W08: DNA aflezen gebruiken en delen: hoe ver ga jij? Roel Hermsen Hubrecht Instituut Kirsten Renkema UMC Utrecht

Maat: px
Weergave met pagina beginnen:

Download "W08: DNA aflezen gebruiken en delen: hoe ver ga jij? Roel Hermsen Hubrecht Instituut Kirsten Renkema UMC Utrecht"

Transcriptie

1 W08: DNA aflezen gebruiken en delen: hoe ver ga jij? Roel Hermsen Hubrecht Instituut Kirsten Renkema UMC Utrecht

2 Ik ben hier als: Workshop = doen! 1. Biologie docent 2. TOA 3. Bovenbouw docent middelbare school 4. Onderbouw docent middelbare school 5. Basisschool docent 6. Lerarenopleider 7. MBO docent 8. HBO docent

3 Iedereen mag mijn DNA zien 1. Eens 2. Oneens

4 Deelname wetenschappelijk onderzoek Op welke manier wordt het sequencen van DNA gebruikt in wetenschappelijk onderzoek? Wat betekent dit voor de patient?

5 Wie doen er mee?: patienten met aangeboren nier- / urinewegafwijking 1:500 levendgeborenen, een belangrijke oorzaak van nierfalen bij kinderen Bronnen: Mayo Foundation for Medical Education and Research; A. Boutwell, childrensmemorial.org; VURinfo.com

6 Deelname procedure van patiënten in het onderzoek bij de afdelingen Kinderurologie Kindernefrologie Klinische Genetica informeren Doel van het onderzoek Wat gaan we doen? Mogelijkheid te stoppen met deelname Vertrouwelijkheid gegevens

7 Informed consent

8 Informed consent Handtekening!

9 Onderzoeksethiek: born in scandal Internationale codes en richtlijnen Neurenberg Code 1947 Declaration of Helsinki 1964/2008 Good Clinical Practice (EU) 1975/2001 Wet Med. Wetensch. Onderzoek met mensen 1998/2006 Medisch Ethische Toetsingscommissie (METC)

10 Vragenlijstgegevens verzamelen Uitgebreide vragenlijsten over Omgevingsfactoren / beroep voor en tijdens zwangerschap Voorkomen ziektes in de familie

11 Bloedafname voor DNA isolatie

12 'PCR' is een technologie om? A. DNA af te lezen B. DNA te bouwen C. DNA te kopiëren 0% 0% 0% DNA af te lezen DNA te bouwen DNA te kopiëren

13 PCR principe

14 Snelle ontwikkelingen in technieken om DNA af te lezen ,000 bp/day 1990 ~3,000 bp/day ,000,000,000 bp/analysis

15 Sanger sequencing (first generation sequencing)

16 Next generation sequencing (NGS)

17 ACAAGCTCTCCATGTGAGCTGACAGGCGAGTGGAAACCCCTCGAGTCACGCTGCCCGGCGGCGGA GGGAGCGCTCGCCCGCAGTGGCAACAGCTGCACCACCGCCCCGTCGCTCTGCCTTCCTCTTCTGC AGCCTCTGCTCTTCTGATTACCTCCCTCCCCCGTCCTTTGGTGATTTTTTTTTTTCAAGAAGGAG AGGGCGGGGTAGGTGTCCGTTCCCTCCCCTCTTCCCCCTCCTTTGCCTTCTTGGTTTGAATTTCC TCCCCCGGCGTTGCACTGGCACAGAGTGCAAGAGGCAATACCCGCACGGAGGGAGAACGAAGGCT GAGACTCCCCTGCCGCTCCAAGCCCGGAAGAACTGGAGCCTGGAGGGGGGTGAGGGGAGAAGAGG AAGCGGGAGGGGCTTGGCTTCCTCGCGTATTTGAGGACAGCCCATCTCCCTTCAAGAACCCTACG GAGAGTCGGACTGCATCTCCGCAGCGAGCTCTTGGAGCGCCGCCGGCCGGGAGGCGAAGGATGCA GGCGGCTCCGCGCGCCGGCTGCGGGGCAGCGCTCCTGCTGTGGATTGTCAGCAGCTGCCTCTGCA GAGCCTGGACGGCTCCCTCCACGTCCCGTAAGTAGCCGTCTCCTCGCTCTGCTCTGGAGCAGTTT CAGTGCGGCATTGATGTTTGGCAC TGCATCGCAGTGCTGGCACCCTGA TGTGTTTGTGTCTCCGCTGTCACACACTTGCAGCCACTGCAGTAGACAAACTCGAAACCCAGCGT TTCTGTTTTGGAAGAGACAGGGTTGTGACGCTGGTGATGTTTCTGGAAAGTTGTTCCTGGTCTTG GTGATCGGTTGGCAAGAGCTTGGCTAGAGAGACTGATGTAGATGGCAGCTTCTTAGGAGTTGTTT GTGCAGGGAGAGTTAACTGCATTTGGCTTAGGTAGGTCAGTGAATGAAAAGTGAAGACCATGGCA AAACCAAGGTTTCTTATTTTTATTTATGGTTATAACTTAATGAGCACGGGGTTGAGGTTAACAAG AGGAGCATGTTTTAAACAGTTTGGGCACCTATAGGGTCTCTTTAACCTCTCCCGTTCCCTTAAAC ACCTATAGGGTCTCTTTAACCTCTCCCGTTCCCTTAAAAAGTTAATGCCCATTTAGTACTTGCTT ATTAAAATGGAAGGCAGCGAAATTGTAACTGAAATTGCTTTAATTCTTTGATACTTTGATATCAT GGATATGACTGATGCAGTACGGTACTTGGGACACTCAGTGCAAAGCGTCGTTAATGTAGTAATAA ACAGATTCTTAATAGGGTTTTCAGGAAAATAATTATATTCAATATGTATATCTCTGCATTTTAAT CAACTGTGTGTGTGTGTTTGTGTGCATCTCCGCAGCGAGCTCTTGGAGCGCCGCCGGCCGGGAGG CGAAGGATGCAGGCGGCTCCGCGCGCCGGCTGCGGGGGACTTTCATAGGTACTTTGGATCGTCAC GTCAGGTGCATCGCTTCAGATCAGGTTCAGGTTTTGCATACGATACGTACGTGCTATTTCAGGTC GGCTGCGGGGGACTTTCATAGGTACTTTGGATCGTCACGTCAGGTGCATCGCTTCAGATCAGGTT

18 Een verandering van één letter is altijd minder erg dan het verliezen van een groot stuk DNA (deletie) A. Ja, dit klopt B. Nee, dit klopt niet 0 0 A. B.

19 Mogelijke uitkomsten en interpretatie Dominant De novo Recessief Multifactorieel

20 Publiceren Anoniem? In hoeverre is een stamboom + beschrijving van de familie + genetische analyse te herleiden naar een persoon?

21 Toepassingen van de resultaten van het onderzoek? Genetische achtergrond van aangeboren nier- en urinewegafwijkingen Fundamentele kennis Vroegdiagnostiek - Genetische counseling - Herhalingsrisico Prognose o.b.v. genetisch profiel Personal medicine - aanpassen therapie - voorkómen van nierfalen CAKUT

22 Genetisch onderzoek: nieuwe mogelijkheden I Exome: Sequencen van alleen alle exonen (1-3% v/h genoom)

23 Genetisch onderzoek: nieuwe mogelijkheden II ChIP: (Chromatin Immuno Precipitation) Sequencen van DNA dat bindt aan specifieke eiwitten

24 Conclusie: 1. Er zit heel veel in de genen 2. We kunnen alle informatie aflezen, maar begrijpen nog maar een deel van de code 3. Genetische analyse wordt steeds belangrijker om patienten de meest optimale zorg te kunnen geven

25 Deel 2: 23andMe Ben je bekend met de website 23andMe.com? A. Ja, ik heb een profiel B. Nee, nooit van gehoord C. Wel eens ergens langs zien komen maar wat het precies is weet ik niet? Ja, ik heb een profiel Nee, nooit van gehoord Wel eens ergens langs zi..

26

27 Deel 3: Nu jullie: online DNA predictor Ga naar: functioneelbloot.info klik op het scherm en volg de aanwijzingen

28 Zou je willen weten wat je DNA nog meer over jou vertelt? Stel je voor dat je erachter kan komen. Zou jij dan je DNA hiervoor willen afgeven in de vorm van speeksel? A. Ja, geen probleem. B. Nee, ik geef mijn DNA niet af. 0 0 A. B.

29 Ben jij bereid jouw DNA te delen? A. Ik heb het op Facebook gedeeld B. Ik heb het naar mezelf laten en 0% 0% A. B.

30 157 personen: DNA delen op Facebook 1970 personen: NIET delen Nu: Leeuwarden (tot 9 maart) maart: Roermond Andere plaatsen: dnastore.nl W dnastore.nl

31 Van wie is deze informatie? mezelf -preventie arts -behandeling op maat Samenleving Werkgever -selectie competentie Zorgverzekeraar -kostenmanagement

32 Informatie van mijn genenpaspoort moet beschikbaar zijn: 1. Alleen voor mezelf 2. Ook voor mijn (huis)arts 3. Voor mijn zorgverzekeraar 4. Voor mijn werkgever 5. Voor iedereen 0% 0% 0% 0% 0% Alleen voor mezelf Ook voor mijn (huis)arts Voor mijn zorgverzekeraar Voor mijn werkgever Voor iedereen

33 Genetische testen die online worden aangeboden geven mij relevante informatie over mijn gezondheid en levenswijze A. Mee eens B. Mee oneens 0 0 Mee eens Mee oneens

34 Ik zal mijn familieleden aansporen om een DNA test te laten doen via 23andme A. ja B. nee 0 0 ja nee

35 Biobanken mogen worden ingezet voor misdaadbestrijding A. Mee eens B. Mee oneens 0 0 Mee eens Mee oneens

36 Het uitbreiden en vervroegen van genetische prenatale testen draagt bij aan de levenskwaliteit van ouders en kind A. Mee eens B. Mee onees 0 0 Mee eens Mee onees

37 Tot slot: Iedereen mag mijn DNA zien 1. Eens 2. Oneens

Informatie over Exoom sequencing

Informatie over Exoom sequencing Informatie over Exoom sequencing Exoom sequencing is een nieuwe techniek voor erfelijkheidsonderzoek. In deze folder vindt u informatie over dit onderzoek. De volgende onderwerpen komen aan bod: Om de

Nadere informatie

Mee-naar-huis-neem boodschappen dec. 2016

Mee-naar-huis-neem boodschappen dec. 2016 COIG cursusdag Genoom & Genetica Mee-naar-huis-neem boodschappen dec. 2016 klinische moleculaire genetica klinisch genetisch redeneren ethische / maatschappelijke aspecten van erfelijkheidsonderzoek next

Nadere informatie

Erfelijkheidsonderzoek anno 2015. Lizet van der Kolk klinisch geneticus 11-06-2015

Erfelijkheidsonderzoek anno 2015. Lizet van der Kolk klinisch geneticus 11-06-2015 Erfelijkheidsonderzoek anno 2015 Lizet van der Kolk klinisch geneticus 11-06-2015 Erfelijkheidsonderzoek Bij wie, hoe en waarom? Consequenties en belang voor patiënt(e) en familieleden Nieuwe ontwikkelingen

Nadere informatie

Brochure ExomeScan. Whole Exome Sequencing. Achtergrond

Brochure ExomeScan. Whole Exome Sequencing. Achtergrond Brochure Whole Exome Sequencing De laatste jaren is er een schat aan informatie gepubliceerd over de genetische achtergrond van overerfbare en somatische aandoeningen. In grootschalige Next Generation

Nadere informatie

Brochure ExomeScan. Whole Exome Sequencing. Achtergrond

Brochure ExomeScan. Whole Exome Sequencing. Achtergrond Brochure Whole Exome Sequencing De laatste jaren is er een schat aan informatie gepubliceerd over de genetische achtergrond van overerfbare en somatische aandoeningen. In grootschalige Next Generation

Nadere informatie

UMC St Radboud. Schisis: Erfelijkheidsadvisering. jong-volwassenen

UMC St Radboud. Schisis: Erfelijkheidsadvisering. jong-volwassenen UMC St Radboud Schisis: Erfelijkheidsadvisering voor jong-volwassenen Patiënteninformatie Voor wie is deze folder bedoeld? Deze folder gaat over schisis en erfelijkheid en is vooral bedoeld voor jong-volwassenen

Nadere informatie

Erfelijkheid: nieuwe DNA testen en dilemma s die daarbij horen NVN Nederlandse Nierdag 4 oktober 2014

Erfelijkheid: nieuwe DNA testen en dilemma s die daarbij horen NVN Nederlandse Nierdag 4 oktober 2014 Erfelijkheid: nieuwe DNA testen en dilemma s die daarbij horen NVN Nederlandse Nierdag 4 oktober 2014 Nine Knoers Afdeling Medische Genetica Overzicht presentatie Algemene principes genetica Belang van

Nadere informatie

Recente ontwikkelingen in de ethische normen voor medisch-wetenschappelijk onderzoek

Recente ontwikkelingen in de ethische normen voor medisch-wetenschappelijk onderzoek Recente ontwikkelingen in de ethische normen voor medisch-wetenschappelijk onderzoek Prof dr JJM van Delden Julius Centrum, UMC Utrecht j.j.m.vandelden@umcutrecht.nl Inleiding Medisch-wetenschappelijk

Nadere informatie

Workshop DNA-schade. Erfelijkheidsonderzoek bij borstkanker: met welk doel? Dr. Jan C. Oosterwijk klinisch geneticus, UMCGroningen

Workshop DNA-schade. Erfelijkheidsonderzoek bij borstkanker: met welk doel? Dr. Jan C. Oosterwijk klinisch geneticus, UMCGroningen Workshop DNA-schade Erfelijkheidsonderzoek bij borstkanker: met welk doel? Dr. Jan C. Oosterwijk klinisch geneticus, UMCGroningen Erfelijkheidsonderzoek ging over Down syndroom, Duchenne spierdystrofie,

Nadere informatie

Hoe kijken we naar het DNA van een patiënt?

Hoe kijken we naar het DNA van een patiënt? Hoe kijken we naar het DNA van een patiënt? Ies Nijman UMC Utrecht Dept of Genetics, Centre for Molecular Medicine Center for Personalized Cancer Treatment (CPCT), Hartwig Medical Foundation 1994 DNA sequenties,

Nadere informatie

In hoeverre ben jij al bezig met de keuze voor een studie na de middelbare school? (bovenbouwscholieren)

In hoeverre ben jij al bezig met de keuze voor een studie na de middelbare school? (bovenbouwscholieren) In hoeverre ben jij al bezig met de keuze voor een studie na de middelbare school? (bovenbouwscholieren) Ik ben daar heel erg mee bezig 39,4% Ik ben daar redelijk mee bezig 50,4% Ik ben daar niet zo mee

Nadere informatie

Kanker in de familie.

Kanker in de familie. Inhoud workshop Kanker in de familie. Dr. Margreet Ausems klinisch geneticus UMCU Introductie Verwachtingen deelnemers Achtergrondinformatie (cijfers!) Hoe ontstaat kanker? Erfelijke kanker en erfelijkheidsonderzoek

Nadere informatie

Automatisering van NGS processen Ewart de Bruijn. Hubrecht Institute

Automatisering van NGS processen Ewart de Bruijn. Hubrecht Institute Automatisering van NGS processen Ewart de Bruijn Hubrecht Institute Wie zijn we De Cuppen groep op het Hubrecht Instituut De Cuppen groep houdt zich bezig met het ontdekken en in kaart brengen van de variaties

Nadere informatie

Voorbij het 1000$ Genoom van diagnostiek naar screening

Voorbij het 1000$ Genoom van diagnostiek naar screening Voorbij het 1000$ Genoom van diagnostiek naar screening Rolf Sijmons Afdeling Genetica Op weg naar het 1000$ Genoom Een gen codeert voor 1 of (meestal) meerdere eiwitten Al ons DNA samen is ons GENOOM

Nadere informatie

Mee-naar-huis-neem boodschappen 2014

Mee-naar-huis-neem boodschappen 2014 COIG cursusdag klinische genetica in de interne geneeskunde Mee-naar-huis-neem boodschappen 2014 Hes Bredenoord Bongers & Deegens Helderman-van der Enden & Rennenberg Meijers-Heijboer & Hoogerbrugge van

Nadere informatie

WES: Informatiebrief en toestemmingsformulier voor whole exome sequencing

WES: Informatiebrief en toestemmingsformulier voor whole exome sequencing WES: Informatiebrief en toestemmingsformulier voor whole exome sequencing Geachte ouders, De arts van uw kind heeft aan u voorgesteld om met gebruik van een nieuwe techniek uitgebreid onderzoek van het

Nadere informatie

Mee-naar-huis-neem boodschappen 2013

Mee-naar-huis-neem boodschappen 2013 COIG cursusdag klinische genetica in de interne geneeskunde Mee-naar-huis-neem boodschappen 2013 Bredenoord, Deegens, Helderman-van der Enden, Hes, Knoers, Menko, Rennenberg, van Tintelen, Vasen, Wilde

Nadere informatie

Postbus AE Den Haag tel fax

Postbus AE Den Haag tel fax Postbus 93245 2509 AE Den Haag tel 070 349 5281 fax 070 349 5397 info@forumbg.nl www.forumbg.nl Nieuwe DNA technieken bieden grotere kans op een diagnose De mogelijkheden en uitdagingen van Next Generation

Nadere informatie

PATIËNTENINFORMATIE TRACING. Registratie van real time continue glucose monitoring in Nederland (TRACING)

PATIËNTENINFORMATIE TRACING. Registratie van real time continue glucose monitoring in Nederland (TRACING) PATIËNTENINFORMATIE TRACING Registratie van real time continue glucose monitoring in Nederland (TRACING) Geachte heer/mevrouw, Bij de behandeling van uw diabetes gebruikt u op dit moment de real time continue

Nadere informatie

Patiënteninformatie voor deelnemers aan erfelijkheidsonderzoek

Patiënteninformatie voor deelnemers aan erfelijkheidsonderzoek Patiënteninformatie voor deelnemers aan erfelijkheidsonderzoek Familiaire Amyotrofische Lateraal Sclerose in Nederland Geachte heer/mevrouw, 1. Inleiding Aan u is gevraagd medewerking te verlenen aan een

Nadere informatie

Algemene informatie. Medisch wetenschappelijk onderzoek

Algemene informatie. Medisch wetenschappelijk onderzoek Algemene informatie Medisch wetenschappelijk onderzoek 1 Inleiding Artsen verrichten naast hun normale behandelingen soms medisch wetenschappelijk onderzoek. Dit doen artsen in het Scheper Ziekenhuis Emmen

Nadere informatie

Patiënten Informatie Brochure Erfelijkheidsonderzoek: Exoom Sequencing

Patiënten Informatie Brochure Erfelijkheidsonderzoek: Exoom Sequencing 2 Patiënten Informatie Brochure Erfelijkheidsonderzoek: Exoom Sequencing Algemene informatie Exoom Sequencing is een nieuwe techniek voor erfelijkheidsonderzoek. In deze folder vindt u informatie over

Nadere informatie

Onderzoeksgroep Neurodegeneratieve Hersenziekten

Onderzoeksgroep Neurodegeneratieve Hersenziekten WETENSCHAPPELIJK ONDERZOEK NAAR DE ROL VAN GENETICA IN JONGDEMENTIE: FAMILIES, MUTATIES EN GENETISCHE TESTEN. Christine Van Broeckhoven Neurodegeneratieve Hersenziekten Groep, Department Moleculaire Genetica,

Nadere informatie

Vragenlijst Intakegesprek

Vragenlijst Intakegesprek Vragenlijst Intakegesprek Voorletters: Meisjesnaam: Roepnaam: Nationaliteit: Spreektaal: Gehuwd/samenwonend/anders: Achternaam partner: Voorletters en roepnaam partner: Geboortedatum partner: Welke achternaam

Nadere informatie

Genetic origin of Dupuytren s disease and associated fibromatosis Genexpressie onderzoek

Genetic origin of Dupuytren s disease and associated fibromatosis Genexpressie onderzoek UMCG, Martini Ziekenhuis, MCL, MST, Isala Klinieken, UMCU, Catharina Ziekenhuis, Nederland 1 University of California, Los Angeles, Verenigde Staten Informatie Genetic origin of Dupuytren s disease and

Nadere informatie

Ook al heb je geen klachten, willen we graag dat je de vragenlijst invult.

Ook al heb je geen klachten, willen we graag dat je de vragenlijst invult. oktober 2013 Beste jongere, Tussen maart 2012 en maart 2013 ben je in het ziekenhuis geweest na het breken van je arm, sleutelbeen of been. Wij willen jou vragen mee te doen aan een onderzoek naar de gevolgen

Nadere informatie

Algemene aspecten van erfelijkheid. Waarom is kennis over erfelijke aspecten van een ziekte belangrijk? Wanneer erfelijkheidsadvies/onderzoek?

Algemene aspecten van erfelijkheid. Waarom is kennis over erfelijke aspecten van een ziekte belangrijk? Wanneer erfelijkheidsadvies/onderzoek? Erfelijke nierziekten: algemene aspecten van erfelijkheid, overerving en erfelijkheidsadvies Nine Knoers Klinisch Geneticus Commissie Erfelijke Nierziekten NVN 4 november 2006 HUMAN GENETICS NIJMEGEN Inhoud

Nadere informatie

Aangeboren hartafwijkingen en erfelijkheid

Aangeboren hartafwijkingen en erfelijkheid Aangeboren hartafwijkingen en erfelijkheid 13 november 2010 Klaartje van Engelen Klinische genetica Academisch Medisch Centrum, Amsterdam Wat kunnen we met alle kennis over DNA en genen in de medische

Nadere informatie

Welkom. Dit is een onderzoek over online identiteiten en onderwijs.

Welkom. Dit is een onderzoek over online identiteiten en onderwijs. Welkom Dit is een onderzoek over online identiteiten en onderwijs. In dit onderzoek wordt een online identiteit gezien als de complete set van karakteristieken die een persoon definiëren en die online

Nadere informatie

Chromosoomonderzoek bij herhaalde miskramen

Chromosoomonderzoek bij herhaalde miskramen Chromosoomonderzoek bij herhaalde miskramen Divisie Biomedische Genetica, afdeling Genetica Herhaalde miskramen Een miskraam betekent vrijwel altijd een teleurstelling voor een vrouw en haar partner. Al

Nadere informatie

Implementatie LIMS binnen afdeling Genetica van het Radboudumc. Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 27 03 2014

Implementatie LIMS binnen afdeling Genetica van het Radboudumc. Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 27 03 2014 Implementatie LIMS binnen afdeling Genetica van het Radboudumc Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 27 03 2014 Inleiding Wie? Wat? Hoe? Historie LIMS Implementatie Labvantage Toekomst plannen

Nadere informatie

Kijk op kinderen. KinderKennisCentrum Genèvelaan CC Utrecht

Kijk op kinderen. KinderKennisCentrum Genèvelaan CC Utrecht baby & kind Kijk op kinderen YOUth is een initiatief van Universiteit Utrecht en het Universitair Medisch Centrum Utrecht KinderKennisCentrum Genèvelaan 4-6 3584 CC Utrecht www.youthonderzoek.nl www.facebook.com/youthonderzoek

Nadere informatie

Zwanger worden: via de natuurlijke weg of zijn er andere mogelijkheden?

Zwanger worden: via de natuurlijke weg of zijn er andere mogelijkheden? 21 mei 2011 Zwanger worden: via de natuurlijke weg of zijn er andere mogelijkheden? Drs. Inge Smeets PGD arts en arts-onderzoeker Maastricht Universitair Medisch Centrum Themamiddag Jong en BRCA Borstkankervereniging

Nadere informatie

Nieuwsbrief AGORA. AGORA bestaat 10 jaar! Resultaten onderzoek: wetenschappelijke publicaties

Nieuwsbrief AGORA. AGORA bestaat 10 jaar! Resultaten onderzoek: wetenschappelijke publicaties Nieuwsbrief AGORA Aetiologisch onderzoek naar Genetische en Omgevings Risicofactoren voor Aandoeningen bij kinderen www.agoraproject.nl AGORA bestaat 10 jaar! De AGORA data en biobank bestaat 10 jaar.

Nadere informatie

Ik weet dat mijn gegevens anoniem zullen worden toegevoegd aan een databestand dat voor wetenschappelijke doeleinden gebruikt wordt.

Ik weet dat mijn gegevens anoniem zullen worden toegevoegd aan een databestand dat voor wetenschappelijke doeleinden gebruikt wordt. Toestemmingsverklaring: Ik heb informatie gekregen over de inhoud, methode en het doel van het onderzoek. Ik weet dat de gegevens en resultaten van het onderzoek alleen anoniem en vertrouwelijk gebruikt

Nadere informatie

Van gen tot genoom en daarbuiten: recente revoluties in genetisch onderzoek

Van gen tot genoom en daarbuiten: recente revoluties in genetisch onderzoek Van gen tot genoom en daarbuiten: recente revoluties in genetisch onderzoek Anne Herkert, klinisch geneticus Jan Jongbloed, moleculair geneticus Landelijke dag erfelijke hartziekten 29 oktober 2016 Erfelijkheid

Nadere informatie

Klinische Genetica. Erfelijkheidsonderzoek en -voorlichting

Klinische Genetica. Erfelijkheidsonderzoek en -voorlichting Klinische Genetica Erfelijkheidsonderzoek en -voorlichting Klinische Genetica Inhoud Inleiding 3 Een verzoek om erfelijkheidsonderzoek en -voorlichting 3 Wachten op de uitslag 3 Kosten 4 Het doel van

Nadere informatie

B elangenverklaring. Persoonlijke gegevens aanvrager

B elangenverklaring. Persoonlijke gegevens aanvrager B elangenverklaring In het kader van de Code ter voorkoming van oneigenlijke beïnvloeding door belangenverstrengeling wordt alle beoogd betrokkenen bij de totstandkoming van wetenschappelijke adviesrapporten

Nadere informatie

Onderzoek: Studiekeuze

Onderzoek: Studiekeuze Onderzoek: Studiekeuze Publicatiedatum: 31-01- 2014 Over dit onderzoek Aan dit online onderzoek, gehouden van 29 t/m 31 januari 2014, deden 712 scholieren en 1064 studenten mee. De uitslag van de peiling

Nadere informatie

Datum 8 september 2015 Onderwerp Antwoorden Kamervragen over de opslag van DNA data bij onder andere Google en Amazon

Datum 8 september 2015 Onderwerp Antwoorden Kamervragen over de opslag van DNA data bij onder andere Google en Amazon 1 > Retouradres Postbus 20301 2500 EH Den Haag Aan de Voorzitter van de Tweede Kamer der Staten-Generaal Postbus 20018 2500 EA DEN HAAG Bestuurlijke en Turfmarkt 147 2511 DP Den Haag Postbus 20301 2500

Nadere informatie

Afsluitende les. Leerlingenhandleiding. DNA-onderzoek en gentherapie

Afsluitende les. Leerlingenhandleiding. DNA-onderzoek en gentherapie Afsluitende les Leerlingenhandleiding DNA-onderzoek en gentherapie Inleiding In de afsluitende les DNA-onderzoek en gentherapie zul je aan de hand van een aantal vragen een persoonlijke en kritische blik

Nadere informatie

Informatiebrief deelnemers MIND-TIA: De waarde van een bloedtest bij verdenking op een TIA

Informatiebrief deelnemers MIND-TIA: De waarde van een bloedtest bij verdenking op een TIA Informatiebrief deelnemers MIND-TIA: De waarde van een bloedtest bij verdenking op een TIA Julius Centrum UMC Utrecht Geachte heer/mevrouw, Wij vragen u vriendelijk om mee te doen aan een medisch-wetenschappelijk

Nadere informatie

Niet-Invasief Prenataal Testen: Nevenbevindingen, regionale en landelijke resultaten en een blik vooruit

Niet-Invasief Prenataal Testen: Nevenbevindingen, regionale en landelijke resultaten en een blik vooruit Niet-Invasief Prenataal Testen: Nevenbevindingen, regionale en landelijke resultaten en een blik vooruit Dr BHW Faas Laboratorium Specialist Klinische Genetica Radboud Universiteit Nijmegen Afdeling Genetica

Nadere informatie

Erfelijke ziekten bij rashonden: Hoe los ik dat probleem nou op?

Erfelijke ziekten bij rashonden: Hoe los ik dat probleem nou op? Erfelijke ziekten bij rashonden: Hoe los ik dat probleem nou op? Expertisecentrum Genetica Gezelschapsdieren Prof. dr. Jan Rothuizen Departement Geneeskunde van Gezelschapsdieren Faculteit Diergeneeskunde

Nadere informatie

ORATIE Bruggen bouwen in de genetica, van patiënt naar genoom en weer terug

ORATIE Bruggen bouwen in de genetica, van patiënt naar genoom en weer terug ORATIE Bruggen bouwen in de genetica, van patiënt naar genoom en weer terug Conny M.A. van Ravenswaaij-Arts Bruggen bouwen in de genetica, van patiënt naar genoom en weer terug Rede uitgesproken door Dr.

Nadere informatie

Klinisch onderzoek bij kinderen en jongeren met kanker. wat is het en hoe werkt het?

Klinisch onderzoek bij kinderen en jongeren met kanker. wat is het en hoe werkt het? Klinisch onderzoek bij kinderen en jongeren met kanker wat is het en hoe werkt het? De behandeling van kinderen en jongeren met kanker vindt meestal plaats in combinatie met een klinisch onderzoek. We

Nadere informatie

Etiologisch onderzoek naar slechthorendheid op de kinderleeftijd. Sarina Kant & Rosanne van Velzen 27-09-2013

Etiologisch onderzoek naar slechthorendheid op de kinderleeftijd. Sarina Kant & Rosanne van Velzen 27-09-2013 Etiologisch onderzoek naar slechthorendheid op de kinderleeftijd Sarina Kant & Rosanne van Velzen 27-09-2013 Etiologisch onderzoek naar slechthorendheid op de kinderleeftijd Richtlijn Multidisciplinaire

Nadere informatie

De Reizende DNA-labs. 2-3 uur practicum met inleidende en afsluitende lessen voor docent

De Reizende DNA-labs. 2-3 uur practicum met inleidende en afsluitende lessen voor docent De Reizende DNA-labs 2-3 uur practicum met inleidende en afsluitende lessen voor docent Brug tussen biologie en scheikunde op school en de life sciences Leerlingen gaan zelf aan de slag met de nieuwste

Nadere informatie

Deelname aan wetenschappelijk onderzoek

Deelname aan wetenschappelijk onderzoek Sophia Kinderziekenhuis Erasmus MC -Sophia Kinderziekenhuis is een universitair medisch centrum. Dit betekent dat er niet alleen kinderen worden behandeld en verpleegd, maar dat er ook medisch wetenschappelijk

Nadere informatie

ALS Onderzoek. ALS biobank en database. ALS Onderzoek. Onderzoeksprojecten

ALS Onderzoek. ALS biobank en database. ALS Onderzoek. Onderzoeksprojecten ALS Onderzoek ALS Centrum Nederland doet onderzoek naar ALS, PLS en PSMA met als doel om zo snel mogelijk een behandeling voor deze ziektes te vinden. We verzamelen gegevens van zoveel mogelijk patiënten.

Nadere informatie

High through put automatisering in de Genetica. Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 19 11 2014

High through put automatisering in de Genetica. Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 19 11 2014 High through put automatisering in de Genetica Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 19 11 2014 Inleiding Wie? Wat? Hoe? Automatisering / Robotisering Toekomst plannen Medewerkers Afdeling Genetica

Nadere informatie

GENETISCHE COUNSELING SYLVIA DE NOBELE, GENETISCH COUNSELOR CENTRUM MEDISCHE GENETICA, UZGENT (CMGG) FAPA 19/11/2016

GENETISCHE COUNSELING SYLVIA DE NOBELE, GENETISCH COUNSELOR CENTRUM MEDISCHE GENETICA, UZGENT (CMGG) FAPA 19/11/2016 GENETISCHE COUNSELING SYLVIA DE NOBELE, GENETISCH COUNSELOR CENTRUM MEDISCHE GENETICA, UZGENT (CMGG) FAPA 19/11/2016 INHOUD 1. Erfelijke dikkedarmkanker 2. Betrokken genen en overerving 3. DNA, chromosomen

Nadere informatie

Infobrochure INFORMATIE OVER GENOOMONDERZOEK IN DE GENETICA

Infobrochure INFORMATIE OVER GENOOMONDERZOEK IN DE GENETICA INFORMATIE OVER GENOOMONDERZOEK IN DE GENETICA Array Comparative Genomic Hybridization (array CGH) Single Nucleotide Polymorphism array (SNP array) Massive Parallel Sequencing (MPS) Versie 120150504 Design

Nadere informatie

MOSAIC studie Informatiebrief voor cases

MOSAIC studie Informatiebrief voor cases 1 MOSAIC studie Informatiebrief voor cases Informatiebrief betreffende het onderzoek (MOSAIC studie): de gevolgen van acute hepatitis C virus infectie bij HIV positieve en HIV negatieve mannen die seks

Nadere informatie

Therapie, Counselling en Coaching

Therapie, Counselling en Coaching Informed Consent Therapie, Counselling en Coaching Wij werken volgens de beroepscode van het Nederlands Instituut van Psychologen (NIP). Informatie hierover kunt u vinden op de website van het NIP: www.psynip.nl

Nadere informatie

Informatie voor donoren over UMC Utrecht Biobank TiN

Informatie voor donoren over UMC Utrecht Biobank TiN Informatie voor donoren over UMC Utrecht Biobank TiN Geachte mevrouw/mijnheer, In het kader van de Trombocytopathie in Nederland studie wordt een gedeelte van het extra afgenomen bloed opgeslagen in een

Nadere informatie

Gebruik van medische gegevens en/of resterend lichaamsmateriaal

Gebruik van medische gegevens en/of resterend lichaamsmateriaal Gebruik van medische gegevens en/of resterend lichaamsmateriaal Belangrijke telefoonnummers Algemeen nummer UMCG (050) 361 61 61 U kunt hier terecht met algemene vragen over het UMCG. Bijvoorbeeld over

Nadere informatie

Erfelijkheidsonderzoek: de procedure

Erfelijkheidsonderzoek: de procedure Erfelijkheidsonderzoek: de procedure Divisie Biomedische Genetica, afdeling Genetica Erfelijkheidsonderzoek: de procedure Wanneer erfelijkheidsonderzoek? Er is reden voor een erfelijkheidsonderzoek als:

Nadere informatie

HET PARTNER-ONDERZOEK

HET PARTNER-ONDERZOEK Deelnemersinformatie en geïnformeerde voor de HIV-positieve partner HET PARTNER-ONDERZOEK Het PARTNER-onderzoek is een onderzoek naar stellen, waarbij: (i) de ene partner HIV-positief is en de ander HIV-negatief;

Nadere informatie

Bijlage I bij het Kaderreglement van het Parelsnoer Initiatief. Handleiding Parelspecifiek reglement

Bijlage I bij het Kaderreglement van het Parelsnoer Initiatief. Handleiding Parelspecifiek reglement Bijlage I bij het Kaderreglement van het Parelsnoer Initiatief Handleiding Parelspecifiek reglement Op grond van artikel 4 lid 17 van het Kaderreglement Parelsnoer Initiatief dient per Parel een reglement

Nadere informatie

BIOKLOK DE BIOLOGISCHE KLOK IN DE LES MODULE B HAVO. klok. www. bio. .nl

BIOKLOK DE BIOLOGISCHE KLOK IN DE LES MODULE B HAVO. klok. www. bio. .nl BIOKLOK DE BIOLOGISCHE KLOK IN DE LES MODULE B HAVO www. bio klok.nl BIOKLOK MODULE B HAVO VERSTOORDE CHRONOTYPES INLEIDING Als het goed is, heb je een vragenlijst ingevuld om te testen of je een ochtendmens

Nadere informatie

Afdeling Medische Psychologie Informatie voor kinderen, jongeren en hun ouders

Afdeling Medische Psychologie Informatie voor kinderen, jongeren en hun ouders Afdeling Medische Psychologie Informatie voor kinderen, jongeren en hun ouders Je bent doorverwezen naar de afdeling Medische Psychologie van het Sint Anna Ziekenhuis. Deze brochure geeft je informatie

Nadere informatie

WES-MR: Informatiebrief en toestemmingsformulier voor whole exome sequencing bij kinderen met een verstandelijke beperking

WES-MR: Informatiebrief en toestemmingsformulier voor whole exome sequencing bij kinderen met een verstandelijke beperking Betreft : Informatiebrief WES-MR: Informatiebrief en toestemmingsformulier voor whole exome sequencing bij kinderen met een verstandelijke beperking Geachte ouders, De arts van uw kind heeft aan u voorgesteld

Nadere informatie

Gebruik van uw medische gegevens en lichaamsmateriaal. Heeft u bezwaar?

Gebruik van uw medische gegevens en lichaamsmateriaal. Heeft u bezwaar? Gebruik van uw medische gegevens en lichaamsmateriaal Heeft u bezwaar? Inleiding U bezoekt het Radboudumc voor onderzoek en/of behandeling. Om u zo goed mogelijk te kunnen onderzoeken en/of behandelen

Nadere informatie

Verzekeringen & erfelijkheid

Verzekeringen & erfelijkheid Verzekeringen & erfelijkheid U wilt een levens- of arbeidsongeschiktheidsverzekering afsluiten? Hier vindt u de www.bpv.nl antwoorden op veelgestelde vragen over erfelijkheid en het aanvragen van een verzekering.

Nadere informatie

EXAMEN KEUZEDEEL VERRIJKING LEERVAARDIGHEDEN Code: K INFORMATIE VOOR DE STUDENT

EXAMEN KEUZEDEEL VERRIJKING LEERVAARDIGHEDEN Code: K INFORMATIE VOOR DE STUDENT EXAMEN KEUZEDEEL VERRIJKING LEERVAARDIGHEDEN Code: K0440 2. INFORMATIE VOOR DE STUDENT Versie 1.0 31.05.2016 Informatie Deze informatie is voor jou omdat je examen gaat doen in het keuzedeel Verrijking

Nadere informatie

Allen Vrouw Man 18-24 25-34 35-44 45-54 55-64 65+ N= 522 243 279 55 73 106 110 132 46 % % % % % % % % % 97,1 97,5 96,8 98,2 100,0 97,2 95,5 97,0 95,7

Allen Vrouw Man 18-24 25-34 35-44 45-54 55-64 65+ N= 522 243 279 55 73 106 110 132 46 % % % % % % % % % 97,1 97,5 96,8 98,2 100,0 97,2 95,5 97,0 95,7 Filosofie Magazine Onderzoek De Grote Moraalenquête 2010 Tabellenboek Van Eunen Marketing 6 september 2010 Onderzoek uitgevoerd door PanelClix Representatief Nederland 18+, N=522 Vraag 1: Maakt u zelf

Nadere informatie

Standard Operating Procedure

Standard Operating Procedure Standard Operating Procedure SOP: V9 Initiatievisite Auteur Naam: Functie instelling/afdeling Judie van den Elshout Staffunctionaris Wetenschapsbureau Wetenschapsbureau / Cluster Leerhuis Handtekening:...

Nadere informatie

ONDERZOEK IN VLOKKEN OF VRUCHTWATER BIJ ECHOAFWIJKINGEN

ONDERZOEK IN VLOKKEN OF VRUCHTWATER BIJ ECHOAFWIJKINGEN ONDERZOEK IN VLOKKEN OF VRUCHTWATER BIJ ECHOAFWIJKINGEN ONDERZOEK IN VLOKKEN E VRUCHTWATER BIJ ECHOAFWIJKINGEN Afdeling Genetica UMCG 2 Onderzoek in vlokken of in vruchtwater bij echoafwijkingen. U bent

Nadere informatie

Informatiebrief voor patiënten. Vullingsstrategie bij bloedverlies tijdens de bevalling

Informatiebrief voor patiënten. Vullingsstrategie bij bloedverlies tijdens de bevalling Informatiebrief voor patiënten Vullingsstrategie bij bloedverlies tijdens de bevalling NL42942.068.13 Versie 4 18-11.2013 Geachte mevrouw, U bent voor uw zwangerschap onder controle in het academisch ziekenhuis

Nadere informatie

Medischwetenschappelijk. onderzoek. Algemene informatie voor de proefpersoon

Medischwetenschappelijk. onderzoek. Algemene informatie voor de proefpersoon Medischwetenschappelijk onderzoek Algemene informatie voor de proefpersoon Inhoud Inleiding 5 Medisch-wetenschappelijk onderzoek 6 Wat is medisch-wetenschappelijk onderzoek? Wat zijn proefpersonen? Wie

Nadere informatie

onderzoek Invloed van UVB lichttherapie op huid en darmflora.

onderzoek Invloed van UVB lichttherapie op huid en darmflora. Uw behandelend arts of de onderzoeker heeft u geïnformeerd over het medisch-wetenschappelijk onderzoek Invloed van UVB lichttherapie op huid en darmflora. U beslist zelf of u wilt meedoen. Om deze beslissing

Nadere informatie

Les 1. 1 En jij? O 2 keer per jaar O 3 keer per jaar O 4 keer per jaar. Wat is een rapport? 1. Krijgt jouw kind een rapport?

Les 1. 1 En jij? O 2 keer per jaar O 3 keer per jaar O 4 keer per jaar. Wat is een rapport? 1. Krijgt jouw kind een rapport? Les 1 Wat is een rapport? 1 En jij? 1. Krijgt jouw kind een rapport? O ja O nee 2. Krijgen kleuters ook een rapport? O ja O nee 3. Kreeg jij vroeger in de school ook een rapport? O ja O nee Wanneer? Wat

Nadere informatie

Meten van mediawijsheid. Bijlage 6. Interview. terug naar meten van mediawijsheid

Meten van mediawijsheid. Bijlage 6. Interview. terug naar meten van mediawijsheid Meten van mediawijsheid Bijlage 6 Interview terug naar meten van mediawijsheid Bijlage 6: Het interview Individueel interview Uitleg interview Ik zal je uitleggen wat de bedoeling is vandaag. Ik ben heel

Nadere informatie

Hieronder vind je de uitgebreide privacy code van InsightYou. InsightYou: InsightYou B.V., gevestigd te Rotterdam, KvK 54690692.

Hieronder vind je de uitgebreide privacy code van InsightYou. InsightYou: InsightYou B.V., gevestigd te Rotterdam, KvK 54690692. Privacy Code. Hieronder vind je de uitgebreide privacy code van InsightYou. 1. Definities (in alfabetische volgorde). Biologische gegevens: de gegevens, verzameld uit het door jou aangeleverde biologisch

Nadere informatie

TRIDENT studie. Mireille Bekker Gynaecoloog Radboud umc

TRIDENT studie. Mireille Bekker Gynaecoloog Radboud umc TRIDENT studie Mireille Bekker Gynaecoloog Radboud umc Historie April 2011 oprichting NIPT consortium Nederland TRIDENT studie: implementatie van lab tot uitslag ESPRIT studie: ethisch, economisch, maatschappelijk

Nadere informatie

Onderzoek: Studiekeuzecheck

Onderzoek: Studiekeuzecheck Onderzoek: Studiekeuzecheck Publicatiedatum: 11-4- 2014 Over dit onderzoek Het 1V Jongerenpanel, onderdeel van EenVandaag, bestaat uit 7000 jongeren van 12 t/m 24 jaar. Aan dit online onderzoek, gehouden

Nadere informatie

Dragerschap en erfelijke belasting

Dragerschap en erfelijke belasting Dragerschap en erfelijke belasting VSOP 17 mei 2010 Martina Cornel Hoogleraar Community Genetics & Public Health Genomics Quality of Care EMGO Institute for Health and Care Research Nieuwe technologische

Nadere informatie

Medewerking Behoort u niet tot de doelgroep, wilt u dan deze vragenlijst doorsturen aan bekenden die wel tot de doelgroep behoren?

Medewerking Behoort u niet tot de doelgroep, wilt u dan deze vragenlijst doorsturen aan bekenden die wel tot de doelgroep behoren? Peiling 20-weken echo 30-03-2010 Vragenlijst Opmerking PEILING VAN EEN 20-WEKEN ECHO Achtergrond van het onderzoek Iedere vrouw die zwanger is, krijgt een zogenaamde?20-weken echo? aangeboden. Regelmatig

Nadere informatie

Voormeting kandidaat

Voormeting kandidaat K1 Voormeting kandidaat Beste kandidaat, Het CBR is aan het onderzoeken of het nieuwe faalangstexamen voldoet aan de verwachtingen en aan de eisen van de minister van Verkeer en Waterstaat. Dit onderzoek

Nadere informatie

Keuzeproces voor het inrichten van een gerobotiseerd opslagsysteem. Gerard van Duijnhoven UMC St Radboud, Nijmegen Afdeling Genetica

Keuzeproces voor het inrichten van een gerobotiseerd opslagsysteem. Gerard van Duijnhoven UMC St Radboud, Nijmegen Afdeling Genetica Keuzeproces voor het inrichten van een gerobotiseerd opslagsysteem Gerard van Duijnhoven UMC St Radboud, Nijmegen Afdeling Genetica Inhoud Genetica Radboud Biobank Manuele sample opslag Geautomatiseerd

Nadere informatie

De rol van de verpleegkundige binnen Medischwetenschappelijk

De rol van de verpleegkundige binnen Medischwetenschappelijk De rol van de verpleegkundige binnen Medischwetenschappelijk onderzoek Moderator Mevr. R.C.A. Veldhoen-Tijben 1st author / speaker Miriam Gelderloos Co-author Erna Helmantel Belangenverklaring In overeenstemming

Nadere informatie

Ik weet dat mijn gegevens anoniem zullen worden toegevoegd aan een databestand dat voor wetenschappelijke doeleinden gebruikt wordt.

Ik weet dat mijn gegevens anoniem zullen worden toegevoegd aan een databestand dat voor wetenschappelijke doeleinden gebruikt wordt. Hallo, Door deze vragenlijst in te vullen help je mee aan een onderzoek naar het leefklimaat op jouw groep. Hierbij gaat het om wat jij vindt van de ondersteuning van de medewerkers, de sfeer en wat je

Nadere informatie

Thematische behoeftepeiling. Uitkomsten en conclusies van een brede enquête onder patiëntenorganisaties

Thematische behoeftepeiling. Uitkomsten en conclusies van een brede enquête onder patiëntenorganisaties Thematische behoeftepeiling Uitkomsten en conclusies van een brede enquête onder patiëntenorganisaties Inleiding In de komende jaren ontwikkelt de VSOP toerustende activiteiten voor patiëntenorganisaties

Nadere informatie

Welkom bij Centrum Jeugd. Informatie voor kinderen, jongeren en hun familieleden

Welkom bij Centrum Jeugd. Informatie voor kinderen, jongeren en hun familieleden Welkom bij Centrum Jeugd Informatie voor kinderen, jongeren en hun familieleden Welkom bij Centrum Jeugd Je gaat deelnemen aan een van de behandelingen bij Centrum Jeugd van GGz Breburg. De behandelaren

Nadere informatie

Bijlage 4.2.2 Vragenlijst voor stotterende kinderen

Bijlage 4.2.2 Vragenlijst voor stotterende kinderen Bijlage 4.2.2 Vragenlijst voor stotterende kinderen bussum 2011 Wij wijzen erop dat het gebruik van de bijlagen bedoeld is voor de praktijk van de therapeut die de in het boek Stotteren: van theorie naar

Nadere informatie

Het formulier zal na beoordeling openbaar worden gemaakt. Hoofdfunctie[s) Graag omvang perfunctie vermelden als u meerderefuncties heeft

Het formulier zal na beoordeling openbaar worden gemaakt. Hoofdfunctie[s) Graag omvang perfunctie vermelden als u meerderefuncties heeft B elangenverklaring In het kader van de Code ter voorkoming van oneigenlijke beïnvloeding door belangenverstrengeling wordt alle beoogd betrokkenen bij de totstandkoming van wetenschappelijke adviesrapporten

Nadere informatie

1. Inleiding. 2. Sequencing: de technieken. a. Sanger Sequencing. a. Next-generation Sequencing

1. Inleiding. 2. Sequencing: de technieken. a. Sanger Sequencing. a. Next-generation Sequencing MY STATEMENT PAPER Genoom sequencing kan een nuttige tool zijn voor verschillende toepassingen, maar diepgaande discussie is nodig om de mogelijke wetenschappelijke, sociale en ethische gevolgen in kaart

Nadere informatie

Toekomst voorspellingen

Toekomst voorspellingen Toekomst voorspellingen Dit zoek is een vragenlijst waarin aan jou gevraagd wordt om over voorspellingen na te denken die mensen maken in verschillende omstandigheden. Deelname duurt ongeveer 1 minuten.

Nadere informatie

18 november 2016 CineMec Utrecht

18 november 2016 CineMec Utrecht Julius Academy Personalized Medicine en de rol van Big Data: Grenzeloze Mogelijkheden 18 november 2016 CineMec Utrecht Personalized Medicine en de rol van Big Data: grenzeloze mogelijkheden Op vrijdag

Nadere informatie

Deelnemersinformatie en geïnformeerde toestemming voor de HIV-negatieve partner HET PARTNER-ONDERZOEK

Deelnemersinformatie en geïnformeerde toestemming voor de HIV-negatieve partner HET PARTNER-ONDERZOEK Deelnemersinformatie en geïnformeerde voor de HIV-negatieve partner HET PARTNER-ONDERZOEK Het PARTNER-onderzoek is een onderzoek naar stellen, waarbij: (i) de ene partner HIV-positief is en de ander HIV-negatief;

Nadere informatie

Zoek het uit! Studiekeuze123

Zoek het uit! Studiekeuze123 Zoek het uit! Opdrachten Studiekeuze123 Naam: Klas: Wat denk je zelf? Het maken van een studiekeuze is belangrijk, maar kan best lastig zijn. Er zijn ruim 1.700 bacheloropleidingen waaruit je kunt kiezen

Nadere informatie

Genetic Counseling en Kanker

Genetic Counseling en Kanker Genetic Counseling en Kanker (erfelijke en familiaire kanker in de praktijk) dr Rolf Sijmons, klinisch geneticus afdeling Genetica UMC Groningen (Theoretische en) Practische aspecten Erfelijke Kanker Counseling

Nadere informatie

Betreft: Uitnodiging SCORE-onderzoek. Geachte heer/mevrouw,

Betreft: Uitnodiging SCORE-onderzoek. Geachte heer/mevrouw, Betreft: Uitnodiging SCORE-onderzoek. Geachte heer/mevrouw, Met deze brief willen we u uitnodigen om deel te nemen aan het SCORE-onderzoek. Dit onderzoek gaat over de inhoud van revalidatie na een beroerte,

Nadere informatie

Infoblad. Als je weet dat je een baby met een aandoening krijgt

Infoblad. Als je weet dat je een baby met een aandoening krijgt Als je weet dat je een baby met een aandoening krijgt Soms krijgen ouders tijdens de zwangerschap te horen dat hun kind een aandoening heeft. Dan volgt een moeilijke keuze: laat je het kind komen of breek

Nadere informatie

website www.nvmetc.nl

website www.nvmetc.nl Verslag NVMETC secretarissenoverleg 19 juni 2014 1. Opening en vaststelling agenda Dhr. Davids geeft aan, dat een belangrijke reden van dit secretarissenoverleg is, dat we van elkaar horen wat er speelt

Nadere informatie

VRAGENLIJST TER VOORBEREIDING PRENATALE SCREENING & DIAGNOSTIEK. van uw partner: Beroep: Gegevens vader van de baby. Voorletter(s): Achternaam:

VRAGENLIJST TER VOORBEREIDING PRENATALE SCREENING & DIAGNOSTIEK. van uw partner: Beroep: Gegevens vader van de baby. Voorletter(s): Achternaam: VRAGENLIJST TER VOORBEREIDING PRENATALE SCREENING & DIAGNOSTIEK Voorletter(s): Roepnaam: Burgerlijke staat: Geboorteland: Beroep: Meisjes achternaam: Geboortedatum: Gebruikt u de naam van uw partner: Nationaliteit:

Nadere informatie

Patiënten informatiebrief

Patiënten informatiebrief Patiënten informatiebrief Landelijk onderzoek naar patiënten met trombocytopathie in Nederland Geachte mevrouw/mijnheer, Trombocytopathie in Nederland (TiN) Wij vragen u vriendelijk om mee te doen aan

Nadere informatie

Wil ik het wel weten?

Wil ik het wel weten? Wil ik het wel weten? Vera Hovers en Joyce de Vos-Houben 3 oktober 2015 Wil ik het wel weten? De consequenties van erfelijkheidsonderzoek Vera Hovers en dr. Joyce de Vos-Houben Genetisch consulenten polikliniek

Nadere informatie