W08: DNA aflezen gebruiken en delen: hoe ver ga jij? Roel Hermsen Hubrecht Instituut Kirsten Renkema UMC Utrecht

Maat: px
Weergave met pagina beginnen:

Download "W08: DNA aflezen gebruiken en delen: hoe ver ga jij? Roel Hermsen Hubrecht Instituut Kirsten Renkema UMC Utrecht"

Transcriptie

1 W08: DNA aflezen gebruiken en delen: hoe ver ga jij? Roel Hermsen Hubrecht Instituut Kirsten Renkema UMC Utrecht

2 Ik ben hier als: Workshop = doen! 1. Biologie docent 2. TOA 3. Bovenbouw docent middelbare school 4. Onderbouw docent middelbare school 5. Basisschool docent 6. Lerarenopleider 7. MBO docent 8. HBO docent

3 Iedereen mag mijn DNA zien 1. Eens 2. Oneens

4 Deelname wetenschappelijk onderzoek Op welke manier wordt het sequencen van DNA gebruikt in wetenschappelijk onderzoek? Wat betekent dit voor de patient?

5 Wie doen er mee?: patienten met aangeboren nier- / urinewegafwijking 1:500 levendgeborenen, een belangrijke oorzaak van nierfalen bij kinderen Bronnen: Mayo Foundation for Medical Education and Research; A. Boutwell, childrensmemorial.org; VURinfo.com

6 Deelname procedure van patiënten in het onderzoek bij de afdelingen Kinderurologie Kindernefrologie Klinische Genetica informeren Doel van het onderzoek Wat gaan we doen? Mogelijkheid te stoppen met deelname Vertrouwelijkheid gegevens

7 Informed consent

8 Informed consent Handtekening!

9 Onderzoeksethiek: born in scandal Internationale codes en richtlijnen Neurenberg Code 1947 Declaration of Helsinki 1964/2008 Good Clinical Practice (EU) 1975/2001 Wet Med. Wetensch. Onderzoek met mensen 1998/2006 Medisch Ethische Toetsingscommissie (METC)

10 Vragenlijstgegevens verzamelen Uitgebreide vragenlijsten over Omgevingsfactoren / beroep voor en tijdens zwangerschap Voorkomen ziektes in de familie

11 Bloedafname voor DNA isolatie

12 'PCR' is een technologie om? A. DNA af te lezen B. DNA te bouwen C. DNA te kopiëren 0% 0% 0% DNA af te lezen DNA te bouwen DNA te kopiëren

13 PCR principe

14 Snelle ontwikkelingen in technieken om DNA af te lezen ,000 bp/day 1990 ~3,000 bp/day ,000,000,000 bp/analysis

15 Sanger sequencing (first generation sequencing)

16 Next generation sequencing (NGS)

17 ACAAGCTCTCCATGTGAGCTGACAGGCGAGTGGAAACCCCTCGAGTCACGCTGCCCGGCGGCGGA GGGAGCGCTCGCCCGCAGTGGCAACAGCTGCACCACCGCCCCGTCGCTCTGCCTTCCTCTTCTGC AGCCTCTGCTCTTCTGATTACCTCCCTCCCCCGTCCTTTGGTGATTTTTTTTTTTCAAGAAGGAG AGGGCGGGGTAGGTGTCCGTTCCCTCCCCTCTTCCCCCTCCTTTGCCTTCTTGGTTTGAATTTCC TCCCCCGGCGTTGCACTGGCACAGAGTGCAAGAGGCAATACCCGCACGGAGGGAGAACGAAGGCT GAGACTCCCCTGCCGCTCCAAGCCCGGAAGAACTGGAGCCTGGAGGGGGGTGAGGGGAGAAGAGG AAGCGGGAGGGGCTTGGCTTCCTCGCGTATTTGAGGACAGCCCATCTCCCTTCAAGAACCCTACG GAGAGTCGGACTGCATCTCCGCAGCGAGCTCTTGGAGCGCCGCCGGCCGGGAGGCGAAGGATGCA GGCGGCTCCGCGCGCCGGCTGCGGGGCAGCGCTCCTGCTGTGGATTGTCAGCAGCTGCCTCTGCA GAGCCTGGACGGCTCCCTCCACGTCCCGTAAGTAGCCGTCTCCTCGCTCTGCTCTGGAGCAGTTT CAGTGCGGCATTGATGTTTGGCAC TGCATCGCAGTGCTGGCACCCTGA TGTGTTTGTGTCTCCGCTGTCACACACTTGCAGCCACTGCAGTAGACAAACTCGAAACCCAGCGT TTCTGTTTTGGAAGAGACAGGGTTGTGACGCTGGTGATGTTTCTGGAAAGTTGTTCCTGGTCTTG GTGATCGGTTGGCAAGAGCTTGGCTAGAGAGACTGATGTAGATGGCAGCTTCTTAGGAGTTGTTT GTGCAGGGAGAGTTAACTGCATTTGGCTTAGGTAGGTCAGTGAATGAAAAGTGAAGACCATGGCA AAACCAAGGTTTCTTATTTTTATTTATGGTTATAACTTAATGAGCACGGGGTTGAGGTTAACAAG AGGAGCATGTTTTAAACAGTTTGGGCACCTATAGGGTCTCTTTAACCTCTCCCGTTCCCTTAAAC ACCTATAGGGTCTCTTTAACCTCTCCCGTTCCCTTAAAAAGTTAATGCCCATTTAGTACTTGCTT ATTAAAATGGAAGGCAGCGAAATTGTAACTGAAATTGCTTTAATTCTTTGATACTTTGATATCAT GGATATGACTGATGCAGTACGGTACTTGGGACACTCAGTGCAAAGCGTCGTTAATGTAGTAATAA ACAGATTCTTAATAGGGTTTTCAGGAAAATAATTATATTCAATATGTATATCTCTGCATTTTAAT CAACTGTGTGTGTGTGTTTGTGTGCATCTCCGCAGCGAGCTCTTGGAGCGCCGCCGGCCGGGAGG CGAAGGATGCAGGCGGCTCCGCGCGCCGGCTGCGGGGGACTTTCATAGGTACTTTGGATCGTCAC GTCAGGTGCATCGCTTCAGATCAGGTTCAGGTTTTGCATACGATACGTACGTGCTATTTCAGGTC GGCTGCGGGGGACTTTCATAGGTACTTTGGATCGTCACGTCAGGTGCATCGCTTCAGATCAGGTT

18 Een verandering van één letter is altijd minder erg dan het verliezen van een groot stuk DNA (deletie) A. Ja, dit klopt B. Nee, dit klopt niet 0 0 A. B.

19 Mogelijke uitkomsten en interpretatie Dominant De novo Recessief Multifactorieel

20 Publiceren Anoniem? In hoeverre is een stamboom + beschrijving van de familie + genetische analyse te herleiden naar een persoon?

21 Toepassingen van de resultaten van het onderzoek? Genetische achtergrond van aangeboren nier- en urinewegafwijkingen Fundamentele kennis Vroegdiagnostiek - Genetische counseling - Herhalingsrisico Prognose o.b.v. genetisch profiel Personal medicine - aanpassen therapie - voorkómen van nierfalen CAKUT

22 Genetisch onderzoek: nieuwe mogelijkheden I Exome: Sequencen van alleen alle exonen (1-3% v/h genoom)

23 Genetisch onderzoek: nieuwe mogelijkheden II ChIP: (Chromatin Immuno Precipitation) Sequencen van DNA dat bindt aan specifieke eiwitten

24 Conclusie: 1. Er zit heel veel in de genen 2. We kunnen alle informatie aflezen, maar begrijpen nog maar een deel van de code 3. Genetische analyse wordt steeds belangrijker om patienten de meest optimale zorg te kunnen geven

25 Deel 2: 23andMe Ben je bekend met de website 23andMe.com? A. Ja, ik heb een profiel B. Nee, nooit van gehoord C. Wel eens ergens langs zien komen maar wat het precies is weet ik niet? Ja, ik heb een profiel Nee, nooit van gehoord Wel eens ergens langs zi..

26

27 Deel 3: Nu jullie: online DNA predictor Ga naar: functioneelbloot.info klik op het scherm en volg de aanwijzingen

28 Zou je willen weten wat je DNA nog meer over jou vertelt? Stel je voor dat je erachter kan komen. Zou jij dan je DNA hiervoor willen afgeven in de vorm van speeksel? A. Ja, geen probleem. B. Nee, ik geef mijn DNA niet af. 0 0 A. B.

29 Ben jij bereid jouw DNA te delen? A. Ik heb het op Facebook gedeeld B. Ik heb het naar mezelf laten en 0% 0% A. B.

30 157 personen: DNA delen op Facebook 1970 personen: NIET delen Nu: Leeuwarden (tot 9 maart) maart: Roermond Andere plaatsen: dnastore.nl W dnastore.nl

31 Van wie is deze informatie? mezelf -preventie arts -behandeling op maat Samenleving Werkgever -selectie competentie Zorgverzekeraar -kostenmanagement

32 Informatie van mijn genenpaspoort moet beschikbaar zijn: 1. Alleen voor mezelf 2. Ook voor mijn (huis)arts 3. Voor mijn zorgverzekeraar 4. Voor mijn werkgever 5. Voor iedereen 0% 0% 0% 0% 0% Alleen voor mezelf Ook voor mijn (huis)arts Voor mijn zorgverzekeraar Voor mijn werkgever Voor iedereen

33 Genetische testen die online worden aangeboden geven mij relevante informatie over mijn gezondheid en levenswijze A. Mee eens B. Mee oneens 0 0 Mee eens Mee oneens

34 Ik zal mijn familieleden aansporen om een DNA test te laten doen via 23andme A. ja B. nee 0 0 ja nee

35 Biobanken mogen worden ingezet voor misdaadbestrijding A. Mee eens B. Mee oneens 0 0 Mee eens Mee oneens

36 Het uitbreiden en vervroegen van genetische prenatale testen draagt bij aan de levenskwaliteit van ouders en kind A. Mee eens B. Mee onees 0 0 Mee eens Mee onees

37 Tot slot: Iedereen mag mijn DNA zien 1. Eens 2. Oneens

Erfelijkheidsonderzoek anno 2015. Lizet van der Kolk klinisch geneticus 11-06-2015

Erfelijkheidsonderzoek anno 2015. Lizet van der Kolk klinisch geneticus 11-06-2015 Erfelijkheidsonderzoek anno 2015 Lizet van der Kolk klinisch geneticus 11-06-2015 Erfelijkheidsonderzoek Bij wie, hoe en waarom? Consequenties en belang voor patiënt(e) en familieleden Nieuwe ontwikkelingen

Nadere informatie

Brochure ExomeScan. Whole Exome Sequencing. Achtergrond

Brochure ExomeScan. Whole Exome Sequencing. Achtergrond Brochure Whole Exome Sequencing De laatste jaren is er een schat aan informatie gepubliceerd over de genetische achtergrond van overerfbare en somatische aandoeningen. In grootschalige Next Generation

Nadere informatie

Informatie over Exoom sequencing

Informatie over Exoom sequencing Informatie over Exoom sequencing Exoom sequencing is een nieuwe techniek voor erfelijkheidsonderzoek. In deze folder vindt u informatie over dit onderzoek. De volgende onderwerpen komen aan bod: Om de

Nadere informatie

Brochure ExomeScan. Whole Exome Sequencing. Achtergrond

Brochure ExomeScan. Whole Exome Sequencing. Achtergrond Brochure Whole Exome Sequencing De laatste jaren is er een schat aan informatie gepubliceerd over de genetische achtergrond van overerfbare en somatische aandoeningen. In grootschalige Next Generation

Nadere informatie

UMC St Radboud. Schisis: Erfelijkheidsadvisering. jong-volwassenen

UMC St Radboud. Schisis: Erfelijkheidsadvisering. jong-volwassenen UMC St Radboud Schisis: Erfelijkheidsadvisering voor jong-volwassenen Patiënteninformatie Voor wie is deze folder bedoeld? Deze folder gaat over schisis en erfelijkheid en is vooral bedoeld voor jong-volwassenen

Nadere informatie

Erfelijkheid: nieuwe DNA testen en dilemma s die daarbij horen NVN Nederlandse Nierdag 4 oktober 2014

Erfelijkheid: nieuwe DNA testen en dilemma s die daarbij horen NVN Nederlandse Nierdag 4 oktober 2014 Erfelijkheid: nieuwe DNA testen en dilemma s die daarbij horen NVN Nederlandse Nierdag 4 oktober 2014 Nine Knoers Afdeling Medische Genetica Overzicht presentatie Algemene principes genetica Belang van

Nadere informatie

Hoe kijken we naar het DNA van een patiënt?

Hoe kijken we naar het DNA van een patiënt? Hoe kijken we naar het DNA van een patiënt? Ies Nijman UMC Utrecht Dept of Genetics, Centre for Molecular Medicine Center for Personalized Cancer Treatment (CPCT), Hartwig Medical Foundation 1994 DNA sequenties,

Nadere informatie

Recente ontwikkelingen in de ethische normen voor medisch-wetenschappelijk onderzoek

Recente ontwikkelingen in de ethische normen voor medisch-wetenschappelijk onderzoek Recente ontwikkelingen in de ethische normen voor medisch-wetenschappelijk onderzoek Prof dr JJM van Delden Julius Centrum, UMC Utrecht j.j.m.vandelden@umcutrecht.nl Inleiding Medisch-wetenschappelijk

Nadere informatie

Workshop DNA-schade. Erfelijkheidsonderzoek bij borstkanker: met welk doel? Dr. Jan C. Oosterwijk klinisch geneticus, UMCGroningen

Workshop DNA-schade. Erfelijkheidsonderzoek bij borstkanker: met welk doel? Dr. Jan C. Oosterwijk klinisch geneticus, UMCGroningen Workshop DNA-schade Erfelijkheidsonderzoek bij borstkanker: met welk doel? Dr. Jan C. Oosterwijk klinisch geneticus, UMCGroningen Erfelijkheidsonderzoek ging over Down syndroom, Duchenne spierdystrofie,

Nadere informatie

Automatisering van NGS processen Ewart de Bruijn. Hubrecht Institute

Automatisering van NGS processen Ewart de Bruijn. Hubrecht Institute Automatisering van NGS processen Ewart de Bruijn Hubrecht Institute Wie zijn we De Cuppen groep op het Hubrecht Instituut De Cuppen groep houdt zich bezig met het ontdekken en in kaart brengen van de variaties

Nadere informatie

Voorbij het 1000$ Genoom van diagnostiek naar screening

Voorbij het 1000$ Genoom van diagnostiek naar screening Voorbij het 1000$ Genoom van diagnostiek naar screening Rolf Sijmons Afdeling Genetica Op weg naar het 1000$ Genoom Een gen codeert voor 1 of (meestal) meerdere eiwitten Al ons DNA samen is ons GENOOM

Nadere informatie

Kanker in de familie.

Kanker in de familie. Inhoud workshop Kanker in de familie. Dr. Margreet Ausems klinisch geneticus UMCU Introductie Verwachtingen deelnemers Achtergrondinformatie (cijfers!) Hoe ontstaat kanker? Erfelijke kanker en erfelijkheidsonderzoek

Nadere informatie

In hoeverre ben jij al bezig met de keuze voor een studie na de middelbare school? (bovenbouwscholieren)

In hoeverre ben jij al bezig met de keuze voor een studie na de middelbare school? (bovenbouwscholieren) In hoeverre ben jij al bezig met de keuze voor een studie na de middelbare school? (bovenbouwscholieren) Ik ben daar heel erg mee bezig 39,4% Ik ben daar redelijk mee bezig 50,4% Ik ben daar niet zo mee

Nadere informatie

Mee-naar-huis-neem boodschappen 2014

Mee-naar-huis-neem boodschappen 2014 COIG cursusdag klinische genetica in de interne geneeskunde Mee-naar-huis-neem boodschappen 2014 Hes Bredenoord Bongers & Deegens Helderman-van der Enden & Rennenberg Meijers-Heijboer & Hoogerbrugge van

Nadere informatie

Mee-naar-huis-neem boodschappen 2013

Mee-naar-huis-neem boodschappen 2013 COIG cursusdag klinische genetica in de interne geneeskunde Mee-naar-huis-neem boodschappen 2013 Bredenoord, Deegens, Helderman-van der Enden, Hes, Knoers, Menko, Rennenberg, van Tintelen, Vasen, Wilde

Nadere informatie

Patiënten Informatie Brochure Erfelijkheidsonderzoek: Exoom Sequencing

Patiënten Informatie Brochure Erfelijkheidsonderzoek: Exoom Sequencing 2 Patiënten Informatie Brochure Erfelijkheidsonderzoek: Exoom Sequencing Algemene informatie Exoom Sequencing is een nieuwe techniek voor erfelijkheidsonderzoek. In deze folder vindt u informatie over

Nadere informatie

Implementatie LIMS binnen afdeling Genetica van het Radboudumc. Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 27 03 2014

Implementatie LIMS binnen afdeling Genetica van het Radboudumc. Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 27 03 2014 Implementatie LIMS binnen afdeling Genetica van het Radboudumc Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 27 03 2014 Inleiding Wie? Wat? Hoe? Historie LIMS Implementatie Labvantage Toekomst plannen

Nadere informatie

Patiënteninformatie voor deelnemers aan erfelijkheidsonderzoek

Patiënteninformatie voor deelnemers aan erfelijkheidsonderzoek Patiënteninformatie voor deelnemers aan erfelijkheidsonderzoek Familiaire Amyotrofische Lateraal Sclerose in Nederland Geachte heer/mevrouw, 1. Inleiding Aan u is gevraagd medewerking te verlenen aan een

Nadere informatie

WES: Informatiebrief en toestemmingsformulier voor whole exome sequencing

WES: Informatiebrief en toestemmingsformulier voor whole exome sequencing WES: Informatiebrief en toestemmingsformulier voor whole exome sequencing Geachte ouders, De arts van uw kind heeft aan u voorgesteld om met gebruik van een nieuwe techniek uitgebreid onderzoek van het

Nadere informatie

PATIËNTENINFORMATIE TRACING. Registratie van real time continue glucose monitoring in Nederland (TRACING)

PATIËNTENINFORMATIE TRACING. Registratie van real time continue glucose monitoring in Nederland (TRACING) PATIËNTENINFORMATIE TRACING Registratie van real time continue glucose monitoring in Nederland (TRACING) Geachte heer/mevrouw, Bij de behandeling van uw diabetes gebruikt u op dit moment de real time continue

Nadere informatie

Erfelijke ziekten bij rashonden: Hoe los ik dat probleem nou op?

Erfelijke ziekten bij rashonden: Hoe los ik dat probleem nou op? Erfelijke ziekten bij rashonden: Hoe los ik dat probleem nou op? Expertisecentrum Genetica Gezelschapsdieren Prof. dr. Jan Rothuizen Departement Geneeskunde van Gezelschapsdieren Faculteit Diergeneeskunde

Nadere informatie

Genetic origin of Dupuytren s disease and associated fibromatosis Genexpressie onderzoek

Genetic origin of Dupuytren s disease and associated fibromatosis Genexpressie onderzoek UMCG, Martini Ziekenhuis, MCL, MST, Isala Klinieken, UMCU, Catharina Ziekenhuis, Nederland 1 University of California, Los Angeles, Verenigde Staten Informatie Genetic origin of Dupuytren s disease and

Nadere informatie

Onderzoeksgroep Neurodegeneratieve Hersenziekten

Onderzoeksgroep Neurodegeneratieve Hersenziekten WETENSCHAPPELIJK ONDERZOEK NAAR DE ROL VAN GENETICA IN JONGDEMENTIE: FAMILIES, MUTATIES EN GENETISCHE TESTEN. Christine Van Broeckhoven Neurodegeneratieve Hersenziekten Groep, Department Moleculaire Genetica,

Nadere informatie

Welkom. Dit is een onderzoek over online identiteiten en onderwijs.

Welkom. Dit is een onderzoek over online identiteiten en onderwijs. Welkom Dit is een onderzoek over online identiteiten en onderwijs. In dit onderzoek wordt een online identiteit gezien als de complete set van karakteristieken die een persoon definiëren en die online

Nadere informatie

Algemene aspecten van erfelijkheid. Waarom is kennis over erfelijke aspecten van een ziekte belangrijk? Wanneer erfelijkheidsadvies/onderzoek?

Algemene aspecten van erfelijkheid. Waarom is kennis over erfelijke aspecten van een ziekte belangrijk? Wanneer erfelijkheidsadvies/onderzoek? Erfelijke nierziekten: algemene aspecten van erfelijkheid, overerving en erfelijkheidsadvies Nine Knoers Klinisch Geneticus Commissie Erfelijke Nierziekten NVN 4 november 2006 HUMAN GENETICS NIJMEGEN Inhoud

Nadere informatie

Zwanger worden: via de natuurlijke weg of zijn er andere mogelijkheden?

Zwanger worden: via de natuurlijke weg of zijn er andere mogelijkheden? 21 mei 2011 Zwanger worden: via de natuurlijke weg of zijn er andere mogelijkheden? Drs. Inge Smeets PGD arts en arts-onderzoeker Maastricht Universitair Medisch Centrum Themamiddag Jong en BRCA Borstkankervereniging

Nadere informatie

De Reizende DNA-labs. 2-3 uur practicum met inleidende en afsluitende lessen voor docent

De Reizende DNA-labs. 2-3 uur practicum met inleidende en afsluitende lessen voor docent De Reizende DNA-labs 2-3 uur practicum met inleidende en afsluitende lessen voor docent Brug tussen biologie en scheikunde op school en de life sciences Leerlingen gaan zelf aan de slag met de nieuwste

Nadere informatie

Aangeboren hartafwijkingen en erfelijkheid

Aangeboren hartafwijkingen en erfelijkheid Aangeboren hartafwijkingen en erfelijkheid 13 november 2010 Klaartje van Engelen Klinische genetica Academisch Medisch Centrum, Amsterdam Wat kunnen we met alle kennis over DNA en genen in de medische

Nadere informatie

High through put automatisering in de Genetica. Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 19 11 2014

High through put automatisering in de Genetica. Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 19 11 2014 High through put automatisering in de Genetica Ermanno Bosgoed ermanno.bosgoed@radboudumc.nl 19 11 2014 Inleiding Wie? Wat? Hoe? Automatisering / Robotisering Toekomst plannen Medewerkers Afdeling Genetica

Nadere informatie

B elangenverklaring. Persoonlijke gegevens aanvrager

B elangenverklaring. Persoonlijke gegevens aanvrager B elangenverklaring In het kader van de Code ter voorkoming van oneigenlijke beïnvloeding door belangenverstrengeling wordt alle beoogd betrokkenen bij de totstandkoming van wetenschappelijke adviesrapporten

Nadere informatie

Niet-Invasief Prenataal Testen: Nevenbevindingen, regionale en landelijke resultaten en een blik vooruit

Niet-Invasief Prenataal Testen: Nevenbevindingen, regionale en landelijke resultaten en een blik vooruit Niet-Invasief Prenataal Testen: Nevenbevindingen, regionale en landelijke resultaten en een blik vooruit Dr BHW Faas Laboratorium Specialist Klinische Genetica Radboud Universiteit Nijmegen Afdeling Genetica

Nadere informatie

Ook al heb je geen klachten, willen we graag dat je de vragenlijst invult.

Ook al heb je geen klachten, willen we graag dat je de vragenlijst invult. oktober 2013 Beste jongere, Tussen maart 2012 en maart 2013 ben je in het ziekenhuis geweest na het breken van je arm, sleutelbeen of been. Wij willen jou vragen mee te doen aan een onderzoek naar de gevolgen

Nadere informatie

WES-MR: Informatiebrief en toestemmingsformulier voor whole exome sequencing bij kinderen met een verstandelijke beperking

WES-MR: Informatiebrief en toestemmingsformulier voor whole exome sequencing bij kinderen met een verstandelijke beperking Betreft : Informatiebrief WES-MR: Informatiebrief en toestemmingsformulier voor whole exome sequencing bij kinderen met een verstandelijke beperking Geachte ouders, De arts van uw kind heeft aan u voorgesteld

Nadere informatie

Klinisch onderzoek bij kinderen en jongeren met kanker. wat is het en hoe werkt het?

Klinisch onderzoek bij kinderen en jongeren met kanker. wat is het en hoe werkt het? Klinisch onderzoek bij kinderen en jongeren met kanker wat is het en hoe werkt het? De behandeling van kinderen en jongeren met kanker vindt meestal plaats in combinatie met een klinisch onderzoek. We

Nadere informatie

Etiologisch onderzoek naar slechthorendheid op de kinderleeftijd. Sarina Kant & Rosanne van Velzen 27-09-2013

Etiologisch onderzoek naar slechthorendheid op de kinderleeftijd. Sarina Kant & Rosanne van Velzen 27-09-2013 Etiologisch onderzoek naar slechthorendheid op de kinderleeftijd Sarina Kant & Rosanne van Velzen 27-09-2013 Etiologisch onderzoek naar slechthorendheid op de kinderleeftijd Richtlijn Multidisciplinaire

Nadere informatie

Infobrochure INFORMATIE OVER GENOOMONDERZOEK IN DE GENETICA

Infobrochure INFORMATIE OVER GENOOMONDERZOEK IN DE GENETICA INFORMATIE OVER GENOOMONDERZOEK IN DE GENETICA Array Comparative Genomic Hybridization (array CGH) Single Nucleotide Polymorphism array (SNP array) Massive Parallel Sequencing (MPS) Versie 120150504 Design

Nadere informatie

Datum 8 september 2015 Onderwerp Antwoorden Kamervragen over de opslag van DNA data bij onder andere Google en Amazon

Datum 8 september 2015 Onderwerp Antwoorden Kamervragen over de opslag van DNA data bij onder andere Google en Amazon 1 > Retouradres Postbus 20301 2500 EH Den Haag Aan de Voorzitter van de Tweede Kamer der Staten-Generaal Postbus 20018 2500 EA DEN HAAG Bestuurlijke en Turfmarkt 147 2511 DP Den Haag Postbus 20301 2500

Nadere informatie

ALS Onderzoek. ALS biobank en database. ALS Onderzoek. Onderzoeksprojecten

ALS Onderzoek. ALS biobank en database. ALS Onderzoek. Onderzoeksprojecten ALS Onderzoek ALS Centrum Nederland doet onderzoek naar ALS, PLS en PSMA met als doel om zo snel mogelijk een behandeling voor deze ziektes te vinden. We verzamelen gegevens van zoveel mogelijk patiënten.

Nadere informatie

Vragenlijst Intakegesprek

Vragenlijst Intakegesprek Vragenlijst Intakegesprek Voorletters: Meisjesnaam: Roepnaam: Nationaliteit: Spreektaal: Gehuwd/samenwonend/anders: Achternaam partner: Voorletters en roepnaam partner: Geboortedatum partner: Welke achternaam

Nadere informatie

Keuzeproces voor het inrichten van een gerobotiseerd opslagsysteem. Gerard van Duijnhoven UMC St Radboud, Nijmegen Afdeling Genetica

Keuzeproces voor het inrichten van een gerobotiseerd opslagsysteem. Gerard van Duijnhoven UMC St Radboud, Nijmegen Afdeling Genetica Keuzeproces voor het inrichten van een gerobotiseerd opslagsysteem Gerard van Duijnhoven UMC St Radboud, Nijmegen Afdeling Genetica Inhoud Genetica Radboud Biobank Manuele sample opslag Geautomatiseerd

Nadere informatie

1. Inleiding. 2. Sequencing: de technieken. a. Sanger Sequencing. a. Next-generation Sequencing

1. Inleiding. 2. Sequencing: de technieken. a. Sanger Sequencing. a. Next-generation Sequencing MY STATEMENT PAPER Genoom sequencing kan een nuttige tool zijn voor verschillende toepassingen, maar diepgaande discussie is nodig om de mogelijke wetenschappelijke, sociale en ethische gevolgen in kaart

Nadere informatie

Informatiebrief deelnemers MIND-TIA: De waarde van een bloedtest bij verdenking op een TIA

Informatiebrief deelnemers MIND-TIA: De waarde van een bloedtest bij verdenking op een TIA Informatiebrief deelnemers MIND-TIA: De waarde van een bloedtest bij verdenking op een TIA Julius Centrum UMC Utrecht Geachte heer/mevrouw, Wij vragen u vriendelijk om mee te doen aan een medisch-wetenschappelijk

Nadere informatie

Erfelijkheidsonderzoek: de procedure

Erfelijkheidsonderzoek: de procedure Erfelijkheidsonderzoek: de procedure Divisie Biomedische Genetica, afdeling Genetica Erfelijkheidsonderzoek: de procedure Wanneer erfelijkheidsonderzoek? Er is reden voor een erfelijkheidsonderzoek als:

Nadere informatie

Wil ik het wel weten?

Wil ik het wel weten? Wil ik het wel weten? Vera Hovers en Joyce de Vos-Houben 3 oktober 2015 Wil ik het wel weten? De consequenties van erfelijkheidsonderzoek Vera Hovers en dr. Joyce de Vos-Houben Genetisch consulenten polikliniek

Nadere informatie

HET PARTNER-ONDERZOEK

HET PARTNER-ONDERZOEK Deelnemersinformatie en geïnformeerde voor de HIV-positieve partner HET PARTNER-ONDERZOEK Het PARTNER-onderzoek is een onderzoek naar stellen, waarbij: (i) de ene partner HIV-positief is en de ander HIV-negatief;

Nadere informatie

ORATIE Bruggen bouwen in de genetica, van patiënt naar genoom en weer terug

ORATIE Bruggen bouwen in de genetica, van patiënt naar genoom en weer terug ORATIE Bruggen bouwen in de genetica, van patiënt naar genoom en weer terug Conny M.A. van Ravenswaaij-Arts Bruggen bouwen in de genetica, van patiënt naar genoom en weer terug Rede uitgesproken door Dr.

Nadere informatie

Moleculaire revolutie in de pathologie: next generation sequencing

Moleculaire revolutie in de pathologie: next generation sequencing Moleculaire revolutie in de pathologie: next generation sequencing John Hinrichs, klinisch moleculair bioloog in de pathologie UMC Utrecht, afdeling pathologie De (moleculaire) pathologie maakt op dit

Nadere informatie

Ook al heb je geen klachten, graag willen we dat je de vragenlijst invult.

Ook al heb je geen klachten, graag willen we dat je de vragenlijst invult. oktober 2013 Beste jongere, Tussen maart 2012 en maart 2013 ben je in het ziekenhuis geweest voor onderzoek van je hoofd (hersenen) na bijvoorbeeld een val of ongeluk en daarom ontvang je deze uitnodiging.

Nadere informatie

Molecular Pathology for Pathologists. Pr P. Pauwels

Molecular Pathology for Pathologists. Pr P. Pauwels Molecular Pathology for Pathologists Pr P. Pauwels NGS moleculair pathologie rapport ontcijferen Nomenclatuur waarin gerapporteerd wordt: EGFR c.2573t>g, p.(leu858arg) Coderende sequentie Eiwit/proteïne

Nadere informatie

Standard Operating Procedure

Standard Operating Procedure Standard Operating Procedure SOP: V9 Initiatievisite Auteur Naam: Functie instelling/afdeling Judie van den Elshout Staffunctionaris Wetenschapsbureau Wetenschapsbureau / Cluster Leerhuis Handtekening:...

Nadere informatie

Mee-naar-huis-neem boodschappen 2015

Mee-naar-huis-neem boodschappen 2015 COIG cursusdag klinische genetica in de interne geneeskunde Mee-naar-huis-neem boodschappen 2015 Hes Bredenoord Bongers & Deegens Helderman-van der Enden & Rennenberg Hoedemaekers & Postema Menko en Smorenburg

Nadere informatie

Afdeling Medische Psychologie Informatie voor kinderen, jongeren en hun ouders

Afdeling Medische Psychologie Informatie voor kinderen, jongeren en hun ouders Afdeling Medische Psychologie Informatie voor kinderen, jongeren en hun ouders Je bent doorverwezen naar de afdeling Medische Psychologie van het Sint Anna Ziekenhuis. Deze brochure geeft je informatie

Nadere informatie

De antwoorden op vragen 1 en 2, 3 en 4, en 5 t/m 8 graag op verschillende vellen schrijven. Vergeet ook niet op de 3 vellen je naam en studentnr.

De antwoorden op vragen 1 en 2, 3 en 4, en 5 t/m 8 graag op verschillende vellen schrijven. Vergeet ook niet op de 3 vellen je naam en studentnr. Tentamen Genoombiologie, 28 Oktober 2009, 9.00-11.45 h De antwoorden op vragen 1 en 2, 3 en 4, en 5 t/m 8 graag op verschillende vellen schrijven. Vergeet ook niet op de 3 vellen je naam en studentnr.

Nadere informatie

Wie bent u en wat verwacht u van deze workshop? Verwachtingen managen rond genetisch testen. Hoe verloopt intake gesprek? Waar bent u werkzaam?

Wie bent u en wat verwacht u van deze workshop? Verwachtingen managen rond genetisch testen. Hoe verloopt intake gesprek? Waar bent u werkzaam? Wie bent u en wat verwacht u van deze workshop? Verwachtingen managen rond genetisch testen Akke Albada Margreet Ausems Afd. Medische Genetica UMC Utrecht Waar bent u werkzaam? Hebben uw patiënten onrealistische

Nadere informatie

Dragerschap en erfelijke belasting

Dragerschap en erfelijke belasting Dragerschap en erfelijke belasting VSOP 17 mei 2010 Martina Cornel Hoogleraar Community Genetics & Public Health Genomics Quality of Care EMGO Institute for Health and Care Research Nieuwe technologische

Nadere informatie

Informatie voor deelnemers aan erfelijkheidsonderzoek. Familiaire Amyotrofische Lateraal Sclerose in Nederland. Geachte heer/mevrouw,

Informatie voor deelnemers aan erfelijkheidsonderzoek. Familiaire Amyotrofische Lateraal Sclerose in Nederland. Geachte heer/mevrouw, Informatie voor deelnemers aan erfelijkheidsonderzoek Familiaire Amyotrofische Lateraal Sclerose in Nederland Geachte heer/mevrouw, Recent bent u benaderd door een van uw familieleden om mee te werken

Nadere informatie

TRIDENT studie. Mireille Bekker Gynaecoloog Radboud umc

TRIDENT studie. Mireille Bekker Gynaecoloog Radboud umc TRIDENT studie Mireille Bekker Gynaecoloog Radboud umc Historie April 2011 oprichting NIPT consortium Nederland TRIDENT studie: implementatie van lab tot uitslag ESPRIT studie: ethisch, economisch, maatschappelijk

Nadere informatie

Wat moet ik doen als assistente?

Wat moet ik doen als assistente? Wat moet ik doen als assistente? Ruggespraak Julius Centrum voor Gezondheidswetenschappen en Eerstelijns Geneeskunde Huisartsgeneeskunde, Huisartsopleiding Dorpsstraat 12-14 3732 HJ Utrecht Contactpersoon:

Nadere informatie

ONDERZOEK IN VLOKKEN OF VRUCHTWATER BIJ ECHOAFWIJKINGEN

ONDERZOEK IN VLOKKEN OF VRUCHTWATER BIJ ECHOAFWIJKINGEN ONDERZOEK IN VLOKKEN OF VRUCHTWATER BIJ ECHOAFWIJKINGEN ONDERZOEK IN VLOKKEN E VRUCHTWATER BIJ ECHOAFWIJKINGEN Afdeling Genetica UMCG 2 Onderzoek in vlokken of in vruchtwater bij echoafwijkingen. U bent

Nadere informatie

De rol van de verpleegkundige binnen Medischwetenschappelijk

De rol van de verpleegkundige binnen Medischwetenschappelijk De rol van de verpleegkundige binnen Medischwetenschappelijk onderzoek Moderator Mevr. R.C.A. Veldhoen-Tijben 1st author / speaker Miriam Gelderloos Co-author Erna Helmantel Belangenverklaring In overeenstemming

Nadere informatie

Hieronder vind je de uitgebreide privacy code van InsightYou. InsightYou: InsightYou B.V., gevestigd te Rotterdam, KvK 54690692.

Hieronder vind je de uitgebreide privacy code van InsightYou. InsightYou: InsightYou B.V., gevestigd te Rotterdam, KvK 54690692. Privacy Code. Hieronder vind je de uitgebreide privacy code van InsightYou. 1. Definities (in alfabetische volgorde). Biologische gegevens: de gegevens, verzameld uit het door jou aangeleverde biologisch

Nadere informatie

Thematische behoeftepeiling. Uitkomsten en conclusies van een brede enquête onder patiëntenorganisaties

Thematische behoeftepeiling. Uitkomsten en conclusies van een brede enquête onder patiëntenorganisaties Thematische behoeftepeiling Uitkomsten en conclusies van een brede enquête onder patiëntenorganisaties Inleiding In de komende jaren ontwikkelt de VSOP toerustende activiteiten voor patiëntenorganisaties

Nadere informatie

Genetic Counseling en Kanker

Genetic Counseling en Kanker Genetic Counseling en Kanker (erfelijke en familiaire kanker in de praktijk) dr Rolf Sijmons, klinisch geneticus afdeling Genetica UMC Groningen (Theoretische en) Practische aspecten Erfelijke Kanker Counseling

Nadere informatie

Bijlage I bij het Kaderreglement van het Parelsnoer Initiatief. Handleiding Parelspecifiek reglement

Bijlage I bij het Kaderreglement van het Parelsnoer Initiatief. Handleiding Parelspecifiek reglement Bijlage I bij het Kaderreglement van het Parelsnoer Initiatief Handleiding Parelspecifiek reglement Op grond van artikel 4 lid 17 van het Kaderreglement Parelsnoer Initiatief dient per Parel een reglement

Nadere informatie

website www.nvmetc.nl

website www.nvmetc.nl Verslag NVMETC secretarissenoverleg 19 juni 2014 1. Opening en vaststelling agenda Dhr. Davids geeft aan, dat een belangrijke reden van dit secretarissenoverleg is, dat we van elkaar horen wat er speelt

Nadere informatie

Infoblad. Als je weet dat je een baby met een aandoening krijgt

Infoblad. Als je weet dat je een baby met een aandoening krijgt Als je weet dat je een baby met een aandoening krijgt Soms krijgen ouders tijdens de zwangerschap te horen dat hun kind een aandoening heeft. Dan volgt een moeilijke keuze: laat je het kind komen of breek

Nadere informatie

Deelnemersinformatie en geïnformeerde toestemming voor de HIV-negatieve partner HET PARTNER-ONDERZOEK

Deelnemersinformatie en geïnformeerde toestemming voor de HIV-negatieve partner HET PARTNER-ONDERZOEK Deelnemersinformatie en geïnformeerde voor de HIV-negatieve partner HET PARTNER-ONDERZOEK Het PARTNER-onderzoek is een onderzoek naar stellen, waarbij: (i) de ene partner HIV-positief is en de ander HIV-negatief;

Nadere informatie

Vragen Genetica (Diederik de Bruijn) Omcirkel bij vraag 1 t/m 12 het juiste antwoord. Naam: Studentnummer:

Vragen Genetica (Diederik de Bruijn) Omcirkel bij vraag 1 t/m 12 het juiste antwoord. Naam: Studentnummer: Vragen Genetica (Diederik de Bruijn) Omcirkel bij vraag 1 t/m 12 het juiste antwoord 1. Onderstaande stamboom is van een familie waarin het EEC syndroom voorkomt. Er is sprake van autosomaal dominante

Nadere informatie

Jouw digitale wereld safe & social

Jouw digitale wereld safe & social HANDLEIDING BIJ DE DIGITALE LES Jouw digitale wereld safe & social Wat is slim en wat kun je beter niet doen online? In de digitale les Jouw digitale wereld safe & social maken leerlingen kennis met de

Nadere informatie

Het formulier zal na beoordeling openbaar worden gemaakt. Hoofdfunctie[s) Graag omvang perfunctie vermelden als u meerderefuncties heeft

Het formulier zal na beoordeling openbaar worden gemaakt. Hoofdfunctie[s) Graag omvang perfunctie vermelden als u meerderefuncties heeft B elangenverklaring In het kader van de Code ter voorkoming van oneigenlijke beïnvloeding door belangenverstrengeling wordt alle beoogd betrokkenen bij de totstandkoming van wetenschappelijke adviesrapporten

Nadere informatie

Therapie, Counselling en Coaching

Therapie, Counselling en Coaching Informed Consent Therapie, Counselling en Coaching Wij werken volgens de beroepscode van het Nederlands Instituut van Psychologen (NIP). Informatie hierover kunt u vinden op de website van het NIP: www.psynip.nl

Nadere informatie

Valkuilen bij niet-invasieve foetale RhD typering Florentine F. Thurik

Valkuilen bij niet-invasieve foetale RhD typering Florentine F. Thurik Valkuilen bij niet-invasieve foetale RhD typering Florentine F. Thurik Arts onderzoeker Afdeling Experimentele Immunohematologie Sanquin Research, Amsterdam, The Netherlands f.thurik@sanquin.nl Prenatale

Nadere informatie

Deelname aan wetenschappelijk onderzoek

Deelname aan wetenschappelijk onderzoek Sophia Kinderziekenhuis Erasmus MC -Sophia Kinderziekenhuis is een universitair medisch centrum. Dit betekent dat er niet alleen kinderen worden behandeld en verpleegd, maar dat er ook medisch wetenschappelijk

Nadere informatie

BIOKLOK DE BIOLOGISCHE KLOK IN DE LES MODULE B VWO. klok. www. bio. .nl

BIOKLOK DE BIOLOGISCHE KLOK IN DE LES MODULE B VWO. klok. www. bio. .nl BIOKLOK DE BIOLOGISCHE KLOK IN DE LES MODULE B VWO www. bio klok.nl BIOKLOK MODULE B VWO VERSTOORDE CHRONOTYPES INLEIDING Als het goed is, heb je een vragenlijst ingevuld om te testen of je een ochtendmens

Nadere informatie

Ethische aspecten bij postnataal etiologisch onderzoek. Wat willen we weten en waarom? Kristien Hens, PhD, Departement Wijsbegeerte, UA

Ethische aspecten bij postnataal etiologisch onderzoek. Wat willen we weten en waarom? Kristien Hens, PhD, Departement Wijsbegeerte, UA Ethische aspecten bij postnataal etiologisch onderzoek. Wat willen we weten en waarom? Kristien Hens, PhD, Departement Wijsbegeerte, UA Doel van de voordracht Het bespreken van ethische en filosofische

Nadere informatie

Medical ethics & genomics Current legal framework and FAQ. Eline Bunnik Genomic Resequencing in Medical Diagnostics 24 September 2015

Medical ethics & genomics Current legal framework and FAQ. Eline Bunnik Genomic Resequencing in Medical Diagnostics 24 September 2015 Medical ethics & genomics Current legal framework and FAQ Eline Bunnik Genomic Resequencing in Medical Diagnostics 24 September 2015 First of all: NGS is here NGS is becoming a standard diagnostic tool

Nadere informatie

Stand van zaken. Ondertussen ruim 27.000 familieleden met FH gevonden. Database met 65.000 individueen uit 5.000 stambomen

Stand van zaken. Ondertussen ruim 27.000 familieleden met FH gevonden. Database met 65.000 individueen uit 5.000 stambomen Van naar Start van de StOEH Ontwikkeld door de afdeling geneeskunde van het AMC 1994 Initiatiefnemers: Prof. dr. J.J.P Kastelein Dr. Ir. J.C. Defesche 1994-2001 700 1000 FH patienten / jaar April 2003

Nadere informatie

Medischwetenschappelijk. onderzoek. Algemene informatie voor de proefpersoon

Medischwetenschappelijk. onderzoek. Algemene informatie voor de proefpersoon Medischwetenschappelijk onderzoek Algemene informatie voor de proefpersoon Inhoud Inleiding 5 Medisch-wetenschappelijk onderzoek 6 Wat is medisch-wetenschappelijk onderzoek? Wat zijn proefpersonen? Wie

Nadere informatie

Klinische Genetica. Erfelijkheidsonderzoek en -voorlichting

Klinische Genetica. Erfelijkheidsonderzoek en -voorlichting Klinische Genetica Erfelijkheidsonderzoek en -voorlichting Klinische Genetica Inhoud Inleiding 3 Een verzoek om erfelijkheidsonderzoek en -voorlichting 3 Wachten op de uitslag 3 Kosten 4 Het doel van

Nadere informatie

onderzoek Invloed van UVB lichttherapie op huid en darmflora.

onderzoek Invloed van UVB lichttherapie op huid en darmflora. Uw behandelend arts of de onderzoeker heeft u geïnformeerd over het medisch-wetenschappelijk onderzoek Invloed van UVB lichttherapie op huid en darmflora. U beslist zelf of u wilt meedoen. Om deze beslissing

Nadere informatie

Verklarende Woordenlijst

Verklarende Woordenlijst 12 Verklarende Woordenlijst Gebaseerd op een woordenlijst die werd ontwikkeld door Londen IDEAS Genetic Knowledge Park aangepast volgens hun kwaliteitsnormen. Juli 2008 Vertaald door Mies Wits-Douw en

Nadere informatie

Ik weet dat mijn gegevens anoniem zullen worden toegevoegd aan een databestand dat voor wetenschappelijke doeleinden gebruikt wordt.

Ik weet dat mijn gegevens anoniem zullen worden toegevoegd aan een databestand dat voor wetenschappelijke doeleinden gebruikt wordt. Toestemmingsverklaring: Ik heb informatie gekregen over de inhoud, methode en het doel van het onderzoek. Ik weet dat de gegevens en resultaten van het onderzoek alleen anoniem en vertrouwelijk gebruikt

Nadere informatie

Duchenne/Becker spierdystrofie in de familie, zijn. vrouwen getest met behulp van DNA onderzoek?

Duchenne/Becker spierdystrofie in de familie, zijn. vrouwen getest met behulp van DNA onderzoek? Duchenne/Becker spierdystrofie in de familie, zijn vrouwen getest met behulp van DNA onderzoek? Paula Helderman-van den Enden, klinisch geneticus, Leiden en Maastricht Inleiding: In het kader van mijn

Nadere informatie

DTL focus meeting Ongoing initiatives to establish automated links between clinical care and clinical research

DTL focus meeting Ongoing initiatives to establish automated links between clinical care and clinical research DTL focus meeting Ongoing initiatives to establish automated links between clinical care and clinical research UMC Utrecht Robert Veen, projectleider Research Data Platform Programma Research ICT EPD s

Nadere informatie

Psychodiagnostisch onderzoek voor kinderen en jeugdigen jonger dan 16 jaar. Informatie voor jeugdigen (12-16 jaar)

Psychodiagnostisch onderzoek voor kinderen en jeugdigen jonger dan 16 jaar. Informatie voor jeugdigen (12-16 jaar) Psychodiagnostisch onderzoek voor kinderen en jeugdigen jonger dan 16 jaar Informatie voor jeugdigen (12-16 jaar) Psychodiagnostisch onderzoek bij kinderen en jeugdigen jonger dan 16 jaar Informatie voor

Nadere informatie

Voormeting kandidaat

Voormeting kandidaat K1 Voormeting kandidaat Beste kandidaat, Het CBR is aan het onderzoeken of het nieuwe faalangstexamen voldoet aan de verwachtingen en aan de eisen van de minister van Verkeer en Waterstaat. Dit onderzoek

Nadere informatie

Zoek het uit! Opdrachten. Studiekeuze123.nl

Zoek het uit! Opdrachten. Studiekeuze123.nl Zoek het uit! Opdrachten Studiekeuze123.nl Wat denk je zelf? Het maken van een studiekeuze is niet gemakkelijk. Er zijn zoveel mogelijkheden, maar welke studie past goed bij jou? Misschien weet je al jaren

Nadere informatie

Onderzoek: Studiekeuze

Onderzoek: Studiekeuze Onderzoek: Studiekeuze Publicatiedatum: 31-01- 2014 Over dit onderzoek Aan dit online onderzoek, gehouden van 29 t/m 31 januari 2014, deden 712 scholieren en 1064 studenten mee. De uitslag van de peiling

Nadere informatie

SEMINAR 4 NOVEMBER 2014

SEMINAR 4 NOVEMBER 2014 SEMINAR 4 NOVEMBER 2014 Professioneel opzetten en uitvoeren van klinisch onderzoek www.deresearchmanager.nl Striksteeg 7 7411 KR Deventer 0570 594 789 info@deresearchmanager.nl Innovatief klinisch onderzoek,

Nadere informatie

Welkom bij Centrum Jeugd. Informatie voor kinderen, jongeren en hun familieleden

Welkom bij Centrum Jeugd. Informatie voor kinderen, jongeren en hun familieleden Welkom bij Centrum Jeugd Informatie voor kinderen, jongeren en hun familieleden Welkom bij Centrum Jeugd Je gaat deelnemen aan een van de behandelingen bij Centrum Jeugd van GGz Breburg. De behandelaren

Nadere informatie

Biobanken zijn overal

Biobanken zijn overal Vol mensenkennis Annual Special Issue van Time, 2009 Biobanken zijn overal Biobanken zijn overal Nationaal en internationaal is er een groeiende behoefte aan grootschalige dataen biobanken ten behoeve

Nadere informatie

Peilstation Intensief Melden

Peilstation Intensief Melden Peilstation Intensief Melden Nederlands Centrum voor Beroepsziekten AMC Presentatie casus beroepsziekte en Capita Selecta 5 e PIM workshop, najaar 2013 Nederlands Centrum voor Beroepsziekten, AMC/Coronel

Nadere informatie

DIABETOgen Test. Diabetes mellitus Typ II. Risico s in kaart. Diabetes Mellitus

DIABETOgen Test. Diabetes mellitus Typ II. Risico s in kaart. Diabetes Mellitus DIABETOgen Test Diabetes mellitus Typ II Prof Dr. B. Weber Laboratoires Réunis Risico s in kaart De DIABETOgen test biedt u de mogelijkheid uw persoonlijk risico en predispositie op diabetes mellitus type

Nadere informatie

BRAF rondzending SKML 2012

BRAF rondzending SKML 2012 BRAF rondzending SKML 2012 Presentatie van de resultaten op de deelnemersbijeenkomst 5 februari 2013 Riki Willems Patricia Groenen Willeke Blokx Adriaan van den Brule Casus 1 Langerhanscel histiocytose

Nadere informatie

Informatiebrief voor patiënten. Vullingsstrategie bij bloedverlies tijdens de bevalling

Informatiebrief voor patiënten. Vullingsstrategie bij bloedverlies tijdens de bevalling Informatiebrief voor patiënten Vullingsstrategie bij bloedverlies tijdens de bevalling NL42942.068.13 Versie 4 18-11.2013 Geachte mevrouw, U bent voor uw zwangerschap onder controle in het academisch ziekenhuis

Nadere informatie

Cover Page. The handle http://hdl.handle.net/1887/35456 holds various files of this Leiden University dissertation.

Cover Page. The handle http://hdl.handle.net/1887/35456 holds various files of this Leiden University dissertation. Cover Page The handle http://hdl.handle.net/1887/35456 holds various files of this Leiden University dissertation. Author: Hassan, Suha Mustafa Title: Toward prevention of Hemoglobinopathies in Oman Issue

Nadere informatie

PATIENTEN INFORMATIE

PATIENTEN INFORMATIE Thrombofilie, ontsteking en waarden in het bloed van hart- en vaatziekten in HIV-geïnfecteerde patiënten. Protocol title: INF-BEAST PATIENTEN INFORMATIE Informatiebrief INF-BEAST pagina 1 van 7 Titel van

Nadere informatie

Mannen en BRCA1/2. Ingrid van Kessel/Conny van der Meer genetisch consulenten, afdeling Klinische Genetica Erasmus MC Rotterdam 18 april 2009

Mannen en BRCA1/2. Ingrid van Kessel/Conny van der Meer genetisch consulenten, afdeling Klinische Genetica Erasmus MC Rotterdam 18 april 2009 Mannen en BRCA1/2 Ingrid van Kessel/Conny van der Meer genetisch consulenten, afdeling Klinische Genetica Erasmus MC Rotterdam 18 april 2009 Rudi van Dantzig Danser en choreograaf Risico borstkanker Bevolkingsrisico

Nadere informatie