Op Wandel met Walvissen

Maat: px
Weergave met pagina beginnen:

Download "Op Wandel met Walvissen"

Transcriptie

1 Vliebergh-Sencie Biologie 2009 Op Wandel met Walvissen Evolutie in het Museum voor Dierkunde I. Het evolutieparcours in het museum De brochure I think... Evolutie in het Museum voor Dierkunde kan je downloaden op II. Opdracht Overgangsvormen in het fossiel archief zijn een belangrijk bewijs voor het concept van afstamming van een gemeenschappelijke voorouder. Fossielen tonen aan dat de viervoeters ontstaan zijn uit een bepaalde groep beenvissen (de Actinistia), vogels uit een groep van dinosauriërs, en walvissen uit op het land levende zoogdieren met vier poten. Paleontologen vonden in de VS, Egypte en Pakistan uitgestorven walvissensoorten (Basilosaurus) waarvan sommige achterpoten met kniegewrichten hadden. Alle fossiele walvissen die tot voor kort bekend waren, waren evenwel volledig aquatische soorten, uitgezonderd Ambulocetus, die een amfibische levenswijze kende (zoals zeeleeuwen). Recent werden in Pakistan fossiele resten ontdekt van Pakicetus, de oudst gekende walvissensoort (50 miljoen jaar oud) die bovendien volledig terrestrisch was. In deze opdracht stellen we ons de vraag: Aan welke zoogdierengroep zijn de walvissen het meest verwant?. De recente walvissen zijn door divergente evolutie uiterlijk zo verschillend geworden van de andere zoogdieren, dat deze vraag moeilijk te beantwoorden is. Bovendien verschilt de schedel- en skeletstructuur van walvissen sterk van die van andere zoogdieren, en zijn fossielen van primitieve walvissen vrij zeldzaam en meestal onvolledig. Op basis van de structuur van de tanden en het oor, gingen paleontologen ervan uit dat de Mesonychia, een groep van uitgestorven, grote, carnivore hoefdieren die leefden in het vroege Tertiair, de nauwste verwanten van de walvissen waren. De recent ontdekte Pakicetus-fossielen werpen een nieuw licht op deze kwestie.

2 Pakicetus, de oudst gekende walvis, was volledig terrestrisch. Ambulocetus kende een amfibische levenswijze. Dorudon was een volledig aquatische primitieve walvis, maar behield toch een scharnierend ellebooggewricht en rudimentaire achterpoten. Balaena is een recente walvis. De skeletten zijn niet op schaal getekend. Homologe en rudimentaire structuren bij walvisachtigen. De voorpoot van walvisachtigen (hier de Irrawaddydolfijn, Orcaella brevirostris) gelijkt uiterlijk op een vin, maar bestaat uit gelijkaardige (homologe) beenderen als de voorpoten van andere viervoeters. Achteraan in het lichaam heeft de dolfijn nog restanten van de bekkengordel. Bij voorouders van de walvisachtigen, zoals de uitgestorven Dorudon atrox, waren de bekkengordel en de achterpoten nog sterker ontwikkeld. In de loop van de evolutie zijn ze gedegenereerd tot de rudimentaire structuren zonder functie bij de huidige walvisachtigen. (uit De Wetenschap van het Leven. Over eenheid in biologische diversiteit., B. De Groef & P. Roels, Uitgeverij Acco) 2 Op Wandel met Walvissen

3 Bekijk de structuur van de enkelbeentjes (astragali) van fossiele en levende hoefdieren en walvissen (zie figuur hieronder). Astragali van fossiele en levende hoefdieren en walvissen. Phenacodus was een primitieve onevenhoevige (63 miljoen jaar geleden); Pachyaena een mesonychide (55 miljoen jaar geleden); Pakicetus een primitieve walvis (50 miljoen jaar geleden); Diacodexis de oudst gekende evenhoevige (55 miljoen jaar geleden); Sus het huidig levende varken, een evenhoevige. Tot de huidig levende onevenhoevigen, hoefdieren met een oneven aantal tenen (1, 3 of 5), behoren paarden, neushoorns en tapirs. Tot de huidig levende evenhoevigen, hoefdieren met een even aantal tenen (2, 4 of 6), behoren ondermeer runderen, herten, giraffen, varkens en nijlpaarden. Schrap wat niet past: - De enkels van Mesonychia lijken op die van EVENHOEVIGEN / ONEVENHOEVIGEN. - De enkels van primitieve walvissen (Pakicetus) lijken het meest op die van ONEVENHOEVIGEN / MESONYCHIA / EVENHOEVIGEN. - Afgaand op deze observaties, delen de walvissen waarschijnlijk het recentst een gemeenschappelijke voorouder met de ONEVENHOEVIGEN / MESONYCHIA / EVENHOEVIGEN. Gelijkenissen tussen organismen zijn niet beperkt tot de anatomie; ook op het moleculair niveau vertonen organismen overeenkomsten. Sommige homologieën, zoals de universele genetische code, komen bij alle organismen voor omdat ze teruggaan tot een zeer verre gemeenschappelijke voorouder. Homologieën die recenter evolueerden, worden door kleinere takken van de stamboom gedeeld. DNA-sequenties van verschillende organismen kunnen met elkaar vergeleken worden. Wanneer een bepaalde sequentie wordt overgeërfd van een voorouder, zal die in de loop van de tijd mutaties accumuleren, meestal zonder significant effect op de genfunctie. Naarmate twee organismen langer afgesplitst zijn van hun gemeenschappelijke voorouder, des te meer mutaties zullen er opgetreden zijn en des te meer verschillen zullen we terugvinden in hun DNA-sequenties. In het algemeen wijst een grotere gelijkenis in deze sequenties op een nauwere verwantschap. Op de volgende pagina vind je 11 sequenties die (een deel van) de basensequentie van het gen voor β-caseïne (een melkeiwit) bij verschillende zoogdieren weergeven. De noordkaper, potvis en bruinvis zijn walvisachtigen. De neushoorn is een onevenhoevige en dient als vergelijkingspunt of outgroup ; alle overige dieren zijn evenhoevigen. Pekari s of navelzwijnen zijn evenhoevigen verwant met varkens. Vergelijk de Op Wandel met Walvissen 3

4 sequenties twee aan twee en noteer het aantal verschillende baseparen in de tabel. Noordkaper: Potvis: Bruinvis: Giraf: Nijlpaard: Koe: Kameel: Hert: Varken: Pekari: Neushoorn: AATCCCCAAAGCTAAGGAGACTATCCTTCCTAAGCATAAAGAAATGCCCTTCCCTATATC AGTCCCCAAAGCTAAGGAGACTCTCCTTCCTAAGCATAAAGAAATGCCCTTCCCTAAATC AGTCCCCAAAGCTAAGGAGACTATCCTTCCTAAGCATAAAGAAATGCGCTTCCCTAAATC AGTCTCCAAAGTGAAGGAGACTATGGCTCCTAAGCACAAAGAAATGCCCTTCCCTAAATA AGTCCCCAAAGCAAAGGAGACTATCCTTCCTAAGCATAAAGAAATGCCCTTCTCTAAATC AGTCCCCAAAGTGAAGGAGACTATGGTTCCTAAGCACAAGGAAATGCCCTTCCCTAAATA TGTCCCCAAAACTAAGGAGACCATCATTCCTAAGCGCAAAGAAATGCCCTTGCTTCAGTC AGTCTCCGAAGTGAAGGAGACTATGGTTCCTAAGCACGAAGAAATGCCCTTCCCTAAATA AGATTCCAAAGCTAAGGAGACCATTGTTCCCAAGCGTAAAGGAATGCCCTTCCCTAAATC AGACCCCAAACCTAAGGAGACCGTTGTTCACAAGCGTAAAGGAATGTCCTCCCCTAAATC AGTCCTCCAAACTAAGGAGACCATCTTTCCTAAGCTCAAAGTTATGCCCTCCCTTAAATC potvis bruinvis giraf nijlpaard koe kameel hert varken pekari neushoorn noordkaper potvis bruinvis giraf nijlpaard koe kameel hert varken pekari Welke soorten verschillen slechts 2 tot 4 basenparen in de DNA-sequentie? 2 bp... 4 Op Wandel met Walvissen

5 4 bp... 4 bp... Merk op dat er in deze lijst 4 soorten voorkomen die in alle mogelijke combinaties met elkaar voorkomen. Welke 4 soorten zijn dit? Daarnaast zijn er nog 3 soorten die in hun eigen 3 mogelijke combinaties voorkomen. Welke 3 soorten zijn dit? Verschillen van 5-6 basenparen vinden we niet terug. Welke soorten verschillen 7 basenparen van elkaar? Alle andere soortencombinaties hebben tussen de 8 en 18 basenparen verschillend in dit DNA-fragment. Welke 2 soorten zijn nu nog niet opgesomd? Wat vertellen deze gegevens je over de verwantschappen van de evenhoevigen en walvissen? Om terug te komen op onze oorspronkelijke vraag: welk van de huidig levende evenhoevigen is volgens deze moleculaire analyse het nauwst verwant met de walvissen? Omwille van de nauwe verwantschap tussen evenhoevigen (Artiodactyla) en walvissen (Cetacea), stellen sommige onderzoekers voor om beide orden te laten versmelten tot één enkele orde, Cetartiodactyla. Tracht zelf een stamboom van de Cetartiodactyla te schetsen. Op Wandel met Walvissen 5

6 Waar ondervond je moeilijkheden bij het tekenen van de stamboom? Hoe zou je dit trachten op te lossen? Samenstelling: Bert De Groef; gebaseerd op: - Whale Ankles and DNA. L. Flammer (2007) ENSI, Evolution and the Nature of Science Institute. - Walking with Whales. C. de Muizon (2001) Nature 413, Op Wandel met Walvissen

7 Verschijnt najaar 2009: Bert De Groef en Peter Roels De wetenschap van het leven Over eenheid in biologische diversiteit Uitgeverij acco Ons verhaal begint zo'n 3,8 miljard jaar geleden. Niets deed vermoeden dat de primitieve oercellen van toen aanleiding zouden geven tot de gigantische biodiversiteit van vandaag. Daarbij komen de meest wonderbaarlijke aanpassingen voor. Zo overtreffen planten, die hele ecosystemen van energie voorzien, de efficiëntie van elk zonnepaneel, hebben runderen complexe magen met micro-organismen die hen toelaten op gras te overleven, en omzeilen bacteriën steeds weer nieuwe antibiotica. De wetenschap die de verwondering over zoveel vernuft vertaalt naar concrete wetenschappelijke vragen en experimenten, is de biologie, de studie van het leven. Omdat alle levensvormen een gemeenschappelijke oorsprong delen, vertonen ze een opmerkelijke uniformiteit. Dat ze opgebouwd zijn uit één of meerdere cellen, DNA gebruiken als erfelijk materiaal en eenzelfde genetische code hanteren, zijn maar enkele voorbeelden die we onder de loep nemen. Vervolgens gaan we dieper in op de diversiteit van het leven: hoe passen organismen zich aan hun omgeving aan, tot welke verscheidenheid aan soorten leiden de evolutieprocessen, en hoe treden al die soorten met elkaar in interactie? Ten slotte beantwoorden we de vraag waarom de impact van de mens eigenlijk slechts een jong twijgje aan de Stamboom van het Leven - zo ingrijpend is. BERT DE GROEF is onderzoeker aan de Afdeling Dierenfysiologie en Neurobiologie binnen het Departement Biologie van de K.U.Leuven. Hij is betrokken bij verschillende projecten omtrent wetenschapsverspreiding. PETER ROELS werkt als studiebegeleider biologie op het monitoraat van de Faculteit Wetenschappen van de K.U.Leuven. Hij publiceerde meerdere wetenschapspopulariserende artikels voor leraren biologie. Dit boek kwam tot stand op initiatief van de Onderwijscommissie Biologie en met de medewerking van verschillende leden van het Departement Biologie van de K.U.Leuven. Op Wandel met Walvissen 7

Evolutie, wat is dat nu feitelijk?!

Evolutie, wat is dat nu feitelijk?! Evolutie, wat is dat nu feitelijk?! Heb je je wel eens afgevraagd waarom er zo veel verschillende soorten vlinders, vogels of vissen zijn? Waarom is er niet gewoon één soort van die dieren? Er is toch

Nadere informatie

Katholieke Universiteit Leuven, 2009! Samenstelling: Bert De Groef! Lay-out: Sylvia Grommen & Bert De Groef! Met de financiële steun van! vzw!

Katholieke Universiteit Leuven, 2009! Samenstelling: Bert De Groef! Lay-out: Sylvia Grommen & Bert De Groef! Met de financiële steun van! vzw! Katholieke Universiteit Leuven, 2009! Samenstelling: Bert De Groef! Lay-out: Sylvia Grommen & Bert De Groef! Met de financiële steun van! vzw! ➎ ➓ ➎ ➏ ➏ ➑ Benedenverdieping! ➒ ➍ ➐ ➊ ➏ ➋ ➌ Bovenverdieping!

Nadere informatie

Darwin en de evolutieleer

Darwin en de evolutieleer Darwin en de evolutieleer Joost Raeymaekers science4fun - 16 oktober 2009 Wie was Charles Darwin? - Een echte Engelsman uit de vorige eeuw (geboren in 1809) - Wetenschapper - Studeerde biologie, de leer

Nadere informatie

Paleontologie, de studie van fossielen die gebruikt wordt om een beeld te krijgen over de geschiedenis van het leven op aarde.

Paleontologie, de studie van fossielen die gebruikt wordt om een beeld te krijgen over de geschiedenis van het leven op aarde. Paleontologie, de studie van fossielen die gebruikt wordt om een beeld te krijgen over de geschiedenis van het leven op aarde. Fig. 22-3 Verschillende aardlagen, Ontstaan in verschillende tijden Jongere

Nadere informatie

Veel onderzoek kan gedaan worden door dingen direct te observeren in de natuur, of te bestuderen in het laboratorium. Sommige biologische processen

Veel onderzoek kan gedaan worden door dingen direct te observeren in de natuur, of te bestuderen in het laboratorium. Sommige biologische processen Samenvatting SAMENVATTING Veel onderzoek kan gedaan worden door dingen direct te observeren in de natuur, of te bestuderen in het laboratorium. Sommige biologische processen zijn echter extreem langzaam,

Nadere informatie

Evolutie: De ontwikkeling van het leven op aarde waarbij soorten ontstaan, veranderen en/of verdwijnen.

Evolutie: De ontwikkeling van het leven op aarde waarbij soorten ontstaan, veranderen en/of verdwijnen. Evolutie: De ontwikkeling van het leven op aarde waarbij soorten ontstaan, veranderen en/of verdwijnen. Evolutietheorie: Vanaf de 18 de eeuw. Het is niet te bewijzen, maar er zijn genoeg argumenten die

Nadere informatie

KATIE SCOTT JENNY BROOM. Het dierenboek. Een fascinerende reis door het dierenrijk

KATIE SCOTT JENNY BROOM. Het dierenboek. Een fascinerende reis door het dierenrijk KATIE SCOTT en JENNY BROOM Het dierenboek Een fascinerende reis door het dierenrijk HET DIERENBOEK Voorwoord De aarde is de enige planeet waarvan we zeker weten dat er leven op bestaat. De levende wezens

Nadere informatie

Meercellig Tweezijdig symmetrisch Exoskelet. Dit is een stekelhuidige

Meercellig Tweezijdig symmetrisch Exoskelet. Dit is een stekelhuidige Meercellig Tweezijdig symmetrisch Exoskelet Dit is een stekelhuidige Dit is een stekelhuidige Meercellig Tweezijdig symmetrisch Exoskelet Dit is een geleedpotige Geleedpotigen ontstonden ongeveer tegelijk

Nadere informatie

2. We nu nog levende katachtige is volgens deze stamboom het meest verwant aan de Poema? A de Cheeta B de Europese lynx C de Huiskat D de Jaguar

2. We nu nog levende katachtige is volgens deze stamboom het meest verwant aan de Poema? A de Cheeta B de Europese lynx C de Huiskat D de Jaguar 14 C datering De techniek van werken met het verval van 14 C is afkomstig uit onderzoek naar de ouderdom van bepaalde fossielen. De halfwaardetijd van 14 C is 5730 jaar. Over dit onderzoek worden twee

Nadere informatie

En toen kwam Darwin. On the origin of species. 1. Het ontstaan van het leven. Fossielen. 2. Getuigen van deevolutietheorie

En toen kwam Darwin. On the origin of species. 1. Het ontstaan van het leven. Fossielen. 2. Getuigen van deevolutietheorie On the origin of species En toen kwam Darwin 1. Het ontstaan van het leven 2. Getuigen van deevolutietheorie Verklaring voor het ontstaan van leven komt voor in alle culturen. Creationisme Nemen de bijbel

Nadere informatie

1. Fossielen, dood of levend?

1. Fossielen, dood of levend? 1. Fossielen, dood of levend? Op veel plaatsen op aarde kun je fossielen vinden. Deze oeroude overblijfselen van organismen vertellen een deel van het levensverhaal van de aarde. Soms worden er planten

Nadere informatie

1. Mensapen (mensapengebouw, binnen en buiten) Welke ledematen zijn het langst bij de chimpansee?

1. Mensapen (mensapengebouw, binnen en buiten) Welke ledematen zijn het langst bij de chimpansee? Koninklijke Maatschappij voor Dierkunde van Antwerpen Educatieve dienst Werkblad ATLETEN te WATER, te LAND en in de LUCHT: beweging bij gewervelde dieren. Naam: Klas: Het is je taak om te observeren. En

Nadere informatie

Museumexpeditie Werkboek 12-14 jaar

Museumexpeditie Werkboek 12-14 jaar Museumexpeditie Werkboek 12-14 jaar Naam: Inleiding Welkom in Natuurmuseum Fryslân. Wat leuk dat je ons museum bezoekt! Dit werkboekje leidt je rond door bijna het hele museum. Als je de bordjes van de

Nadere informatie

Oriëntatiejaar Life Sciences

Oriëntatiejaar Life Sciences Oriëntatiejaar Life Sciences Oriëntatiejaar Life Sciences Joan Wellink (studieadviseur) Voor wie is het oriëntatiejaar? Wat is het oriëntatiejaar? Wat heb je nodig? Hoe en wat studeer je? Wat kun je er

Nadere informatie

Galerij van de Evolutie

Galerij van de Evolutie Galerij van de Evolutie Werkblad Niveau 3 RODE DRAAD 1) De galerij van de evolutie leidt je in 6 hoofdstukken van het prille leven tot de huidige tijd. Uiteraard beperkt evolutie zich niet tot deze 6 periodes

Nadere informatie

10. 11. b - 8. een dikke vetlaag hebben. een dunne vacht hebben. een middagdutje doen. een witte vacht hebben. hele grote oren hebben

10. 11. b - 8. een dikke vetlaag hebben. een dunne vacht hebben. een middagdutje doen. een witte vacht hebben. hele grote oren hebben b - 8 10. Ga naar het verblijf van de fennek (in het Kleine-Zoogdierenhuis). Deze woestijnvos leeft in de Sahara (in Afrika) waar het in de zomer heel heet en droog is. In Noord- Amerika en Noord-Europa

Nadere informatie

De evolutiebioloog als detective

De evolutiebioloog als detective De evolutiebioloog als detective Bart Klink September 2006 Veel mensen hebben grote moeite om zich voor te stellen dat het leven zoals we het nu kennen het product is van ruim 3,5 miljard jaar evolutie.

Nadere informatie

Paarden zijn hoefdieren: dieren met hoeven aan hun voeten. Een hoef is een hele dikke nagel die de poot beschermt.

Paarden zijn hoefdieren: dieren met hoeven aan hun voeten. Een hoef is een hele dikke nagel die de poot beschermt. [Junior Winkler Prins online; lemma paard ] paard Paarden zijn hoefdieren. Er zijn verschillende rassen gefokt als rij- en trekdier. Er komt nog één soort in het wild voor. Ook de ezels en en zebra s zijn

Nadere informatie

Museumexpeditie. Naam:

Museumexpeditie. Naam: 1 Museumexpeditie Naam: 1 Inleiding Welkom in het Natuurmuseum Fryslân. Wat leuk dat je ons museum bezoekt! Dit werkboekje leidt je rond door het hele museum. Als je de bordjes van de museumroute volgt,

Nadere informatie

Eindexamen havo biologie pilot 2012 - II

Eindexamen havo biologie pilot 2012 - II Groenlander van weleer geeft zijn DNA prijs Voor het schrijven van een essay over De geschiedenis afbeelding 1 van de mensheid vonden Luc en Bas, twee leerlingen uit HAVO-5, een artikel in een krant over

Nadere informatie

Beest binnenste buiten

Beest binnenste buiten Beest binnenste buiten Lesbrief websessie Een kijkje achter de schermen van museum Naturalis voor klas 1 en 2 (VMBO/H/V) lesbrief Beest binnenste buiten 1 Introductieles 2 Beschrijving websessie 3 Afsluiting

Nadere informatie

Voorbereiding toelatingsexamen arts/tandarts. Biologie: evolutieleer 6/29/2013. dr. Brenda Casteleyn

Voorbereiding toelatingsexamen arts/tandarts. Biologie: evolutieleer 6/29/2013. dr. Brenda Casteleyn Voorbereiding toelatingsexamen arts/tandarts Biologie: evolutieleer 6/29/2013 dr. Brenda Casteleyn Met dank aan: Leen Goyens (http://users.telenet.be/toelating) en studenten van forum http://www.toelatingsexamen-geneeskunde.be

Nadere informatie

Gebruik de informatie over het Tsjaadmeer op de vorige bladzijde om onderstaande vragen te beantwoorden.

Gebruik de informatie over het Tsjaadmeer op de vorige bladzijde om onderstaande vragen te beantwoorden. 10.000 8000 6000 4000 2000 0 1000 n.chr. diepte in meters TSJAADMEER Figuur 1 toont de niveauveranderingen van het Tsjaadmeer, in de Noord-Afrikaanse Sahara. Ongeveer 20.000, tijdens de laatste ijstijd,

Nadere informatie

De Evolutietheorie Door: Gijs Steur (Jur was ziek) Klas: B2a Docent: ERH Datum: 11 06 2014 1

De Evolutietheorie Door: Gijs Steur (Jur was ziek) Klas: B2a Docent: ERH Datum: 11 06 2014 1 De Evolutietheorie Door: Gijs Steur (Jur was ziek) Klas: B2a Docent: ERH Datum: 11 06 2014 1 Inhoudsopgave Hoofdstuk Blz. 1. Inleiding. 3 2. Uitleg evolutietheorie. 4/5 3. Betoog ontstaan leven op aarde.

Nadere informatie

Beest binnenste buiten

Beest binnenste buiten binnenste buiten Lesbrief websessie Beest binnenste buiten Een kijkje achter de schermen van museum Naturalis voor groep 5, 6, 7 en 8 Inhoud lesbrief 1. Introductieles 2. Beschrijving websessie 3. Afsluiting

Nadere informatie

Thema 5 Evolutie Basisstof 2 Evolutie van de mens

Thema 5 Evolutie Basisstof 2 Evolutie van de mens Een populatie met een grote genetische diversiteit heeft een grote overlevingskans. De kans is groot dat enkele individuen de genen bezitten om een onbekende ziekteverwekker af te weren of om zich goed

Nadere informatie

Krokodil 32 Bruine rat 42 Konijn 44 Zijdeaapje 46 Chimpansee 48 Tabel 1

Krokodil 32 Bruine rat 42 Konijn 44 Zijdeaapje 46 Chimpansee 48 Tabel 1 A BASISSTOF Beantwoord de volgende vragen. 1 Hoe wordt de informatie voor de erfelijke eigenschappen van een organisme genoemd? De volgende gegevens horen bij de vragen 2 en 3. In tabel 1 is voor enkele

Nadere informatie

Nederlandse Samenvatting

Nederlandse Samenvatting Nederlandse Samenvatting Samenvatting De mogelijkheid om genen op een specifieke wijze te reguleren creëert diverse manieren om genfunctie te kunnen bestuderen of moduleren. Artificiële transcriptiefactoren

Nadere informatie

11. o - 8 ... ... ... ... f e. d i. Apenrots Leeuwenterras Kleine-Zoogdierenhuis Uilenruïne Californische zeeleeuwen Insectarium

11. o - 8 ... ... ... ... f e. d i. Apenrots Leeuwenterras Kleine-Zoogdierenhuis Uilenruïne Californische zeeleeuwen Insectarium o - 8 11. We hadden al gezien dat sommige dieren toevallig bepaalde voordelige eigenschappen hebben. Je kunt je voorstellen dat zo n dier-met-voordeel meer nakomelingen krijgt dan andere dieren. En die

Nadere informatie

Er groeit iets in Meise!

Er groeit iets in Meise! Gidsprocedures Atelier Evolution Overzicht van de onderdelen Inleiding: Hoe werkt evolutie? Locatie : Van Heurck-auditorium Duur : 20 minuten Alle leerlingen samen Deel I: Evolutie in actie: Radiatie en

Nadere informatie

Spreekbeurten.info Spreekbeurten en Werkstukken http://spreekbeurten.info

Spreekbeurten.info Spreekbeurten en Werkstukken http://spreekbeurten.info Neushoorn Inleiding De neushoorn is een groot en zwaar landdier en kan wel 60 jaar oud worden. De witte neushoorn is de grootste en weegt wel 3000 kilo. Alleen de olifant is groter. De neushoorn is één

Nadere informatie

WIE DURFT MIJ BETER TE LEREN KENNEN? WIE DURFT MIJ BETER TE LEREN KENNEN?

WIE DURFT MIJ BETER TE LEREN KENNEN? WIE DURFT MIJ BETER TE LEREN KENNEN? Lesboek bovenbouw havo/vwo WIE DURFT MIJ BETER TE LEREN KENNEN? WIE DURFT MIJ BETER TE LEREN KENNEN? Werkbladen bovenbouw havo/vwo E xscaufarrsipiaerk Beekse Bergen Docent: Klas: ep) Naam (of naam gro

Nadere informatie

HOOFDSTUK 1 HET ONTSTAAN VAN HET LEVEN OP AARDE BLZ 3. HOOFDSTUK 3 DE VELOCIRAPTOR BLZ 5. HOOFDSTUK 4 DE SPINOSAURUS BLZ 6.

HOOFDSTUK 1 HET ONTSTAAN VAN HET LEVEN OP AARDE BLZ 3. HOOFDSTUK 3 DE VELOCIRAPTOR BLZ 5. HOOFDSTUK 4 DE SPINOSAURUS BLZ 6. INLEIDING BLZ 2. HOOFDSTUK 1 HET ONTSTAAN VAN HET LEVEN OP AARDE BLZ 3. HOOFDSTUK 2 DE IRRITATOR BLZ 4. HOOFDSTUK 3 DE VELOCIRAPTOR BLZ 5. HOOFDSTUK 4 DE SPINOSAURUS BLZ 6. HOOFDSTUK 5 TYRANOSAURUS REX

Nadere informatie

Wat is biodiversiteit? Hoeveel biodiversiteit is er (wereldwijd en

Wat is biodiversiteit? Hoeveel biodiversiteit is er (wereldwijd en Biodiversiteit Cursus Natuur-in-zicht 1 Inhoud Wat is biodiversiteit? Hoeveel biodiversiteit is er (wereldwijd en bij ons)? Waar komt die biodiversiteit vandaan? Waarom is biodiversiteit belangrijk? Hoe

Nadere informatie

Wakker Worden Kinderlezing: Komen er nog diersoorten bij? Verslag lezing zondag 22 mei 2016

Wakker Worden Kinderlezing: Komen er nog diersoorten bij? Verslag lezing zondag 22 mei 2016 Wakker Worden Kinderlezing: Komen er nog diersoorten bij? Verslag lezing zondag 22 mei 2016 Honden, eenden, paarden, vlinders, giraffen en inktvissen: op aarde lopen, vliegen en zwemmen ontelbaar veel

Nadere informatie

Wadi Hitan, het dal der walvissen over oerwalvissen in Egypte en de evolutie der walvissen

Wadi Hitan, het dal der walvissen over oerwalvissen in Egypte en de evolutie der walvissen In Grondboor & Hamer 1971, nr. 2 las ik voor het eerst iets over de walvissen van Egypte (Heslinga en Schut, april 1971, nr.2, p.62). Dit artikel ging weliswaar over de fossiele walvisresten van Nederland,

Nadere informatie

Evolutie / biodiversiteit

Evolutie / biodiversiteit Evolutie / biodiversiteit Cursus Natuurgids Overzicht van de les: o Evolutietheorie o Bewijzen voor de evolutietheorie o Ontstaan van soorten o Biodiversiteit 2 1 3 Oude opvatting: creationisme alles bestaat

Nadere informatie

Academisch cafe Utrechts Universiteitsfonds, 12 april 2007, Arnhem

Academisch cafe Utrechts Universiteitsfonds, 12 april 2007, Arnhem Academisch cafe Utrechts Universiteitsfonds, 12 april 2007, Arnhem Geachte aanwezigen, mijn naam is Roy Erkens en de komende 15 minuten ga ik u iets vertellen over mijn proefschrift getiteld from morphological

Nadere informatie

Bijlage VMBO-GL en TL 2006

Bijlage VMBO-GL en TL 2006 Bijlage VMBO-GL en TL 2006 tijdvak 2 BIOLOGIE CSE GL EN TL Deze bijlage bevat informatie. 600051-2-588b REPTIELEN INFORMATIE 1 VERSCHILLENDE GROEPEN In de afbeelding hieronder staan vier soorten reptielen

Nadere informatie

LESPAKKET ORDENING EN EVOLUTIE

LESPAKKET ORDENING EN EVOLUTIE LESPAKKET ORDENING VMBO EN EVOLUTIE Naam Docent Klas LEKKER BEESTEN TUSSEN DE DIEREN Dierenrijk is onderdeel van WELKOM IN DIERENRIJK KENMERKEN Om ervoor te zorgen dat je een leuke en leerzame excursie

Nadere informatie

Activiteiten werkwinkel misconcepties

Activiteiten werkwinkel misconcepties Activiteiten werkwinkel misconcepties Misconcepties rond de persoon van Darwin en zijn reis 1. Darwin deed een wereldreis met het schip de Beagle en beschreef de evolutietheorie in On the origin of species

Nadere informatie

Evolutie van het Melkviooltje en verwanten door hybridisatie en polyploïdie

Evolutie van het Melkviooltje en verwanten door hybridisatie en polyploïdie Evolutie van het Melkviooltje en verwanten door hybridisatie en polyploïdie De systematiek is de wetenschap binnen de biologie die zich bezighoudt met inventariseren, identificeren van de verwantschapsrelaties

Nadere informatie

Had Darwijn toch gelijk? - Wetenschappelijke kritiek op Darwins evolutietheorie!

Had Darwijn toch gelijk? - Wetenschappelijke kritiek op Darwins evolutietheorie! Had Darwijn toch gelijk? - Wetenschappelijke kritiek op Darwins evolutietheorie! Deze open vraag staat met grote letters op de voorkant van het Novembernummer van National Geographic. Wie meent dat dit

Nadere informatie

LESPAKKET ORDENING EN EVOLUTIE

LESPAKKET ORDENING EN EVOLUTIE LESPAKKET ORDENING HAVO / VWO EN EVOLUTIE Naam Docent Klas LEKKER BEESTEN TUSSEN DE DIEREN Dierenrijk is onderdeel van WELKOM IN DIERENRIJK KENMERKEN Om ervoor te zorgen dat je een leuke en leerzame excursie

Nadere informatie

Leerlijn Biologie inhouden (PO-havo/vwo), Biologische eenheid

Leerlijn Biologie inhouden (PO-havo/vwo), Biologische eenheid Leerlijn Biologie inhouden (PO-havo/vwo), Biologische eenheid Voor meer informatie zie: Kerndoelen onderbouw Vakportaal Mens & maatschappij Vakportaal Natuur & techniek kerndoelen primair onderwijs kerndoelen

Nadere informatie

TIJDLIJN. Een reis door de geschiedenis

TIJDLIJN. Een reis door de geschiedenis De OERKNAL! Wetenschappers denken dat zo n 13,7 miljard aardse jaren geleden alles in het heelal samengeperst was tot een gloeiend heet punt. Tijdens een enorme oerexplosie ontstonden uit dat punt materie

Nadere informatie

1. A. Noem de drie domeinen waarin alle levende organismen worden ingedeeld.

1. A. Noem de drie domeinen waarin alle levende organismen worden ingedeeld. Microbiële diversiteit (COO) Hand-out bij de COO-module, versie 2 oktober 2013 Indeling A. Noem de drie domeinen waarin alle levende organismen worden ingedeeld. B. Alle levende organismen worden in drie

Nadere informatie

Erfelijkheid en ordening. havo/vwo 3-4

Erfelijkheid en ordening. havo/vwo 3-4 Erfelijkheid en ordening havo/vwo 3-4 Microben waren er al vroeg bij. Ze waren de eerste en, bijna vier miljard jaar lang, de enige bewoners op aarde. Uit de eencellige micro-organismen evolueerden op

Nadere informatie

Out of Africa: mtdna en Y chromosoom. Jean-Jacques Cassiman KuLeuven

Out of Africa: mtdna en Y chromosoom. Jean-Jacques Cassiman KuLeuven Out of Africa: mtdna en Y chromosoom Jean-Jacques Cassiman KuLeuven 12.05.2007 Kern DNA CME 06 CME 06 CME 06 Start in 2007: twee zonen per generatie (25j) In 2258 (10 generaties of 250 jaar) zullen er

Nadere informatie

DinoLab LIVE Lesbrief websessie

DinoLab LIVE Lesbrief websessie DinoLab LIVE Lesbrief websessie Een kijkje achter de schermen van museum Naturalis voor groep 6, 7 en 8 1 DinoLab LIVE lesbrief DinoLab LIVE 1 Introductieles 2 Beschrijving websessie 3 Afsluiting 4 Bijlage:

Nadere informatie

N e d e r l a n d s c e n t r u m v o o r. Naturalis, Zoölogisch Museum Amsterdam en Nationaal Herbarium Nederland bundelen hun krachten

N e d e r l a n d s c e n t r u m v o o r. Naturalis, Zoölogisch Museum Amsterdam en Nationaal Herbarium Nederland bundelen hun krachten N e d e r l a n d s c e n t r u m v o o r biodiversiteitonderzoek NCB Naturalis, Zoölogisch Museum Amsterdam en Nationaal Herbarium Nederland bundelen hun krachten Nederlands Centrum voor Biodiversiteitonderzoek

Nadere informatie

Fossielen uit de Noordzee.

Fossielen uit de Noordzee. Lesbrief websessie Fossielen uit de Noordzee. Een kijkje achter de schermen van museum Naturalis voor groep 5, 6, 7 en 8 Inhoud lesbrief 1. Introductieles 2. Beschrijving websessie 3. Afsluiting Tijdbesteding

Nadere informatie

Eerste graad A-stroom

Eerste graad A-stroom EINDTERMEN en ONTWIKKELINGSDOELEN Vijverbiotoopstudie Eerste graad A-stroom Vakgebonden eindtermen aardrijkskunde Het natuurlijk milieu Reliëf 16* De leerlingen leren respect opbrengen voor de waarde van

Nadere informatie

Lesbrief online gastles. Een bek vol tanden. Een kijkje achter de schermen van museum Naturalis voor groep 5, 6, 7 en 8

Lesbrief online gastles. Een bek vol tanden. Een kijkje achter de schermen van museum Naturalis voor groep 5, 6, 7 en 8 Lesbrief online gastles Een bek vol tanden Een kijkje achter de schermen van museum Naturalis voor groep 5, 6, 7 en 8 Inhoud lesbrief 1. Introductieles 2. Beschrijving uitzending Online gastles 3. Afsluiting

Nadere informatie

Docentenhandleiding. Afsluitende module. De tumor als evolutieproces

Docentenhandleiding. Afsluitende module. De tumor als evolutieproces Docentenhandleiding Afsluitende module De tumor als evolutieproces Ontwikkeld door het Cancer Genomics Centre in samenwerking met het Freudenthal Instituut voor Didactiek van Wiskunde en Natuurwetenschappen

Nadere informatie

Erfelijkheid van de ziekte van Huntington

Erfelijkheid van de ziekte van Huntington Erfelijkheid van de ziekte van Huntington In de kern van iedere cel van het menselijk lichaam is uniek erfelijk materiaal opgeslagen. Dit erfelijk materiaal wordt ook wel DNA (Desoxyribonucleïnezuur) genoemd.

Nadere informatie

De kunst van het opzetten

De kunst van het opzetten Lesbrief websessie De kunst van het opzetten Een kijkje achter de schermen van museum Naturalis voor groep 5, 6, 7 en 8 Inhoud lesbrief 1. Introductieles 2. Uitzending 3. Afronding Inhoud in het kort:

Nadere informatie

het machtigste leven op aarde erfelijkheid & ordening

het machtigste leven op aarde erfelijkheid & ordening antwoorden en uitleg bij Micropia-onderwijsmateriaal Havo/VWO 3-4 het machtigste leven op aarde erfelijkheid & ordening In dit document vindt u de vragen uit het Micropia-onderwijsmateriaal voor Havo/VWO

Nadere informatie

Eindexamen biologie vmbo gl/tl II

Eindexamen biologie vmbo gl/tl II REPTIELEN INFORMATIE 1 VERSCHILLENDE GROEPEN In de afbeelding hieronder staan vier soorten reptielen afgebeeld. Elke soort behoort tot een bepaalde groep van de reptielen: dier 1 behoort tot de krokodillen,

Nadere informatie

Inteelt en genetische diversiteit van de Cavalier King Charles Spaniel op basis van afstammingsgegevens

Inteelt en genetische diversiteit van de Cavalier King Charles Spaniel op basis van afstammingsgegevens Inteelt en genetische diversiteit van de Cavalier King Charles Spaniel op basis van afstammingsgegevens // dr. Steven Janssens, lic. Katrien Wijnrocx en prof. Nadine Buys Livestock Genetics, KULeuven Data

Nadere informatie

DINOSAURIËRS. Marthe Terny

DINOSAURIËRS. Marthe Terny DINOSAURIËRS Marthe Terny 1. INLEIDING Ik hou mijn spreekbeurt over dinosauriërs, omdat ik dit een erg leuk en interessant onderwerp vind. We weten al veel over de dinosauriërs, maar nog niet alles. Ik

Nadere informatie

Examenprogramma biologie havo

Examenprogramma biologie havo Examenprogramma biologie havo Het eindexamen Het eindexamen bestaat uit het centraal examen en het schoolexamen. Het examenprogramma bestaat uit de volgende domeinen: Domein A1 Vaardigheden Domein A2 Analyse

Nadere informatie

Fossielen uit de Noordzee

Fossielen uit de Noordzee Fossielen uit de Noordzee Lesbrief websessie Een kijkje achter de schermen van museum Naturalis voor groep 5, 6, 7 en 8 Inhoud lesbrief Fossielen uit de Noordzee 1 Introductieles 2 Beschrijving websessie

Nadere informatie

Omgaan met inteelt in kleine rassen

Omgaan met inteelt in kleine rassen Omgaan met inteelt in kleine rassen Piter Bijma, Jack Windig en Sipke-Joost Hiemstra Centrum Genetische bronnen Nederland (CGN) Animal Breeding and Genomics Centre (ABGC) 23 april 2008. Traditionele planten-

Nadere informatie

Examenprogramma biologie vwo

Examenprogramma biologie vwo Bijlage 4 Examenprogramma biologie vwo Het eindexamen Het eindexamen bestaat uit het centraal examen en het schoolexamen. Het examenprogramma bestaat uit de volgende domeinen: Domein A Vaardigheden Domein

Nadere informatie

Schooljaar 2015-2016. Wetenschap op Stap

Schooljaar 2015-2016. Wetenschap op Stap Schooljaar 2015-2016 Wetenschap op Stap Inhoudstafel Over VIB 7 Schoolproject Wetenschap op Stap 10 Wetenschapper in de klas 14 Test jouw brein 20 OVER VIB Vlaams Instituut voor Biotechnologie De wetenschappers

Nadere informatie

SZH voor levend erfgoed

SZH voor levend erfgoed SZH voor levend erfgoed Verwantschap Kor Oldenbroek en Myrthe Maurice Informatieochtend Drentsche Patrijshonden Woudenberg 15 februari 2014 Programma Wat kunt u vanmorgen verwachten: - Wat is verwantschap?

Nadere informatie

Fossielen uit de Noordzee

Fossielen uit de Noordzee Fossielen uit de Noordzee Lesbrief websessie Een kijkje achter de schermen van museum Naturalis voor klas 1 en 2 (VMBO/H/V) lesbrief Fossielen uit de Noordzee 1 Introductieles 2 Beschrijving websessie

Nadere informatie

Waar biologie de grens met ethiek raakt deel A

Waar biologie de grens met ethiek raakt deel A Waar biologie de grens met ethiek raakt deel A An Quaghebeur Leraar biologie VLTI - Torhout Vakbegeleider biologie-natuurwetenschappen Bisdom Brugge 1 Waar biologie de grens met ethiek raakt Situering

Nadere informatie

Klinische Genetica. Autosomaal dominante overerving

Klinische Genetica. Autosomaal dominante overerving Klinische Genetica Autosomaal dominante overerving Klinische Genetica U bent (of uw kind is) doorverwezen naar de polikliniek Klinische Genetica. Tijdens de eerste afspraak legt een klinisch geneticus

Nadere informatie

infprg03dt practicumopdracht 4

infprg03dt practicumopdracht 4 infprg03dt practicumopdracht 4 W. Oele 31 augustus 2008 1 Evolutie Het volgende citaat komt letterlijk van Wikipedia: Met evolutietheorie (soms ook wel evolutieleer genoemd) wordt de wetenschappelijke

Nadere informatie

Sponsors' Contactinformatie'

Sponsors' Contactinformatie' Sponsors' Contactinformatie' KULeuvenwebsite: http://www.kuleuven.be/bioscenter/igem igemwiki: 2015.igem.org/Team:KU_Leuven Socialemedia: Facebook:www.facebook.com/KULeuveniGEM Twitter:twitter.com/kuleuven_igem

Nadere informatie

Homologie eenvoudig uitgelegd

Homologie eenvoudig uitgelegd Homologie eenvoudig uitgelegd door Dominic Statham, http://creation.com/homology-made-simple, 27-1-2014 Alle Schriftaanhalingen komen uit de Statenvertaling (1977 of HSV) Vertaling en voetnoten door M.V.

Nadere informatie

Onderzoeksgroep Neurodegeneratieve Hersenziekten

Onderzoeksgroep Neurodegeneratieve Hersenziekten WETENSCHAPPELIJK ONDERZOEK NAAR DE ROL VAN GENETICA IN JONGDEMENTIE: FAMILIES, MUTATIES EN GENETISCHE TESTEN. Christine Van Broeckhoven Neurodegeneratieve Hersenziekten Groep, Department Moleculaire Genetica,

Nadere informatie

Een mens is voor 50% genetisch identiek aan een banaan.

Een mens is voor 50% genetisch identiek aan een banaan. Een mens is voor 50% genetisch identiek aan een banaan. Qu3 / DNABAR Noorderlicht 2010 Voorwoord 3 Dit boekje is een initiatief van de afdeling Genetica van het Universitair Medisch Centrum Groningen.

Nadere informatie

Thema dieren. Deze werkbundel is van:

Thema dieren. Deze werkbundel is van: Deze werkbunl is van: DIEREN TELLEN Tel hoeveel je er ziet van elk dier. Noteer het aantal achter juiste benaming. hond: kat: het paard: hamster: slak: DIEREN TELLEN Oplossing Tel hoeveel je er ziet van

Nadere informatie

PTA biologie vwo Belgisch Park cohort

PTA biologie vwo Belgisch Park cohort Domeinen biologie Het examenprogramma biologie kent de volgende (sub)domeinen: Domein A Vaardigheden Domein B Zelfregulatie o Subdomein B1 Eiwitsynthese o Subdomein B2 Stofwisseling van de cel o Subdomein

Nadere informatie

Oog in oog met de dino s expeditie oertijd

Oog in oog met de dino s expeditie oertijd Oog in oog met de dino s expeditie oertijd Museumles - Expeditie Oertijd Informatie voor leerlingen basisonderwijs groepen 4 t/m 8 experience www.limburgsmuseum.nl wat je ziet, ben je zelf Oog in oog met

Nadere informatie

Bijlage-VMBO-KB 2006 BIOLOGIE CSE KB. tijdvak 2. Deze bijlage bevat informatie b

Bijlage-VMBO-KB 2006 BIOLOGIE CSE KB. tijdvak 2. Deze bijlage bevat informatie b Bijlage-VMBO-KB 2006 tijdvak 2 BIOLOGIE CSE KB Deze bijlage bevat informatie. 600051-2-663b REPTIELEN INFORMATIE 1 VERSCHILLENDE GROEPEN In de afbeelding hieronder staan vier soorten reptielen afgebeeld.

Nadere informatie

Werkblad schedels groep 1

Werkblad schedels groep 1 Werkblad schedels groep 1 De lengte van het dier is ongeveer 5 keer de lengte van de schedel Hoe lang is de schedel? Meet langs de zijkant Hoe breed is de oogkas? Schedel nr 1 Schedel nr 2 Schedel nr 3

Nadere informatie

Natuur In Zicht - Biodiversiteit

Natuur In Zicht - Biodiversiteit Natuur In Zicht - Biodiversiteit Kennismaking lesgever 2 1 Lesverloop 3 Biodiversiteit: wat is het? Hoe ontstaat het? Belang van biodiversiteit Bedreiging van biodiversiteit Wat kan je zelf doen? Hectarespel

Nadere informatie

Inteeltbeheersing bij rashonden

Inteeltbeheersing bij rashonden Inteeltbeheersing bij rashonden Jack J. Windig CGN CGN en Livestock research (Lelystad) Onderdeel Wageningen UR Livestock Research voorheen ASG, ID-Lelystad, ID- DLO CGN = Centrum Genetische bronnen Nederland

Nadere informatie

Module: Een nieuwe soort - v456. CC Naamsvermelding 3.0 Nederland licentie.

Module: Een nieuwe soort - v456. CC Naamsvermelding 3.0 Nederland licentie. Auteur VO-content Laatst gewijzigd 21 July 2016 Licentie CC Naamsvermelding 3.0 Nederland licentie Webadres http://maken.wikiwijs.nl/74461 Dit lesmateriaal is gemaakt met Wikiwijs Maken van Kennisnet.

Nadere informatie

Schooljaar Wetenschap op Stap

Schooljaar Wetenschap op Stap Schooljaar 2016-2017 Wetenschap op Stap Inhoudstafel Over VIB 7 Schoolproject Wetenschap op Stap 10 Wetenschapper in de klas 14 Test jouw brein 20 OVER R VIB Vlaams Instituut voor Biotechnologie De wetenschappers

Nadere informatie

hands on evolutie voor de onderbouw van het voortgezet onderwijs Midshipmens berth Gangway Whaleboat Poop cabin Captains Store-room Gun room Water

hands on evolutie voor de onderbouw van het voortgezet onderwijs Midshipmens berth Gangway Whaleboat Poop cabin Captains Store-room Gun room Water Gangway hands on evolutie Midshipmens berth Whaleboat Gun room Spirit Room Bread Room Poop cabin Captains Store-room Water Captains Cabin voor de onderbouw van het voortgezet onderwijs Les Wat is een natuuronderzoeker?

Nadere informatie

OVER EVOLUTIE De theorie en haar betekenis voor ons Leerlingenhandleiding

OVER EVOLUTIE De theorie en haar betekenis voor ons Leerlingenhandleiding OVER EVOLUTIE De theorie en haar betekenis voor ons Leerlingenhandleiding Nothing in biology makes sense except in the light of evolution. (Theodosius Dobzhansky) INHOUD Centrale vraag 2 Hoofdstuk 1 3

Nadere informatie

DNA ONDERZOEK AAN VOGELS

DNA ONDERZOEK AAN VOGELS DNA ONDERZOEK AAN VOGELS Verschenen in Vogels mrt/april 2000 onder de titel Schudden aan de stamboom van de vogels Dit artikel gaat over het DNAonderzoek zoals het wordt gebruikt bij het maken van stambomen

Nadere informatie

2 Voortplanten met organen Bouw en werking van geslachtsorganen Werking van geslachtshormonen Afsluiting 31

2 Voortplanten met organen Bouw en werking van geslachtsorganen Werking van geslachtshormonen Afsluiting 31 Inhoud Voorwoord 5 Inleiding 6 1 Voortplanten van genen 9 1.1 Genetica 9 1.2 Kruisingen 13 1.3 Crossing-over en mutatie 16 1.4 Erfelijkheid en praktijk 17 1.5 Inteelt en inteeltdepressie 21 1.6 Afsluiting

Nadere informatie

Samenvatting Hoofdstuk 1

Samenvatting Hoofdstuk 1 Samenvatting Om een duidelijk inzicht te krijgen in de evolutionaire krachten die tot de enorme biodiversiteit in de natuur leiden, probeert de evolutionaire biologie modellen te ontwikkelen die de essentie

Nadere informatie

Eencellige en meercellige organismen

Eencellige en meercellige organismen 2 Eencellige en e organismen 2.1 Eencelligen en en Tonen onderstaande microscopische foto s een of een organisme? Kruis aan. 1 2 pantoffeldiertje amoebe 3 4 lever nier 5 6 blauwwier wortel tuinboon Conclusie

Nadere informatie

Omgaan met Inteelt in Fokprogramma s

Omgaan met Inteelt in Fokprogramma s Omgaan met Inteelt in Fokprogramma s Piter Bijma Leerstoelgroep Fokkerij en Genetica Animal Breeding Wageningen & Universiteit De boodschap 1. Enige inteelt is normaal; veel inteelt is riskant 2. Inteelt

Nadere informatie

De rol van verwantschap in de fokkerij. Piter Bijma Fokkerij en Genetica, Wageningen UR

De rol van verwantschap in de fokkerij. Piter Bijma Fokkerij en Genetica, Wageningen UR De rol van verwantschap in de fokkerij Piter Bijma Fokkerij en Genetica, Wageningen UR De Boodschap In elk gesloten ras neemt de verwantschap geleidelijk toe Dat is een normaal fenomeen De toename van

Nadere informatie

Weerleggingen van pagina 255

Weerleggingen van pagina 255 Weerleggingen van pagina 255 "De groep homo onwikkelde zich verder..." Homo-habilis Over de homo habilis hoeft na de vorige pagina niets meer gezegd te worden dus gaan we door naar de homo erectus. Homo-erectus:

Nadere informatie

Bijlage VMBO-GL en TL

Bijlage VMBO-GL en TL Bijlage VMBO-GL en TL 2013 tijdvak 1 biologie CSE GL en TL Deze bijlage bevat informatie. GT-0191-a-13-1-b Dieren van Australië Lees eerst informatie 1 tot en met 6 en beantwoord dan vraag 38 tot en met

Nadere informatie

Biodiversiteit in 2010

Biodiversiteit in 2010 Biodiversiteit in 2010 Wim Veraghtert Natuurpunt Educatie Graatakker 11 2300 Turnhout Wat is biodiversiteit? Jeugd, Sport en Brussel 2 Wat is biodiversiteit? Jeugd, Sport en Brussel 3 Genetische variatie

Nadere informatie

Ontdek de topstukken van het Museum voor Natuurwetenschappen. Voor kinderen van 6 tot 8 jaar

Ontdek de topstukken van het Museum voor Natuurwetenschappen. Voor kinderen van 6 tot 8 jaar Ontdek de topstukken van het Museum voor Natuurwetenschappen Voor kinderen van 6 tot 8 jaar Inkomhal De walvis in de inkomhal Dit is geen dino maar een bultrugwalvis. Bekijk het skelet goed: wat heeft

Nadere informatie

Figuur 1. Representatie van de dubbele helix en de structuren van de verschillende basen.

Figuur 1. Representatie van de dubbele helix en de structuren van de verschillende basen. Het DNA molecuul is verantwoordelijk voor het opslaan van de genetische informatie die gebruikt wordt voor de ontwikkeling en het functioneren van levende organismen. Aangezien het de instructies voor

Nadere informatie

De kunst van het opzetten

De kunst van het opzetten De kunst van het opzetten Lesbrief websessie Een kijkje achter de schermen van museum Naturalis voor groep 5, 6, 7 en 8 Inhoud lesbrief De kunst van het opzetten 1 Introductieles 2 Uitzending 3 Afronding

Nadere informatie

presenteert: Zoogdieren Bewerking: Joeri Cortens

presenteert: Zoogdieren Bewerking: Joeri Cortens presenteert: Zoogdieren Bewerking: Joeri Cortens Zoogdieren : evolutie Innovaties: * endotherm - haar * jongen zogen * voedselspecialisatie - tanden - kauwspieren 2 Waarom zijn de meeste zoogdieren nachtactief?

Nadere informatie

Newsletter April 2013

Newsletter April 2013 1. Inleiding Met het thema van deze nieuwsbrief willen we ons richten op de fundamenten van het fokken: de basisgenetica. Want of je het nu wil of niet. dit is ook de basis voor een succesvolle fok! Misschien

Nadere informatie