrix. Geef het verband tussen de formule voor de dimensie d van een niet-strijdig stelsel, d = n rang (A) (zie

Nadere informatie

LES 3 Analoog naar digitaal conversie

LES 3 Analoog naar digitaal conversie LES 3 Analoog naar digitaal conversie Misschien is het goed om eerst te definiëren wat analoog en digitaal is en wat de de voor en nadelen hiervan zijn. Analoog naar digitaal conversie wordt voor veel

Nadere informatie

TIP 10: ANALYSE VAN DE CIJFERS

TIP 10: ANALYSE VAN DE CIJFERS TOETSTIP 10 oktober 2011 Bepaling wat en waarom je wilt meten Toetsopzet Materiaal Betrouw- baarheid Beoordeling Interpretatie resultaten TIP 10: ANALYSE VAN DE CIJFERS Wie les geeft, botst automatisch

Nadere informatie

Effectief Rapporteren

Effectief Rapporteren Effectief Rapporteren van rapporteren naar inzicht Michel Dekker michel.dekker@novasilva.com Bron: http://www.orrplumbing.com/plumbing-problems/plumbing-a-bathroom/ Bron:http://www.telegraph.co.uk/news/picturegalleries/howaboutthat/2689914/The-upside-down-house.html?image=6

Nadere informatie

Recognition and Detection of Objects Using Visual and Textual Cues S. Karaoğlu

Recognition and Detection of Objects Using Visual and Textual Cues S. Karaoğlu Recognition and Detection of Objects Using Visual and Textual Cues S. Karaoğlu Samenvatting Met dit proefschrift richten we onze aandacht op object herkenning en detectie voor een beter begrip in afbeeldingen.

Nadere informatie

Onderzoeksmethodiek LE: 2

Onderzoeksmethodiek LE: 2 Onderzoeksmethodiek LE: 2 3 Parameters en grootheden 3.1 Parameters Wat is een parameter? Een karakteristieke grootheid van een populatie Gem. gewicht van een 34-jarige man 3.2 Steekproefgrootheden Wat

Nadere informatie

2 Data en datasets verwerken

2 Data en datasets verwerken Domein Statistiek en kansrekening havo A 2 Data en datasets verwerken 1 Data presenteren 1.4 Oefenen In opdracht van: Commissie Toekomst Wiskunde Onderwijs 1.4 Oefenen Opgave 9 Bekijk de genoemde dataset

Nadere informatie

Teggs beeldherkenning

Teggs beeldherkenning Teggs beeldherkenning Peter Tummers 17 Januari 2013 WP 3 - Ontwerp van betrouwbare codes Doelsteling: Ontwikkeling van technieken die betrouwbare codes genereren voor een individueel ei. Uitvoering: Een

Nadere informatie

Kansrekening en Statistiek

Kansrekening en Statistiek Kansrekening en Statistiek College 16 Donderdag 4 November 1 / 25 2 Statistiek Indeling: Schatten Correlatie 2 / 25 Schatten 3 / 25 Schatters: maximum likelihood schatters Def. Zij Ω de verzameling van

Nadere informatie

Web mining. In het bijzonder web usage mining

Web mining. In het bijzonder web usage mining Web mining In het bijzonder web usage mining Hoofdstuk web mining uit: Data Mining, Introductory and dvanced Topics; Margaret H. Dunham Web mining Web content mining: wat staat er in webpagina s? Web crawlers,

Nadere informatie

Hierbij is het steekproefgemiddelde x_gemiddeld= en de steekproefstandaardafwijking

Hierbij is het steekproefgemiddelde x_gemiddeld= en de steekproefstandaardafwijking Opdracht 9a ----------- t-procedures voor een enkelvoudige steekproef Voor de meting van de leesvaardigheid van kinderen wordt als toets de Degree of Reading Power (DRP) gebruikt. In een onderzoek onder

Nadere informatie

Toetsende Statistiek, Week 2. Van Steekproef naar Populatie: De Steekproevenverdeling

Toetsende Statistiek, Week 2. Van Steekproef naar Populatie: De Steekproevenverdeling Toetsende Statistiek, Week 2. Van Steekproef naar Populatie: De Steekproevenverdeling Moore, McCabe & Craig: 3.3 Toward Statistical Inference From Probability to Inference 5.1 Sampling Distributions for

Nadere informatie

1BA PSYCH Statistiek 1 Oefeningenreeks 3 1

1BA PSYCH Statistiek 1 Oefeningenreeks 3 1 Juno KOEKELKOREN D.1.3. OEFENINGENREEKS 3 OEFENING 1 In onderstaande tabel vind je zes waarnemingen van twee variabelen (ratio meetniveau). Eén van de waarden van y is onbekend. Waarde x y 1 1 2 2 9 2

Nadere informatie

Populaties beschrijven met kansmodellen

Populaties beschrijven met kansmodellen Populaties beschrijven met kansmodellen Prof. dr. Herman Callaert Deze tekst probeert, met voorbeelden, inzicht te geven in de manier waarop je in de statistiek populaties bestudeert. Dat doe je met kansmodellen.

Nadere informatie

Zomerschool Vakdidactisch Onderzoek Leuven, 8-10 september 2010 Sessie 8: Analyse van kwantitatieve data

Zomerschool Vakdidactisch Onderzoek Leuven, 8-10 september 2010 Sessie 8: Analyse van kwantitatieve data Zomerschool Vakdidactisch Onderzoek Leuven, 8-10 september 2010 Sessie 8: Analyse van kwantitatieve data An Carbonez Leuven Statistics Research Centre Katholieke Universiteit Leuven Voorstelling van de

Nadere informatie

2 Fourier analyse en de Fast Fourier Transform

2 Fourier analyse en de Fast Fourier Transform 2 FOURIER ANALYSE EN DE FAST FOURIER TRANSFORM 21 2 Fourier analyse en de Fast Fourier Transform Zij f een continue 2π-periodieke funktie op IR (eventueel met complexe waarden), dan kunnen we f ontwikkelen

Nadere informatie

Inhoud. Neuronen. Synapsen. McCulloch-Pitts neuron. Sigmoids. De bouwstenen van het zenuwstelsel: neuronen en synapsen

Inhoud. Neuronen. Synapsen. McCulloch-Pitts neuron. Sigmoids. De bouwstenen van het zenuwstelsel: neuronen en synapsen Tom Heskes IRIS, NIII Inhoud De bouwstenen van het zenuwstelsel: neuronen en synapsen Complex gedrag uit eenvoudige elementen McCulloch-Pitts neuronen Hopfield netwerken Computational neuroscience Lerende

Nadere informatie

ONDERDRUKKEN VAN LEK NAAR ZIJLOBBEN BIJ HET BEREKENEN VAN AUTO- EN KRUISSPECTRA M.B.V. PAST FOURIER TRANSFORMS

ONDERDRUKKEN VAN LEK NAAR ZIJLOBBEN BIJ HET BEREKENEN VAN AUTO- EN KRUISSPECTRA M.B.V. PAST FOURIER TRANSFORMS ONDERDRUKKEN VAN LEK NAAR ZIJLOBBEN BIJ HET BEREKENEN VAN AUTO- EN KRUISSPECTRA M.B.V. PAST FOURIER TRANSFORMS G. Klopman Waterloopkundig Laboratorium 24 februari 1989 1. Inleiding Bij het bepalen van

Nadere informatie

2.1.4 Oefenen. d. Je ziet hier twee weegschalen. Wat is het verschil tussen beide als het gaat om het aflezen van een gewicht?

2.1.4 Oefenen. d. Je ziet hier twee weegschalen. Wat is het verschil tussen beide als het gaat om het aflezen van een gewicht? 2.1.4 Oefenen Opgave 9 Bekijk de genoemde dataset GEGEVENS154LEERLINGEN. a. Hoe lang is het grootste meisje? En de grootste jongen? b. Welke lengtes komen het meeste voor? c. Is het berekenen van gemiddelden

Nadere informatie

Data analyse Inleiding statistiek

Data analyse Inleiding statistiek Data analyse Inleiding statistiek Terugblik - Inductieve statistiek Afleiden van eigenschappen van een populatie op basis van een beperkt aantal metingen (steekproef) Kennis gemaakt met kans & kansverdelingen

Nadere informatie

Niet de hoogte, wel de oppervlakte. Aandachtspunten bij. - statistische technieken voor een continue veranderlijke

Niet de hoogte, wel de oppervlakte. Aandachtspunten bij. - statistische technieken voor een continue veranderlijke Niet de hoogte, wel de oppervlakte Prof. dr. Herman Callaert Aandachtspunten bij - statistische technieken voor een continue veranderlijke - de interpretatie van een histogram - de normale dichtheidsfunctie

Nadere informatie

Operationaliseren van variabelen (abstracte begrippen)

Operationaliseren van variabelen (abstracte begrippen) Operationaliseren van variabelen (abstracte begrippen) Tabel 1, schematisch overzicht van abstracte begrippen, variabelen, dimensies, indicatoren en items. (Voorbeeld is ontleend aan de masterscriptie

Nadere informatie

Inleiding Applicatie Software - Statgraphics. Beschrijvende Statistiek

Inleiding Applicatie Software - Statgraphics. Beschrijvende Statistiek Inleiding Applicatie Software - Statgraphics Beschrijvende Statistiek OPDRACHT OVER BESCHRIJVENDE STATISTIEK Beleggen Door een erfenis heeft een vriend van u onverwacht de beschikking over een klein kapitaaltje

Nadere informatie

November December 2011. Jan Meskens / Onderzoek

November December 2011. Jan Meskens / Onderzoek Jan Meskens / Onderzoek 1 Wat is "Predictive Analytics"? Historische en/of huidige data Voorspellingen over de toekomst 2 Toepassing: fraudebestrijding Opsporen fraude met aanrijdingsformulieren [SAS]

Nadere informatie

DEC SDR DSP project 2017 (2)

DEC SDR DSP project 2017 (2) DEC SDR DSP project 2017 (2) Inhoud: DSP software en rekenen Effect van type getallen (integer, float) Fundamenten onder DSP Lezen van eenvoudige DSP formules x[n] Lineariteit ( x functie y dus k maal

Nadere informatie

Geheeltallige programmering

Geheeltallige programmering Geheeltallige programmering In een LP probleem zijn alle variabelen reëel. In een geheeltallig probleem blijven doelfunctie en constraints lineair, maar zijn de variabelen geheeltallig. LP: IP: BIP: MIP:

Nadere informatie

Kansrekening en Statistiek

Kansrekening en Statistiek Kansrekening en Statistiek College 7 Dinsdag 11 Oktober 1 / 33 2 Statistiek Vandaag: Populatie en steekproef Maten Standaardscores Normale verdeling Stochast en populatie Experimenten herhalen 2 / 33 3

Nadere informatie

Deze menu-aansturingen zijn van toepassing op versies 14.0 en 15.0 van SPSS.

Deze menu-aansturingen zijn van toepassing op versies 14.0 en 15.0 van SPSS. Menu aansturing van SPSS voorbeeld in hoofdstuk 9 over multipele correspondentie (HOMALS) en niet-linaire principale componenten analyse (PRINCALS) van kenmerken van moorden Hieronder wordt uitgelegd hoe

Nadere informatie

Vakgroep CW KAHO Sint-Lieven

Vakgroep CW KAHO Sint-Lieven Vakgroep CW KAHO Sint-Lieven Objecten Programmeren voor de Sport: Een inleiding tot JAVA objecten Wetenschapsweek 20 November 2012 Tony Wauters en Tim Vermeulen tony.wauters@kahosl.be en tim.vermeulen@kahosl.be

Nadere informatie

Lineaire Algebra (2DD12)

Lineaire Algebra (2DD12) Lineaire Algebra (2DD12) docent: Ruud Pellikaan - Judith Keijsper email: J.C.M.Keijsper@tue.nl studiewijzer: http://www.win.tue.nl/ ruudp/2dd12.html Technische Universiteit Eindhoven college 1 J.Keijsper

Nadere informatie

DATA-ANALYSEPLAN (20/6/2005)

DATA-ANALYSEPLAN (20/6/2005) DATA-ANALYSEPLAN (20/6/2005) Inleiding De manier waarop data georganiseerd, gecodeerd en gescoord (getallen toekennen aan observaties) worden en welke technieken daarvoor nodig zijn, dient in het ideale

Nadere informatie

Datamining: Graven in gegevens

Datamining: Graven in gegevens Datamining: Graven in gegevens Business Intelligence in de praktijk Jasper Lansink CMG Noord Nederland - Advanced Technology Agenda Business Intelligence Datamining theorie Datamining in de praktijk management

Nadere informatie

Voorspellen van webwinkel aankopen met een Random Forest

Voorspellen van webwinkel aankopen met een Random Forest Voorspellen van webwinkel aankopen met een Random Forest Dorenda Slof Erasmus Universiteit Rotterdam Econometrie en Operationele Research 30 juni 2014 Samenvatting In dit empirische onderzoek voorspellen

Nadere informatie

Inleiding tot het opstellen van een elektronische enquête met LimeSurvey

Inleiding tot het opstellen van een elektronische enquête met LimeSurvey Inleiding tot het opstellen van een elektronische enquête met LimeSurvey Cursus Wetenschappelijk denken en Informatica voor leidinggevenden in het UZ Brussel (voorjaar 2011) 4-3-2011 Herhaling titel van

Nadere informatie

NBB.Stat Jaarrekeningen. Gebruikershandleiding Statistieken uit de jaarrekeningen (Balanscentrale)

NBB.Stat Jaarrekeningen. Gebruikershandleiding Statistieken uit de jaarrekeningen (Balanscentrale) NBB.Stat Jaarrekeningen Gebruikershandleiding Statistieken uit de jaarrekeningen (Balanscentrale) NBB.Stat Gebruikershandleiding Statistieken uit de jaarrekeningen (Balanscentrale) 2. Inhoudsopgave 1 INLEIDING...

Nadere informatie

datavisualisatie Stappen 14-12-12 verzamelen en opschonen analyseren van data interpeteren hoorcollege 4 visualisatie representeren

datavisualisatie Stappen 14-12-12 verzamelen en opschonen analyseren van data interpeteren hoorcollege 4 visualisatie representeren Stappen datavisualisatie hoorcollege 4 visualisatie HVA CMD V2 12 december 2012 verzamelen en opschonen analyseren van data interpeteren representeren in context plaatsen 1 "Ultimately, the key to a successful

Nadere informatie

d. Maak een spreidingsdiagram van de gegevens. Plaats de x-waarden op de x-as en de z-waarden op de y-as.

d. Maak een spreidingsdiagram van de gegevens. Plaats de x-waarden op de x-as en de z-waarden op de y-as. Opdracht 6a ----------- Dichtheidskromme, normaal-kwantiel-plot Een nauwkeurige waarde van de lichtsnelheid is van belang voor ontwerpers van computers, omdat de elektrische signalen zich uitsluitend met

Nadere informatie

Leerlingen concentreren zich op het bouwen van slangen met de juiste lengte. Leerlingen kunnen optellen tot 20 en gebruiken eenvoudige wiskundetaal.

Leerlingen concentreren zich op het bouwen van slangen met de juiste lengte. Leerlingen kunnen optellen tot 20 en gebruiken eenvoudige wiskundetaal. Slang Leerlingen concentreren zich op het bouwen van slangen met de juiste lengte en vragen eventueel elkaar of leerkracht om hulp. Problemen proberen te begrijpen en blijven zoeken naar een oplossing

Nadere informatie

Grafische voorstellingen

Grafische voorstellingen Grafische voorstellingen Onderzoek omtrent de lonen. Wat is uw huidige loon. Streep het gepaste hokje aan. q 40 000-45 000 q 45 000-50 000 q 50 000-55 000 q 55 000-60 000 q 60 000-80 000 q 80 000-100 000

Nadere informatie

Stochastiek 2. Inleiding in de Mathematische Statistiek 1/19

Stochastiek 2. Inleiding in de Mathematische Statistiek 1/19 Stochastiek 2 Inleiding in de Mathematische Statistiek 1/19 Herhaling H.1 2/19 Mathematische Statistiek We beschouwen de beschikbare data als realisatie(s) van een stochastische grootheid X.(Vaak een vector

Nadere informatie

Statistiek voor A.I. College 2. Donderdag 13 September 2012

Statistiek voor A.I. College 2. Donderdag 13 September 2012 Statistiek voor A.I. College 2 Donderdag 13 September 2012 1 / 42 1 Beschrijvende statistiek 2 / 42 Extrapolatie 3 / 42 Verkiezingen 2012 4 / 42 Verkiezingen 2012 5 / 42 1 Beschrijvende statistiek Vandaag:

Nadere informatie

Statistiek: Spreiding en dispersie 6/12/2013. dr. Brenda Casteleyn

Statistiek: Spreiding en dispersie 6/12/2013. dr. Brenda Casteleyn Statistiek: Spreiding en dispersie 6/12/2013 dr. Brenda Casteleyn dr. Brenda Casteleyn www.keu6.be Page 2 1. Theorie Met spreiding willen we in één getal uitdrukken hoe verspreid de gegevens zijn: in hoeveel

Nadere informatie

HOOFDSTUK VIII VARIANTIE ANALYSE (ANOVA)

HOOFDSTUK VIII VARIANTIE ANALYSE (ANOVA) HOOFDSTUK VIII VARIANTIE ANALYSE (ANOVA) DATA STRUKTUUR Afhankelijke variabele: Eén kontinue variabele Onafhankelijke variabele(n): - één discrete variabele: één gecontroleerde factor - twee discrete variabelen:

Nadere informatie

Derde serie opdrachten systeemtheorie

Derde serie opdrachten systeemtheorie Derde serie opdrachten systeemtheorie Opdracht 1. We bekijken een helicopter die ongeveer stilhangt in de lucht. Bij benadering kan zo n helicopter beschreven worden door het volgende stelsel vergelijkingen

Nadere informatie

Matrices en Stelsel Lineaire Vergelijkingen

Matrices en Stelsel Lineaire Vergelijkingen Complexe Getallen Wat is de modulus van een complex getal? Hoe deel je twee complexe getallen? Wat is de geconjugeerde van een complex getal? Hoe kan je z z ook schrijven? Wat is de vergelijking van een

Nadere informatie