Lijk in koffer, Ro-erdam 1927

Save this PDF as:
 WORD  PNG  TXT  JPG

Maat: px
Weergave met pagina beginnen:

Download "Lijk in koffer, Ro-erdam 1927"

Transcriptie

1 Lijk in koffer, Ro-erdam 1927

2 Prof. Dr. Peter de Knijff Forensisch Laboratorium voor DNA Onderzoek (FLDO) Afdeling Humane GeneNca LUMC en het Forensisch Genomisch ConsorNum Nederland (FGCN)

3 het begin van een zaak Ro-erdam, 1933 HOVO fdna onderzoek 3

4 vijf belangrijke vragen Zijn er biologische sporen aanwezig Wat is de cellulaire origine van deze biologische sporen Hoe oud zijn de biologische sporen Wie kan de bron van deze biologische sporen zijn Is er een relane tussen het misdrijf en de biologische sporen Vrijwel alnjd zal forensisch DNA onderzoek alleen informane kunnen verschaffen over de bron (donor) van de biologische sporen. Zelden kan het op zichzelf - zonder enige twijfel de schuldvraag beantwoorden. HOVO fdna onderzoek 4

5 bronnen van DNA Lichaamsvloeistoffen (sperma, bloed, speeksel, urine) Haren Biologische contactsporen Meestal heel weinig cellen Meestal huidcellen, maar bron zelden te achterhalen Zelden met blote oog zichtbaar (nog met andere hulpmiddelen) Voornaamste bron van besmezng is de plaats van het misdrijf. HOVO fdna onderzoek 5

6 dus niet zo HOVO fdna onderzoek 6

7 maar zo HOVO fdna onderzoek 7

8 ons DNA 1- CTAGATCGATATCGCTAGCTAGCTAGTGGGTTTCCGGAATCGATATAGCGC ATCTGCCTGGGTAGCTAGCTAGCTAGCTAGGTTCTACGTATCATCGGATAG CGTTCTTATTTCTTGGAATTAAAGGCCCTTTTACATATACATATAGCTCTAGA GCTCTATTCTCGCGTTAAAGGCCTAGATCGATAGCTTCTCGAGAGATATAG CGATAGCTCTAGATCGATCCTAGATCGATATCGCTAGCTAGCTAGTGGGTTT CCGGAATCGATATAGCGCTCTGGGA t/m HOVO fdna onderzoek 8

9 welke DNA kenmerken CTAGATCGATATCGCTAGCTAGCTAGTGGGTTTCCGGAATCGATATAGCGC ATCTGCCTGGGTAGCTAGCTAGCTAGCTAGGTTCTACGTATCATCGGATAG CGTTCTTATTTCTTGGAATTAAAGGCCCTTTTACATATACATATAGCTCTAGA GCTCTATTCTCGCGTTAAAGGCCTAGATCGATAGCTTCTCGAGAGATATAG CGATAGCTCTAGATCGATCCTAGATCGATATCGCTAGCTAGCTAGTGGGTTT CCGGAATCGATATAGCGCTCTGGGA CTAGATCGATATCGCTAGCTAGCTAGTGGGTTTCCGGAATCGATATAGCGC ATCTGCCTGGGTAGCTAGCTAGCTAGCTAGGTTCTACGTATCATCGGATAG CGTTCTTATTTCTTGGAATTAAAGGCCCTTTTACATATACATATAGCTCTAGA GCTCTATTCTCGCGTTAAAGGCCTAGATCGATAGCTTCTCGAGAGATATAG CGATAGCTCTAGATCGATCCTAGATCGATATCGCTAGCTAGCTAGTGGGTTT CCGGAATCGATATAGCGCTCTGGGA ATCTGCCTGGGTAG CTAG CTAG CTAG CTAG GTTCTACGTATCATCGGATAG ATCTGCCTGGGTAG CTAG CTAG GTTCTACGTATCATCGGATAG HOVO fdna onderzoek 9

10 meten van variane in lengte ATCTGCCTGGGTAG CTAG CTAG CTAG CTAG GTTCTACGTATCATCGGATAG ATCTGCCTGGGTAG CTAG CTAG GTTCTACGTATCATCGGATAG 2 4 kort Lang HOVO fdna onderzoek 10

11 schema huidige analyse X HOVO fdna onderzoek 11

12 schema huidige analyse X HOVO fdna onderzoek 12

13 de basis: een Powerplex- 16 profiel HOVO fdna onderzoek 13

14 allelen ladder HOVO fdna onderzoek 14

15 mogelijke problemen enkelvoudig gemengd 50/50 gemengd 70/30 gemengd 90/10 gemengd 90/10 PCR PCR PCR PCR PCR HOVO fdna onderzoek 15

16 kort schemansch overzicht Biologisch Monster Plaats Delict Wangslijmvliesmonster Verdachte Ro-erdam, 1948 DNA profielen Leiden, 2008 Profielen komen overeen: StaNsNek Profielen komen niet overeen: Verdachte uitgesloten HOVO fdna onderzoek 16

17 een eenvoudig voorbeeld Ro-erdam, 1966 HOVO fdna onderzoek 17

18 eenvoudig voorbeeld Allelen Slo mes Vd HOVO fdna onderzoek 18

19 eenvoudig voorbeeld Allelen Slo mes Vd 1 op 100 (0.01) x 1 op 14 (0.07) x 1 op 81 (0.012) = op 113,400 Voor 15 kenmerken: 1 op 79,531,528,960,000,000 of 1 op ca. 80 quadrillion HOVO fdna onderzoek 19

20 hoe rapporteer je dit Het DNA profiel van het spoor komt volledig overeen met het DNA profiel van de verdachte. De verdachte kan de donor van het spoor zijn. De kans dat een willekeurig onverwante persoon hetzelfde DNA profiel heej als vastgesteld in het spoor is minder dan 1 op de miljard. (Maar, de kans dat een volle broer van de verdachte hetzelfde profiel heej als is vastgesteld in het spoor is ca. 1 op ). Let op! Nooit aannemen dat een zeldzaam profiel uniek is want HOVO fdna onderzoek 20

21 de tweeling valkuil Per 1000 geboortes in Nederland 18 tweelingen Hiervan 35 % MZ tweelingen (~ 6 /1000; 0.6%) FrequenNe tweelingen neemt toe (IVF) FrequenNe MZ tweelingen neemt relanef af Willekeurige kans op MZ ca. 1/160 Dus in theorie zou je per 200 volledig random gekozen mannen minimaal 1 MZ tweeling verwachten HOVO fdna onderzoek 21

22 gemengde DNA profielen Slachtoffer 1 Slachtoffer 2 Kauwgom Verdachte HOVO fdna onderzoek 22

23 conclusie gemengde DNA profielen In bemonstering van het stukje kauwgom is een gemengd DNA profiel bestaande uit 15 autosomale polymorfe DNA kenmerken aangetroffen welke apomsng is van minimaal twee personen. De DNA kenmerken van slachtoffer 1 en verdachte passen volledig binnen dit gemengde autosomale DNA profiel. Er zijn een aantal scenario s welke dit gemengde autosomale gemengde DNA profiel zouden kunnen verklaren. De meest logische zijn: A) Het gemengde DNA profiel kan worden verklaard door vermenging van celmateriaal van slachtoffer 1 en verdachte. B) Het gemengde DNA profiel kan worden verklaard door vermenging van celmateriaal van slachtoffer 1 een een willekeurig gekozen persoon met hetzelfde DNA profiel als verdachte. Onder scenario A zijn de bevindingen van het DNA onderzoek meer dan een miljard keer waarschijnlijker dan onder scenario B. (Scenario A lijkt hiermee dus de meest waarschijnlijke verklaring voor het aangetroffen gemengde DNA profiel in bemonstering van het stukje kauwgom) HOVO fdna onderzoek 23

24 een eenvoudig gemengd DNA profiel VicNm Suspect Ch.gum HOVO fdna onderzoek 24

25 een eenvoudig gemengd DNA profiel VicNm Suspect Ch.gum Ch.gum HOVO fdna onderzoek 25

26 DNA Onderzoek Bij Misdrijven wat als het moeilijk wordt Ro-erdam, 1939 HOVO fdna onderzoek december 2011

27 Volledig DNA profiel posideve controle (1ng) DNA Onderzoek Bij Misdrijven uiterst zwakke DNA profielen HOVO fdna onderzoek 27

28 uiterst zwakke DNA profielen HOVO fdna onderzoek 28

29 uiterst zwakke DNA profielen HOVO fdna onderzoek 29

30 low- template DNA: LCN Reference 28 cycles 5 cells 34 cycles HOVO fdna onderzoek 30

31 een regelmang gerapporteerde doodzonde Stain Suspect HOVO fdna onderzoek 31

32 een regelmang gerapporteerde doodzonde Stain Stain Suspect HOVO fdna onderzoek 32

33 een regelmang gerapporteerde doodzonde Stain Stain Suspect HOVO fdna onderzoek 33

34 een regelmang gerapporteerde doodzonde Stain Stain Stain1+Stain Suspect HOVO fdna onderzoek 34

35 onmogelijke sporen Ro-erdam, 1943 HOVO fdna onderzoek 35

36 Normaal STR profiel DNA Onderzoek Bij Misdrijven onmogelijke sporen Nagelvuil Slachtoffer (vrouw) HOVO fdna onderzoek 36

37 Y- kenmerken: specifiek voor mannen Karyogram man 46XY Karyogram vrouw: 46XX HOVO fdna onderzoek 37

38 Y- STR profiel HOVO fdna onderzoek 38

39 overerving Y- chromosoom HOVO fdna onderzoek 39

40 overerving Y- chromosoom HOVO fdna onderzoek 40

41 Normaal STR profiel DNA Onderzoek Bij Misdrijven toch een oplossing? Nagelvuil Slachtoffer (vrouw) Y- STR profiel Verdachte (man) HOVO fdna onderzoek 41

42 match stansnek HOVO fdna onderzoek 42

43 data in de Y- HRD HOVO fdna onderzoek 43

44 wat te doen met een Y- STR match HOVO fdna onderzoek 44

45 verspreiding van de hits HOVO fdna onderzoek 45

46 nietszeggende stansnek? Global frequency: 0.34 % (330 / ) or 1 in 295 European frequency: 0.37 % (143 / 39017) or 1 in 272 HOVO fdna onderzoek 46

47 het blijj binnen de familie = overleden = verdachte HOVO fdna onderzoek 47

48 nietszeggende stansnek? Global frequency: 0.34 % (330 / ) or 1 in 295 European frequency: 0.37 % (143 / 39017) or 1 in 272 Dutch frequency: 0.53 % (11 / 2085) or 1 in Regional frequency: 0.71 % or 1 in 170) Local frequency (based on surname): % or 1 in 4500 HOVO fdna onderzoek 48

49 aantal conclusies Vereist zeer secuur werk in het veld en in het lab Stricte handhaving van protocollen InterpretaNe vaak subjecnef, zelden absolute zekerheid Rapportage alleen mogelijk na gedegen populane genensche kennisvergaring Gebruikte stansnek ogenschijnlijk simpel maar met veel valkuilen Veel sporen zijn moeilijk met zekerheid te analyseren RelevanNe van de sporen vaak onduidelijk HOVO fdna onderzoek 49

50 wat als het moeilijk wordt HOVO fdna onderzoek 50

naar sporen Forensisch expert worden

naar sporen Forensisch expert worden Speuren B naar sporen Forensisch expert worden 3. Vaststellen identiteit Deze les ga je je verdiepen in één specifiek forensisch onderzoeksgebied. Je wordt als het ware zelf een beetje forensisch expert.

Nadere informatie

De Essenties van forensisch DNA-onderzoek. Samenvatting interpretatie DNA-bewijs

De Essenties van forensisch DNA-onderzoek. Samenvatting interpretatie DNA-bewijs EDERLA DSFORE SISCHIN TITUUT De Essenties van forensisch DNA-onderzoek Samenvatting interpretatie DNA-bewijs 2007 Nederlands Forensisch Instituut Alle rechten voorbehouden. Niets uit deze uitgave mag worden

Nadere informatie

Development of RNA Profiling Tools and the Implementation in Forensic Casework P.A. Lindenbergh

Development of RNA Profiling Tools and the Implementation in Forensic Casework P.A. Lindenbergh Development of RNA Profiling Tools and the Implementation in Forensic Casework P.A. Lindenbergh Nederlandse Samenvatting Binnen het huidige forensische onderzoek wordt genetische informatie in toenemende

Nadere informatie

Honden en Katten als Stille Getuigen. Daniëlle Hoogmoed, MSc.

Honden en Katten als Stille Getuigen. Daniëlle Hoogmoed, MSc. Honden en Katten als Stille Getuigen Daniëlle Hoogmoed, MSc. State of Washington versus Kenneth Leuluaialii and George Tuilefano, 1996 Een echtpaar en hun hond dood aangetroffen in de woning. De politie

Nadere informatie

DNA onderzoek in Gerechtszaken 1 oktober 2008

DNA onderzoek in Gerechtszaken 1 oktober 2008 DNA onderzoek in Gerechtszaken 1 oktober 2008 Jean-Jacques Cassiman Leuvens Instituut voor Forensische Geneeskunde UZ Leuven Kern DNA CME 06 mrna: 3% of the DNA Protein ncrna:? % of the DNA Gene regulation

Nadere informatie

Het DNA-profiel HOOFDSTUK 6. De berekende frequentie van voorkomen van DNA-profielen van tien of meer loci is altijd kleiner dan één op één miljard.

Het DNA-profiel HOOFDSTUK 6. De berekende frequentie van voorkomen van DNA-profielen van tien of meer loci is altijd kleiner dan één op één miljard. Het DNA-profiel HOOFDSTUK 6 De berekende frequentie van voorkomen van DNA-profielen van tien of meer loci is altijd kleiner dan één op één miljard. 135 136 13 Inhoudsopgave DNA 139 Elke cel hetzelfde DNA

Nadere informatie

De Essenties van forensisch DNA-onderzoek. 10 Begrippen

De Essenties van forensisch DNA-onderzoek. 10 Begrippen EDERLA DSFORE SISCHIN TITUUT De Essenties van forensisch DNA-onderzoek 10 Begrippen 2007 Nederlands Forensisch Instituut Alle rechten voorbehouden. Niets uit deze uitgave mag worden verveelvoudigd, opgeslagen

Nadere informatie

Forensisch onderzoek. Ingmar de Heiden Forensische opsporing Amsterdam

Forensisch onderzoek. Ingmar de Heiden Forensische opsporing Amsterdam Forensisch onderzoek Ingmar de Heiden Forensische opsporing Amsterdam Inhoud Wat is forensisch onderzoek? Rol van de forensische opsporing Forensische onderzoeksmogelijkheden Gebruik van verpakkingsmateriaal

Nadere informatie

Klinische Genetica. Autosomaal dominante overerving

Klinische Genetica. Autosomaal dominante overerving Klinische Genetica Autosomaal dominante overerving Klinische Genetica U bent (of uw kind is) doorverwezen naar de polikliniek Klinische Genetica. Tijdens de eerste afspraak legt een klinisch geneticus

Nadere informatie

Downloaded from UvA-DARE, the institutional repository of the University of Amsterdam (UvA) http://hdl.handle.net/11245/2.103565

Downloaded from UvA-DARE, the institutional repository of the University of Amsterdam (UvA) http://hdl.handle.net/11245/2.103565 Downloaded from UvA-DARE, the institutional repository of the University of Amsterdam (UvA) http://hdl.handle.net/11245/2.103565 File ID Filename Version uvapub:103565 Samenvatting unknown SOURCE (OR PART

Nadere informatie

Bewijsvoering op basis van DNA-profielen en -databases

Bewijsvoering op basis van DNA-profielen en -databases 39 Bewijsvoering op basis van DNA-profielen en -databases P. de Knijff* Sinds 1 september 1994 is in Nederland het gebruik van DNA ten behoeve van misdaadbestrijding bij wet vastgelegd. Na een aanpassing

Nadere informatie

Leidraad en praktische handvatten voor de jurist bij het doorgronden van conclusies forensisch DNA-onderzoek

Leidraad en praktische handvatten voor de jurist bij het doorgronden van conclusies forensisch DNA-onderzoek Drs. A.J. Meulenbroek* Leidraad en praktische handvatten voor de jurist bij het doorgronden van conclusies forensisch DNA-onderzoek Met de onverminderd snelle ontwikkelingen in de DNA-technologie nemen

Nadere informatie

Klinische Genetica. Autosomaal recessieve overerving

Klinische Genetica. Autosomaal recessieve overerving Klinische Genetica Autosomaal recessieve overerving Klinische Genetica U of uw kind is doorverwezen naar de polikliniek Klinische Genetica. Tijdens de afspraak legt een klinisch geneticus of een genetisch

Nadere informatie

De Essenties van forensisch DNA-onderzoek. 4 Forensisch onderzoek en bewijswaarde van biologische contactsporen

De Essenties van forensisch DNA-onderzoek. 4 Forensisch onderzoek en bewijswaarde van biologische contactsporen EDERLA DSFORE SISCHIN TITUUT De Essenties van forensisch DNA-onderzoek 4 Forensisch onderzoek en bewijswaarde van biologische contactsporen 2007 Nederlands Forensisch Instituut Alle rechten voorbehouden.

Nadere informatie

Figuur 1. Foto van de gevonden jas.

Figuur 1. Foto van de gevonden jas. Stille getuigen Introductie In het practicum Puzzelen met pieken heb je kennis gemaakt met verschillende forensische technieken tijdens het oplossen van een overval. In deze les ga je aan de slag met een

Nadere informatie

Knoops & Partners Advocaten Amsterdam HOGE RAAD DER NEDERLANDEN

Knoops & Partners Advocaten Amsterdam HOGE RAAD DER NEDERLANDEN Aanvulling Verzoek tot Herziening (ART. 457 Sv.) HOGE RAAD DER NEDERLANDEN Geeft eerbiedig te kennen: Ernest Cornelis Jacobus Johannes LOUWES, geboren te op 13 augustus 1953, thans gedetineerd in de Penitentiaire

Nadere informatie

De niet gevonden vlekken

De niet gevonden vlekken De niet gevonden vlekken De DNA-bevindingen Op 9 februari 2004 wordt Ernest Louwes tijdens het herzieningsproces in Den Bosch wederom tot 12 jaar veroordeeld. De cruciale rol bij deze veroordeling spelen

Nadere informatie

DNA-profiling. ir. H.J.T. Janssen Gerechtelijk Laboratorium van het Ministerie van Justitie, Rijswijk

DNA-profiling. ir. H.J.T. Janssen Gerechtelijk Laboratorium van het Ministerie van Justitie, Rijswijk 127 1 DNA-profiling ir. H.J.T. Janssen Gerechtelijk Laboratorium van het Ministerie van Justitie, Rijswijk 1. Inleiding 127 3 2. DNA-eigenschappen 127 3 3. DNA-vermeerderingstechniek (PCR) 127 4 4. Analyse

Nadere informatie

Registratie-eisen en toetsingsprocedure Humane DNA-analyse en -interpretatie 001.1. Versie 1.1 (Juli 2010)

Registratie-eisen en toetsingsprocedure Humane DNA-analyse en -interpretatie 001.1. Versie 1.1 (Juli 2010) Humane DNA-analyse en -interpretatie 001.1 Versie 1.1 (Juli 2010) Registratie-eisen en toetsingsprocedure Humane DNA-analyse en - interpretatie De kwaliteitseisen geformuleerd in het tweede lid van artikel

Nadere informatie

Complexe DNA-profielen

Complexe DNA-profielen Complexe DNA-profielen Inleiding Bij een DNA-onderzoek worden DNA-profielen bepaald en met elkaar vergeleken. Bij forensisch DNA-onderzoek wordt bijvoorbeeld een DNA-profiel van een verdachte vergeleken

Nadere informatie

Algemene aspecten van erfelijkheid. Waarom is kennis over erfelijke aspecten van een ziekte belangrijk? Wanneer erfelijkheidsadvies/onderzoek?

Algemene aspecten van erfelijkheid. Waarom is kennis over erfelijke aspecten van een ziekte belangrijk? Wanneer erfelijkheidsadvies/onderzoek? Erfelijke nierziekten: algemene aspecten van erfelijkheid, overerving en erfelijkheidsadvies Nine Knoers Klinisch Geneticus Commissie Erfelijke Nierziekten NVN 4 november 2006 HUMAN GENETICS NIJMEGEN Inhoud

Nadere informatie

EDERLA DSFORE SISCHIN TITUUT

EDERLA DSFORE SISCHIN TITUUT EDERL DSFORE SISHIN IUU De Essenties van forensisch DN-onderzoek 5 Het DN-profiel 2006 Nederlands Forensisch Instituut lle rechten voorbehouden. Niets uit deze uitgave mag worden verveelvoudigd, opgeslagen

Nadere informatie

De Essenties van forensisch DNA-onderzoek. 2 Forensisch onderzoek van sporen van lichaamsvloeistoffen

De Essenties van forensisch DNA-onderzoek. 2 Forensisch onderzoek van sporen van lichaamsvloeistoffen EDERLA DSFORE SISCHIN TITUUT De Essenties van forensisch DNA-onderzoek 2 Forensisch onderzoek van sporen van lichaamsvloeistoffen 2007 Nederlands Forensisch Instituut Alle rechten voorbehouden. Niets uit

Nadere informatie

Adviescommissie afgesloten strafzaken Postbus 20303 2500 EH Den Haag

Adviescommissie afgesloten strafzaken Postbus 20303 2500 EH Den Haag Adviescommissie afgesloten strafzaken Postbus 20303 2500 EH Den Haag Bezoekadres: Lange Voorhout 7 2514 EA Den Haag Zaak [verzoeker] (ACAS 020) Beknopt relaas van de feiten Op 20 januari 2010 wordt de

Nadere informatie

De Essenties van forensisch DNA-onderzoek. 7 Interpretatie van DNA-bewijs II

De Essenties van forensisch DNA-onderzoek. 7 Interpretatie van DNA-bewijs II EDERLA DSFORE SISCHIN TITUUT De Essenties van forensisch DNA-onderzoek 7 Interpretatie van DNA-bewijs II onvolledige DNA-profielen en DNA-mengprofielen 2007 Nederlands Forensisch Instituut Alle rechten

Nadere informatie

Postadres Postbus 3110, 2280 GO Rijswijk

Postadres Postbus 3110, 2280 GO Rijswijk Deskundigenrapport M in i s t e rie v an Jus t it ie Nederlands Forensisch Instituut Postadres Postbus 3110, 2280 GO Rijswijk Aanvrager Ressortparket in 's-hertogenbosch Bezoekadres Volmerlaan 17 2288

Nadere informatie

De Essenties van forensisch DNA-onderzoek. 3 Morfologisch en DNA-onderzoek van haren

De Essenties van forensisch DNA-onderzoek. 3 Morfologisch en DNA-onderzoek van haren EDERLA DSFORE SISCHIN TITUUT De Essenties van forensisch DNA-onderzoek 3 Morfologisch en DNA-onderzoek van haren 2007 Nederlands Forensisch Instituut Alle rechten voorbehouden. Niets uit deze uitgave mag

Nadere informatie

DNA-onderzoek van minimale biologische sporen; gevoelige problematiek

DNA-onderzoek van minimale biologische sporen; gevoelige problematiek PROF. DR. A.D. KLOOSTERMAN EN DRS. A.J. MEULENBROEK * DNA-onderzoek van minimale biologische sporen; gevoelige problematiek Het standaard forensisch DNA-onderzoek is één van de meest onderzochte, robuuste

Nadere informatie

Verdieping: DNA alleen onvoldoende bewijs

Verdieping: DNA alleen onvoldoende bewijs Verdieping: DNA alleen onvoldoende bewijs Korte omschrijving werkvorm: De leerlingen luisteren naar een radiofragment van Goedemorgen Nederland en lezen een tekst uit dagblad Trouw over de bewijsvoering

Nadere informatie

De Essenties van forensisch DNA-onderzoek. 6 Interpretatie van DNA-bewijs I

De Essenties van forensisch DNA-onderzoek. 6 Interpretatie van DNA-bewijs I EDERLA DSFORE SISCHIN TITUUT De Essenties van forensisch DNA-onderzoek 6 Interpretatie van DNA-bewijs I match en berekende frequentie 2007 Nederlands Forensisch Instituut Alle rechten voorbehouden. Niets

Nadere informatie

De Essenties van forensisch DNA-onderzoek. 5 Het DNA-profiel

De Essenties van forensisch DNA-onderzoek. 5 Het DNA-profiel EDERL DSFORE SISHIN IUU De Essenties van forensisch DN-onderzoek 5 Het DN-profiel 2007 Nederlands Forensisch Instituut lle rechten voorbehouden. Niets uit deze uitgave mag worden verveelvoudigd, opgeslagen

Nadere informatie

Bewijskracht van onderzoek naar biologische sporen en DNA

Bewijskracht van onderzoek naar biologische sporen en DNA Bas Kokshoorn, Bart Aarts, Jord Nagel en Jerien Koopman* Bewijskracht van onderzoek naar biologische sporen en DNA Deel 2. Bronniveau Dit is het tweede deel van een drieluik waarin de theorie voor criminalistische

Nadere informatie

H. DNA-vingerafdrukken. CC Naamsvermelding-GelijkDelen 3.0 Nederland licentie.

H. DNA-vingerafdrukken. CC Naamsvermelding-GelijkDelen 3.0 Nederland licentie. Auteurs Its Academy Laatst gewijzigd Licentie Webadres 08 May 2015 CC Naamsvermelding-GelijkDelen 3.0 Nederland licentie http://maken.wikiwijs.nl/40624 Dit lesmateriaal is gemaakt met Wikiwijs Maken van

Nadere informatie

De Minister van Justitie

De Minister van Justitie POSTADRES Postbus 93374, 2509 AJ Den Haag BEZOEKADRES Juliana van Stolberglaan 4-10 TEL 070-88 88 500 FAX 070-88 88 501 E-MAIL info@cbpweb.nl INTERNET www.cbpweb.nl AAN De Minister van Justitie DATUM 18

Nadere informatie

leerlinghandleiding Afsluitende module Complexe DNA-profielen

leerlinghandleiding Afsluitende module Complexe DNA-profielen leerlinghandleiding Afsluitende module Complexe DNA-profielen Ontwikkeld door het Forensic Genomics Consortium Netherlands in samenwerking met Its Academy Tekst Melanie Rosenhart Vormgeving Identim, Wageningen

Nadere informatie

Inleiding. Achtergrond van het DNA-onderzoek

Inleiding. Achtergrond van het DNA-onderzoek 6 Inleiding naar biologisch vaderschap, moederschap, ouderschap of andere familierelaties kan worden uitgevoerd wanneer er verschil van mening of twijfel bestaat omtrent de biologische verwantschap. Bijvoorbeeld

Nadere informatie

Leerlingenhandleiding

Leerlingenhandleiding Leerlingenhandleiding Afsluitende module Wie van de drie? Ontwikkeld door het Forensic Genomics Consortium Netherlands (opgeheven in 2013) in samenwerking met Its Academy en de Faculteit der Natuurwetenschappen,

Nadere informatie

over Darwin en genomics

over Darwin en genomics C C. Veranderingen in DNA Je gaat nu zelf onderzoek doen op basis van gegevens van het Forensisch Laboratorium voor DNA Onderzoek. Prof. dr. Peter de Knijff, die als geneticus bij dat laboratorium werkt,

Nadere informatie

De Essenties van forensisch DNA-onderzoek. 8 Interpretatie van DNA-bewijs III

De Essenties van forensisch DNA-onderzoek. 8 Interpretatie van DNA-bewijs III EDERLA DSFORE SISCHIN TITUUT De Essenties van forensisch DNA-onderzoek 8 Interpretatie van DNA-bewijs III de context van de berekende frequentie 2007 Nederlands Forensisch Instituut Alle rechten voorbehouden.

Nadere informatie

Lief Dagboek, 11 augustus Harry kwam opeens opdagen en ik liet hem het eiland zien. Hij is zo lief en begripvol. Ik kon het niet helpen en

Lief Dagboek, 11 augustus Harry kwam opeens opdagen en ik liet hem het eiland zien. Hij is zo lief en begripvol. Ik kon het niet helpen en Wie van de drie? Introductie De twintigjarige Sophie weet niet wie haar vader is. Het enige dat ze over haar vader weet, is dat het een zomerliefde van haar moeder Donna was en dat hij weg was voordat

Nadere informatie

Klinische Genetica. Geslachtsgebonden (X-chromosoom gebonden) recessieve overerving

Klinische Genetica. Geslachtsgebonden (X-chromosoom gebonden) recessieve overerving Klinische Genetica Geslachtsgebonden (X-chromosoom gebonden) recessieve overerving Klinische Genetica Bij uw bezoek aan de polikliniek Klinische Genetica heeft de klinisch geneticus of een genetisch consulent

Nadere informatie

26 januari Hoe gaat het er in Nederland aan toe? Nederlandse DNA-databank voor Stafzaken (I) Nederlandse DNA-databank voor Stafzaken (II)

26 januari Hoe gaat het er in Nederland aan toe? Nederlandse DNA-databank voor Stafzaken (I) Nederlandse DNA-databank voor Stafzaken (II) Hoe gaat het er in Nederland aan toe? Dr.Ir. C.P. (Kees) van der Beek MBA Beheerder Nederlandse DNA-databank voor strafzaken Brussel 26 januari 2012 Nederlandse DNA-databank voor Stafzaken (I) Op te nemen

Nadere informatie

Leerlinghandleiding. Afsluitende module. Wie van de drie?

Leerlinghandleiding. Afsluitende module. Wie van de drie? Leerlinghandleiding Afsluitende module Wie van de drie? Ontwikkeld door het Forensic Genomics Consortium Netherlands in samenwerking met Its Academy Tekst Gerrianne Koeman - van der Velde, Dianne Hamerpagt,

Nadere informatie

FORENSISCH DNA-ONDERZOEK VOORBEREIDENDE LES

FORENSISCH DNA-ONDERZOEK VOORBEREIDENDE LES FORENSISCH DNA-ONDERZOEK VOORBEREIDENDE LES Melanie Rosenhart werkt bij het Nederlands Forensisch Instituut (NFI). Bij het NFI werken wetenschappers die allerlei vragen proberen te beantwoorden die met

Nadere informatie

Voedselallergie wat doen wij hier in het UMCG aan onderzoek?

Voedselallergie wat doen wij hier in het UMCG aan onderzoek? Thema: Voedselallergie wat doen wij hier in het UMCG aan onderzoek? Prof. dr. Cisca Wijmenga Afdeling Genetica UMCG 11/19/13 2 11/19/13 3 Waarom zou je onderzoek willen doen? Belangrijke vragen: Hoe ontstaat

Nadere informatie

De crimescope positieve vlekken en het lijkvocht

De crimescope positieve vlekken en het lijkvocht De crimescope positieve vlekken en het lijkvocht Samenvatting De veroordeling van Ernest Louwes door de rechtbank van Den Bosch was voornamelijk gebaseerd op Ing. Eikelenboom s argumenten m.b.t. de herkomst

Nadere informatie

DNA in de forensische diagnostiek

DNA in de forensische diagnostiek DNA in de forensische diagnostiek Ate Kloosterman 22 maart 2012 Rotterdam de Doelen NFI Humane Biologische Sporen (HBS) & WISK UvA Forensische Biologie 2 Welkom De impact van forensisch DNA! Puttense moordzaak

Nadere informatie

Rol van automatisering bij DNA-onderzoek ter identificatie van slachtoffers van de MH17 ramp. Sander Kneppers Hoofd DNA Profileringslaboratorium

Rol van automatisering bij DNA-onderzoek ter identificatie van slachtoffers van de MH17 ramp. Sander Kneppers Hoofd DNA Profileringslaboratorium Rol van automatisering bij DNA-onderzoek ter identificatie van slachtoffers van de MH17 ramp Sander Kneppers Hoofd DNA Profileringslaboratorium 20 31 februari maart 2015 2014 MH17 Nationaliteit slachtoffers

Nadere informatie

VIII NIEUW FORENSISCH-TECHNISCH FEIT: DE PIEKENPROFIELEN EN IMPACT OP BEWIJSCONSTRUCTIE HOF

VIII NIEUW FORENSISCH-TECHNISCH FEIT: DE PIEKENPROFIELEN EN IMPACT OP BEWIJSCONSTRUCTIE HOF VIII NIEUW FORENSISCH-TECHNISCH FEIT: DE PIEKENPROFIELEN EN IMPACT OP BEWIJSCONSTRUCTIE HOF 1. Een vijfde novum in forensisch-technische zin wordt gevormd door het volgende feit. Zoals hiervoor aangetoond

Nadere informatie

Monitoring aquatische biodiversiteit met DNA barcoding veelbelovend

Monitoring aquatische biodiversiteit met DNA barcoding veelbelovend Monitoring aquatische biodiversiteit met DNA barcoding veelbelovend Waterkwaliteit op de kaart II Berry van der Hoorn, Naturalis Michiel Hootsmans, KRW Watercycle centre Roel Knoben, RHDHV 8 oktober 2015

Nadere informatie

DNA-onderzoek bij veroordeelden

DNA-onderzoek bij veroordeelden Regelingen en voorzieningen CODE 6.5.2.3 DNA-onderzoek bij veroordeelden algemene informatie bronnen ministerie van Veiligheid en Justitie: www.rijksoverheid.nl, januari 2011 brochure de wet DNA-onderzoek

Nadere informatie

DNA-lab dag. 9 maart 2012. Forensisch DNA-onderzoek: Puzzelen met pieken

DNA-lab dag. 9 maart 2012. Forensisch DNA-onderzoek: Puzzelen met pieken DNA-lab dag 9 maart 2012 Forensisch DNA-onderzoek: Puzzelen met pieken Forensisch DNA-onderzoek: puzzelen met pieken Niveau Vak Leerdoelen Aansluitend bij Benodigde voorkennis indien apart gebruikt Bovenbouw

Nadere informatie

Genetica van hemochromatose

Genetica van hemochromatose Genetica van hemochromatose 28-11-2015 Prof.Dr. M.H. Breuning, klinisch geneticus M.H.Breuning@lumc.nl Wat is ijzer? Twee oxidatietoestanden: Fe 2+ Fe 3+ (divalent) (trivalent) IJzer is noodzakelijk voor

Nadere informatie

Informatiebrochure. Over DNA-onderzoek. 10 jaar Forensisch DNA-laboratorium UZA

Informatiebrochure. Over DNA-onderzoek. 10 jaar Forensisch DNA-laboratorium UZA Informatiebrochure Over DNA-onderzoek 10 jaar Forensisch DNA-laboratorium UZA 1. DNA in ons lichaam...4 1.1 Erfelijk materiaal...4 1.2 Uniek voor alle wezens...4 1.3 Identiek in alle cellen...4 2. DNA

Nadere informatie

Reactie op de microsporenfolie-brief van het Openbaar Ministerie, dd. 29 juli 2008

Reactie op de microsporenfolie-brief van het Openbaar Ministerie, dd. 29 juli 2008 Reactie op de microsporenfolie-brief van het Openbaar Ministerie, dd. 29 juli 2008 1. Inleiding Op 25 april 2008 heeft de verdediging van Ernest Louwes vragen gesteld aan het Openbaar Ministerie met betrekking

Nadere informatie

Tweede Kamer der Staten-Generaal

Tweede Kamer der Staten-Generaal Tweede Kamer der Staten-Generaal 2 Vergaderjaar 2005 2006 30 300 VI Vaststelling van de begrotingsstaten van het Ministerie van Justitie (VI) voor het jaar 2006 Nr. 71 VERSLAG VAN EEN SCHRIFTELIJK OVERLEG

Nadere informatie

Environmental DNA Ontwikkelingen en mogelijkheden

Environmental DNA Ontwikkelingen en mogelijkheden Environmental DNA Ontwikkelingen en mogelijkheden Jelger Herder Nijmegen, 21 maart 2013 Veel soorten zijn lastig te vinden Grote modderkruiper Verlandende vegetaties Verstopt zich bij gevaar in de modder

Nadere informatie

naar sporen Over speurders en sporen

naar sporen Over speurders en sporen A Speuren naar sporen Over speurders en sporen Je hebt misschien wel eens een aflevering van CSI gezien. In deze serie zie je forensisch onderzoekers aan het werk, die op allerlei manieren proberen om

Nadere informatie

Over grootschalig DNA - verwantschapsonderzoek

Over grootschalig DNA - verwantschapsonderzoek Over grootschalig DNA - verwantschapsonderzoek DNA-verwantschaps-onderzoek kan de moord op Marianne Vaatstra oplossen DNA-verwantschapsonderzoek kan de moord op Marianne Vaatstra oplossen Op 1 mei 1999

Nadere informatie

28 Testkruising testkruising = een kruising om te achterhalen of een organisme homozygoot of heterozygoot is. Voorbeeld van een testkruising om te bepalen of een organisme homozygoot of heterozygoot is

Nadere informatie

DNA als gerechtelijk bewijsmateriaal

DNA als gerechtelijk bewijsmateriaal DNA als gerechtelijk bewijsmateriaal DRS. Ate D. KloosterMan NEDERLANDS FORENSISCH INSTITUUT DNA als gerechtelijk bewijsmateriaal Drs. Ate D. Kloosterman Nederlands Forensisch Instituut (NFI) Volmerlaan

Nadere informatie

Copyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

Copyright 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings De meeste organismen hebben een twee sets chromosomen, met daarop informatie voor alle eigenschappen van dat organisme (diploid) Deze erfelijke informatie noemen we het genotype Hoe deze erfelijke informatie

Nadere informatie

5 plaatsen vingerafdrukken; laptop weg, mobiele telefoon weg, auto weg.

5 plaatsen vingerafdrukken; laptop weg, mobiele telefoon weg, auto weg. PD 1: 5 plaatsen vingerafdrukken; laptop weg, mobiele telefoon weg, auto weg. 12 vingerafdrukken 4 verschillende afdrukken. 1: Huiseigenaar (2 goeie vingerafdrukken) 2: Schoonmaakster (2 goeie vingerafdrukken)

Nadere informatie

DNA-verwantschapsonderzoek in de strafrechtpraktijk

DNA-verwantschapsonderzoek in de strafrechtpraktijk Drs. A.J. Meulenbroek, dr. K. Slooten, mr. D.J.C. Aben, drs. C. van Kooten en dr. A.J. Kal* DNA-verwantschapsonderzoek in de strafrechtpraktijk Op 1 april 2012 is nieuwe DNA-wetgeving in het strafrecht

Nadere informatie

Kennislink.nl. Reizende criminelen langer uit handen van de politie. Slechts kwart van misdrijven opgehelderd

Kennislink.nl. Reizende criminelen langer uit handen van de politie. Slechts kwart van misdrijven opgehelderd Kennislink.nl Discussieer mee: Allemaal de beste van de klas?! Onderwerpen Publicaties Over Kennislink Nieuwsbrief Zoek Leven, Aarde & Heelal Gezondheid, Hersenen & Gedrag Mens & Maatschappij Energie &

Nadere informatie

Duitse plannen om koninginnen te selecteren op grond van hun DNA

Duitse plannen om koninginnen te selecteren op grond van hun DNA Duitse plannen om koninginnen te selecteren op grond van hun DNA Pim Brascamp Koninginnenteeltdag 28 januari 2017 Bronnen: Spötter e.a. en lezingen van Prof Bienefeld in Celle (2015) en Mayen (2016) Stuur

Nadere informatie

Het HLA-systeem De relatie tussen HLA en bloedtransfusie

Het HLA-systeem De relatie tussen HLA en bloedtransfusie Het HLA-systeem De relatie tussen HLA en bloedtransfusie HLA, Ig-allotypen en erytrocytenbloedgroepen De werking van ons immuunsysteem is gebaseerd op het vermogen om onderscheid te maken tussen eigen

Nadere informatie

Leerlingenhandleiding

Leerlingenhandleiding Leerlingenhandleiding Inleidende les + werkbladen Forensisch DNA-onderzoek: Puzzelen met pieken Ontwikkeld door het Forensic Genomics Consortium Netherlands in samenwerking met Its Academy Tekst Gerrianne

Nadere informatie

Welke van de bovenstaande celorganellen of levensprocessen kunnen zowel in prokaryote, als in eukaryote cellen voorkomen?

Welke van de bovenstaande celorganellen of levensprocessen kunnen zowel in prokaryote, als in eukaryote cellen voorkomen? Biologie Vraag 1 Celorganellen en levensprocessen bij levende cellen zijn: 1. Ribosomen 2. ATP synthese 5. DNA polymerase 3. Celmembranen 6. Fotosynthese 4. Kernmembraan 7. Mitochondria Welke van de bovenstaande

Nadere informatie

Figuur 1: schematische weergave van een cel

Figuur 1: schematische weergave van een cel Inleiding De titel van het proefschrift is Preventing the transmission of mitochondrial diseases. Dat wil zeggen: het tegengaan dat mitochondriële ziekten worden doorgegeven aan het nageslacht. Mitochondriën

Nadere informatie

Zijn wij familie? DNA verwantschapsonderzoek

Zijn wij familie? DNA verwantschapsonderzoek Zijn wij familie? DNA verwantschapsonderzoek 2 Als er twijfels bestaan over biologisch vaderschap of andere familierelaties, dan kan een DNA test hierover uitsluitsel bieden. Deze testen worden door het

Nadere informatie

Informatie voor nabestaanden. Gerechtelijke sectie bij het Nederlands Forensisch Instituut

Informatie voor nabestaanden. Gerechtelijke sectie bij het Nederlands Forensisch Instituut Informatie voor nabestaanden Gerechtelijke sectie bij het Nederlands Forensisch Instituut Inhoud Gerechtelijke sectie 4 Beslissing tot sectie 4 Het onderzoek bij een sectie 5 Resultaten van een sectie

Nadere informatie

Genetische testen en gezondheid

Genetische testen en gezondheid Genetische testen en gezondheid Genetische testen en gezondheid We hebben allemaal een unieke combinatie van genen van onze ouders geërfd. Onze unieke combinatie van genen en de invloed van onze omgeving

Nadere informatie

Het menselijk genoom. Inleiding Medisch Technische Wetenschappen. Bioinformatica Deel 2. Gevouwen chromosoom. X chromosoom DNA.

Het menselijk genoom. Inleiding Medisch Technische Wetenschappen. Bioinformatica Deel 2. Gevouwen chromosoom. X chromosoom DNA. Het menselijk genoom Het menselijk genoom (DN) bestaat uit: Mega Basenparen (MB),,, C,. Inleiding Medisch echnische Wetenschappen Bioinformatica Deel Michael Egmont-Petersen Het menselijk DN is ingedeeld

Nadere informatie

Informatie voor nabestaanden. Gerechtelijke sectie bij het Nederlands Forensisch Instituut

Informatie voor nabestaanden. Gerechtelijke sectie bij het Nederlands Forensisch Instituut Informatie voor nabestaanden Gerechtelijke sectie bij het Nederlands Forensisch Instituut Inhoud Gerechtelijke sectie 4 Beslissing tot sectie 4 Het onderzoek bij een sectie 5 Resultaten van een sectie

Nadere informatie

Opgeschminkte lijkvlekken

Opgeschminkte lijkvlekken De waarheid vinden met forensische opsporing Opgeschminkte lijkvlekken Forensics is een wondermiddel, maar ook noeste arbeid. Jeroen Hofman ging mee op oefening met studenten. foto s Jeroen Hofman tekst

Nadere informatie

Brochure ExomeScan. Whole Exome Sequencing. Achtergrond

Brochure ExomeScan. Whole Exome Sequencing. Achtergrond Brochure Whole Exome Sequencing De laatste jaren is er een schat aan informatie gepubliceerd over de genetische achtergrond van overerfbare en somatische aandoeningen. In grootschalige Next Generation

Nadere informatie

Afsluitende les. Leerlingenhandleiding. Proteomics voor de massa

Afsluitende les. Leerlingenhandleiding. Proteomics voor de massa Afsluitende les Leerlingenhandleiding Proteomics voor de massa Computeropdracht Inleiding - data van een massaspectrometer Bij dit computerpracticum gaan jullie zelf de data van de analyse van een eiwit

Nadere informatie

Mitochondriële ziekten

Mitochondriële ziekten Mitochondriële ziekten Erfelijkheid NCMD Het Nijmeegs Centrum voor Mitochondriële Ziekten is een internationaal centrum voor patiëntenzorg, diagnostiek en onderzoek bij mensen met een stoornis in de mitochondriële

Nadere informatie

De accreditatie werd uitgereikt aan/ L'accréditation est délivrée à/ The accreditation is granted to/ Die akkreditierung wurde erteilt für:

De accreditatie werd uitgereikt aan/ L'accréditation est délivrée à/ The accreditation is granted to/ Die akkreditierung wurde erteilt für: Bijlage bij accreditatie-certificaat Annexe au certificat d'accréditation Annex to the accreditation certificate Beilage zur Akkreditatierungszertifikat 218-TEST NBN EN ISO/IEC 17025:2005 Versie/Version/Fassung

Nadere informatie

humaan mitochondriaal DNA-onderzoek

humaan mitochondriaal DNA-onderzoek Vakbijlage Inhoudsopgave 1. De vakbijlage algemeen 2. Wanneer is mt een optie? 3. Introductie mtdna 4. Hoe ziet een mtdna-profiel eruit? 5. De begrippen haplotype en haplogroep 6. Een voorbeeld van een

Nadere informatie

TCATTCATTCAT: Short Tandem Repeats

TCATTCATTCAT: Short Tandem Repeats TCATTCATTCAT: Short Tandem Repeats In het practicum Puzzelen met pieken heb je kennis gemaakt met forensisch DNA-onderzoek. In het practicum heb je onder andere gehoord over short tandem repeats (STR s).

Nadere informatie

FORENSISCH DNA-ONDERZOEK HET PRACTICUM

FORENSISCH DNA-ONDERZOEK HET PRACTICUM FORENSISCH DNA-ONDERZOEK HET PRACTICUM Melanie Rosenhart werkt bij het Nederlands Forensisch Instituut (NFI). Bij het NFI werken wetenschappers die allerlei vragen proberen te beantwoorden die met strafrecht

Nadere informatie

Onderzoek naar biologische sporen en DNA-onderzoek 5 april

Onderzoek naar biologische sporen en DNA-onderzoek 5 april Herziene onderzoeksset zedendelicten; FAQs Simone van Soest Afdeling Humane Biologische Sporen 27 april 2012 Herziene onderzoeksset zedendelicten 2 Herziene onderzoeksset zedendelicten 27 april 2012 1

Nadere informatie

Toepassingsgebieden van DNA-profiling

Toepassingsgebieden van DNA-profiling Toepassingsgebieden van DNA-profiling Het gebruik van DNA-profielen bij het oplossen van misdaden Bij gewelddaden als moord of verkrachting komt het er op aan om een individu aan te wijzen op basis van

Nadere informatie

Statistische aspecten van de vaststelling van fraude na opsporing via datamining. Marjan Sjerps - KdVI (Uva) - NFI

Statistische aspecten van de vaststelling van fraude na opsporing via datamining. Marjan Sjerps - KdVI (Uva) - NFI Statistische aspecten van de vaststelling van fraude na opsporing via datamining Marjan Sjerps - KdVI (Uva) - NFI - Statistiek team - Principal scientist team - Stochastiek cluster Inhoud De LR methode

Nadere informatie

De accreditatie werd uitgereikt aan/ L'accréditation est délivrée à/ The accreditation is granted to/ Die akkreditierung wurde erteilt für:

De accreditatie werd uitgereikt aan/ L'accréditation est délivrée à/ The accreditation is granted to/ Die akkreditierung wurde erteilt für: Bijlage bij accreditatie-certificaat Annexe au certificat d'accréditation Annex to the accreditation certificate Beilage zur Akkreditatierungszertifikat 482-TEST NBN EN ISO/IEC 17025:2005 Versie/Version/Fassung

Nadere informatie

ECLI:NL:RBROT:2017:4850

ECLI:NL:RBROT:2017:4850 ECLI:NL:RBROT:2017:4850 Instantie Rechtbank Rotterdam Datum uitspraak 25-04-2017 Datum publicatie 26-06-2017 Zaaknummer 10/661201-15 Rechtsgebieden Bijzondere kenmerken Inhoudsindicatie Strafrecht Eerste

Nadere informatie

Vererving Toegepast bij Europese vogels. Door Ben Cretskens

Vererving Toegepast bij Europese vogels. Door Ben Cretskens Vererving Toegepast bij Europese vogels Door Ben Cretskens Inhoud Inleiding Mutatie? Lichaam van de vogel Bevruchting Kleuren Verervingen Inleiding Darwin had gelijk! Wetten van Mendel Eigenschappen van

Nadere informatie

Erfelijke eigenschappen vmbo-kgt34. CC Naamsvermelding-GelijkDelen 3.0 Nederland licentie. https://maken.wikiwijs.nl/63370

Erfelijke eigenschappen vmbo-kgt34. CC Naamsvermelding-GelijkDelen 3.0 Nederland licentie. https://maken.wikiwijs.nl/63370 Auteur VO-content Laatst gewijzigd 23 december 2016 Licentie CC Naamsvermelding-GelijkDelen 3.0 Nederland licentie Webadres https://maken.wikiwijs.nl/63370 Dit lesmateriaal is gemaakt met Wikiwijs van

Nadere informatie

REQUISITOIR VAN HET OPENBAAR MINISTERIE

REQUISITOIR VAN HET OPENBAAR MINISTERIE REQUISITOIR VAN HET OPENBAAR MINISTERIE in de strafzaak tegen: Verdachte Geboortedatum 20 februari 1975 Parketnummer 06/580197/08 Mr. J.M. Fröberg Officier van Justitie 1. Inleiding (In dit requisitoir

Nadere informatie

naar sporen Zelf casussen oplossen

naar sporen Zelf casussen oplossen Speuren C naar sporen Zelf casussen oplossen 2. Een lijk in de duinen Langs de N304, in een berkenbos in Natuurpark de Hoge Veluwe, wordt het lijk van een man gevonden. De forensisch arts verricht enkele

Nadere informatie

KKGT DRUGS OF ABUSE. DOA Ronde A

KKGT DRUGS OF ABUSE. DOA Ronde A DOA Ronde 2013.1 A Casus: Fictieve casus dus graag drugstest ook als dit normaal niet uw lab policy zou zijn: Patiënt heeft op de zwarte markt pillen gekocht om te kunnen slapen. Graag een screening en

Nadere informatie

ECLI:NL:RBUTR:2011:BR2992

ECLI:NL:RBUTR:2011:BR2992 ECLI:NL:RBUTR:2011:BR2992 Instantie Rechtbank Utrecht Datum uitspraak 14-07-2011 Datum publicatie 26-07-2011 Zaaknummer Rechtsgebieden Bijzondere kenmerken Inhoudsindicatie 16/600081-11; 16/600434-10 (tul)

Nadere informatie

Tweede Kamer der Staten-Generaal

Tweede Kamer der Staten-Generaal Tweede Kamer der Staten-Generaal 2 Vergaderjaar 2016 2017 29 628 Politie 28 684 Naar een veiliger samenleving Nr. 725 BRIEF VAN DE MINISTER VAN VEILIGHEID EN JUSTITIE Aan de Voorzitter van de Tweede Kamer

Nadere informatie

Afwegingen bij de keuze voor ICSI. Polikliniek Gynaecologie Route 48

Afwegingen bij de keuze voor ICSI. Polikliniek Gynaecologie Route 48 Afwegingen bij de keuze voor ICSI Polikliniek Gynaecologie Route 48 0 De inhoud van deze voorlichtingsfolder is samengesteld door de Nederlandse Vereniging voor Obstetrie en Gynaecologie (NVOG). Deze folder

Nadere informatie

SCHRIFTELIJKE REACTIE CONCLUSIE D.D. 20 MAART 2007 ERNEST JACOBUS JOHANNES LOUWES. tegen HET OPENBAAR MINISTERIE VAN ADVOCAAT-GENERAAL MR.

SCHRIFTELIJKE REACTIE CONCLUSIE D.D. 20 MAART 2007 ERNEST JACOBUS JOHANNES LOUWES. tegen HET OPENBAAR MINISTERIE VAN ADVOCAAT-GENERAAL MR. SCHRIFTELIJKE REACTIE OP CONCLUSIE D.D. 20 MAART 2007 VAN ADVOCAAT-GENERAAL MR. MACHIELSE ERNEST JACOBUS JOHANNES LOUWES tegen HET OPENBAAR MINISTERIE HOGE RAAD DER NEDERLANDEN TE S-GRAVENHAGE GRIFFIENUMMER

Nadere informatie

W18 Zelf aan de slag met de leskist DNA. Caspar Geraedts (De Praktijk / VU)

W18 Zelf aan de slag met de leskist DNA. Caspar Geraedts (De Praktijk / VU) W18 Zelf aan de slag met de leskist DNA Caspar Geraedts (De Praktijk / VU) IK DOELEN Aan het eind van de workshop weet je wat je moet regelen om bij jou op school met de leskist DNA te kunnen werken, weet

Nadere informatie

Vraag /144. Vraag 14

Vraag /144. Vraag 14 Vraag 13 107/144 De kinderen van Romeo en Julia kunnen de ziekte enkel hebben indien hun beide ouders heterozygoot zijn. Hoe groot is die kans? Julia's broer Augusto heeft de ziekte, dus moeten zowel Laura

Nadere informatie

Recht doen met forensisch DNA-onderzoek

Recht doen met forensisch DNA-onderzoek 1 Recht doen met forensisch DNA-onderzoek Inaugurele rede A.D. Kloosterman 14 januari 2010 14.30 uur Aula van de UvA (Lutherse Kerk), Singel 411, 1012 WN Amsterdam Mevrouw de Rector Magnificus, Mijnheer

Nadere informatie