MAPPIT-analyse van Toll-Like receptor signaalwegen

Save this PDF as:
 WORD  PNG  TXT  JPG

Maat: px
Weergave met pagina beginnen:

Download "MAPPIT-analyse van Toll-Like receptor signaalwegen"

Transcriptie

1 MAPPIT-analyse van Toll-Like receptor signaalwegen Thary Jacob Verhandeling ingediend tot het verkrijgen van de graad van Master in de Biomedische Wetenschappen Promotor: Prof. Dr. Jan Tavernier Begeleider: Peter Ulrichts Vakgroep Biochemie Academiejaar

2

3 MAPPIT-analyse van Toll-Like receptor signaalwegen Thary Jacob Verhandeling ingediend tot het verkrijgen van de graad van Master in de Biomedische Wetenschappen Promotor: Prof. Dr. Jan Tavernier Begeleider: Peter Ulrichts Vakgroep Biochemie Academiejaar

4 De auteur en de promotor geven de toelating deze masterproef voor consultatie beschikbaar te stellen en delen ervan te kopiëren voor persoonlijk gebruik. Elk ander gebruik valt onder de beperkingen van het auteursrecht, in het bijzonder met betrekking tot de verplichting uitdrukkelijk de bron te vermelden bij het aanhalen van resultaten uit deze masterproef. Datum (handtekening student) (handtekening promotor) (naam student) (naam promotor)

5 Dankwoord De thesis zit er dan (eindelijk) op! Ik besef het nog niet goed, maar met dat ik het hier nog eens kan nalezen, begint het besef te komen. Ik weet dat ik gegroeid ben, het voorbije jaar, niet alleen qua kennis, maar zeker op persoonlijkheidsvlak. Het team waar ik me de voorbije maanden thuis in heb mogen voelen, heeft me heel wat bijgebracht. Zo is iedereen er altijd voor elkaar en zijn deze mensen niet alleen collega s, maar ook vrienden. Het is vaak lachen op de werkvloer, terwijl het werk niet wordt verwaarloosd, iets wat in het begin voor mij niet altijd even gemakkelijk was. Ik kan verstrooid zijn en na een slimme raadgeving of grappig verhaaltje toch nog een week werk naar minder goede plaatsen helpen. Maar vooral, ik heb geleerd hoe het eraan toe gaat in het onderzoek. Het is veel meer vallen dan opstaan, en enkel door volharding haal je die eerste resultaten binnen. Kleine successen die leiden tot grootse ontdekkingen. Natuurlijk begin ik met het bedanken van mijn leermeester, mijn mahatma, mijn goeroe, maar tevens een vertrouwenspersoon en ontvanger van de dagelijkse roddel. Peter, bedankt voor je onuitputtelijke bron van geduld en vertrouwen in mij. Ik weet dat het niet altijd even makkelijk ging en dat de resultaten maar niet wilden komen, maar door jouw steun en kennis bleef ik de moed erin houden. Zonder jou had ik dit zeker niet tot zo'n mooi einde kunnen brengen als nu. Ik heb ook zeer veel van je geleerd, zoals zaken logisch(er) bekijken, stap voor stap te werk gaan en leren plannen. Je hebt zeker en vast bijgedragen tot mijn onderzoekspersoonlijkheid (als ik dat al zo kan noemen) en mijn interesse in de wetenschap verder aangewakkerd. Het onderzoek en de eruit resulterende thesis zijn dankzij jou geworden wat ik ervan verwacht had. Personen die ik ook niet mag vergeten, die altijd klaar stonden om mijn dagdagelijkse vragen te beantwoorden of voor een fijne babbel zijn Tim (jij maakte elke dag zonnig), Annick, Anne-Sophie, Dominique, Nele, Elien, Julie, Joris, Els, Lennart, Irma, Célia, Delphine, buren Leentje en Isabel, Viola, Laura, José (sorry voor je pipetman..), Serge en Johan. Echt bedankt allemaal, jullie hebben me het leven in jullie onderzoekswereld zeer aangenaam gemaakt. Jullie blijven nog lang in mijn herinneringen aanwezig. Ik kwam met plezier werken en vertrek nu met spijt in het hart. Gelukkig staan er alweer 2 waardige opvolgers klaar die jullie nog wel even zullen bezighouden. Tenslotte wil ik Dr. Prof. Tavernier bedanken, voor de uitzonderlijke kans die ik heb gekregen door in zijn onderzoeksgroep te mogen werken. Ik ben zeker dat de ervaring die me hierdoor bijgebracht is, me voor de rest van mijn leven zal bijblijven. Ik kan alleen maar hopen dat ik later in zo n fantastische omgeving mag terechtkomen als deze waar ik mijn thesisstage heb mogen uitvoeren. Bedankt! Thary

6 Afkortingenlijst AD Alzheimer s Disease/Activation Domain AlphaScreen Amplified Luminescent Proximity Homogeneous Assay Screen AP-1 Activator Protein 1 AZ AminoZuur BD Binding Domain BSA Bovine Serum Albumin CARD Caspase Recruitment Domain CD Clusters of Differentiation CIP Calf Intestine alkaline Phosphatase CMV CytoMegaloVirus CpG C-phosphate-G CRP C-reactive protein CRS Cytoplasmatic Retention Signal DAI DNA-dependent activator of IFN-regulatory factors DBD DNA Binding Domain DC Dendritic Cell DD Death Domain DNA Deoxyribonucleic Acid dntp deoxyribonucleotide TriPhosphate ds double-stranded Fc Fragment, Crystallizable Region ha3g human APOBEC3G HEK Human Embryonic Kidney HIV Human Immunodeficiency Virus HSP Heat Shock Protein IFN Interferon Ig Immunoglobulin IκB Inhibitor of κb IKK IκB kinase IL Interleukin IRAK IL-1 Receptor-Associated Kinase IRF Interferon Regulatory Factor JAK Janus Kinase LPS Lipopolysaccharide LRR Leucine-Rich Repeat LTA Lipoteichoic Acid Mal MyD88 Adaptor-Like MAP-kinase Mitogen-activated protein kinase MAPPIT Mammalian Protein-Protein Interaction Trap MBL Mannan-binding lectin MHC Major Histocompatibility Complex MyD88 Myeloid Differentiation primary response gene 88 MyD88 s MyD88 short NF-κB Nuclear Factor κb

7 PAMP Pathogen-Associated Molecular Pattern PCR Polymerase Chain Reaction PIP2 Phophatidyl Inositol 4,5-bisPhosphate PKC Protein Kinase C PRR Pathogen Recognition Receptor RHIM Rip Homotypic Interacting Protein RIG-I Retinoic-acid-Inducible protein I RIP1 Receptor-Interacting Protein 1 RNA Ribonucleic Acid rtetrs reverse Tet-Repressor rtta reverse tetracylin-controlled TransActivator SAP Serum Amyloid Protein Sarm Sterile alpha and HEAT-Armadillo motifs containing protein SDS-PAGE Sodium Dodecyl Sulfate PolyAcrylamide Gel Electroforesis SOCS Suppressor of cytokine signalling ss single-stranded STAT Signal Transducer and Activator of Transcription TAP Tandem Affinity Purification TBK1 TANK-binding Kinase 1 TetO Tet-Operator sequence Th T-helper TIR Toll IL-1 Receptor TLR Toll-Like Receptor TNF Tumor Necrosis Factor TRAF Tumor Necrosis Factor-associated factor Tram Trif-related adapter molecule TRE Tetracyclin Response Element Trif TIR-domain-containing adaptor inducing interferon tta Tetracycline-controlled TransActivator UAS Upstream Activating Sequence WB Western Blot Y2H Yeast-2-Hybrid

8 Inhoud 1 Algemene inleiding Toll-like receptoren Het TIR-domein Adaptoren MyD Mal Trif Tram Sarm Verdere signaalwegen MyD88-afhankelijke pathway MyD88-onafhankelijke pathway TLR signalisatie in ziekte Proteïne-proteïne interacties - Methoden MAPPIT Andere methoden Materialen en methoden DNA-technieken PCR-gebaseerde technieken Restrictiedigest Gelelektroforese DNA zuiveren uit agarosegel DNA-ligatie Ontzouten Elektroporeren Mini-prep Midi-prep Sequenering Celbiologische methoden Celkweek HEK293-cellen Kweekmedium Trypsiniseren en splitsen van cellen... 24

9 2.2.5 Ca-fosfaat transfectie MAPPIT-assay SDS-PAGE Western Blot Co-IP AlphaScreen Immunofluorescentie microscopie Resultaten MAPPIT Algemene inleiding Constructiewerk Resultaten Co-IP en AlphaScreen analyse van Tram en Trif TIR mutanten Constructiewerk Resultaten Bespreking Referenties... 48

10 Samenvatting Toll-Like receptoren (TLRs) zijn een belangrijke link in vertebraten tussen de aangeboren (innate) en adaptieve immuunrespons. Ze detecteren pathogenen, waarna ze een directe bescherming bieden via het innate immuunsysteem. Bovendien bewerkstelligen ze via cytokines de activatie en oriëntatie van de adaptieve immuunrespons. TLRs vormen een belangrijke groep transmembranaire PRRs die zowel op het plasmamembraan als op endosomen kunnen geëxpresseerd zijn. Ze danken hun naam aan hun homologie met het Drosophila melanogasterproteïne Toll, wat ook een belangrijke rol in het Drosophila-immuunsysteem heeft. 11 humane TLRs zijn tot op heden beschreven, welke moleculaire patronen van microbiële indringers zoals protozoa, bacteriën, fungi en virussen herkennen. Daar TLRs een belangrijk deel zijn van de eerstelijnsdefensie, is het niet verrassend dat afwijkende TLR-signalisatie leidt tot verscheidene ziektecondities. Ongecontroleerde TLRactivatie zal leiden tot een overmatige productie van pro-inflammatoire cytokines, terwijl gereduceerde signalisatie zal leiden tot een verhoogde vatbaarheid voor bacteriële en virale infecties. Door hun centrale rol in het innate en adaptief immuunsysteem zijn de TLRs eveneens betrokken in auto-immuunziekten. Verder onderzoek op deze TLRs is dus nuttig voor ontwikkeling van therapeutica die inwerken op het innate immuunsysteem, zowel TLRantagonisten als TLR-agonisten. In dit onderzoek zal getracht worden het TIR-domein van Trif beter te definiëren aan de hand van een mutagenesestudie. Op die manier worden de regio s betrokken bij TIR-TIR interacties gekarakteriseerd, wat de ontwikkeling van antagonisten van TLR-signalisatie zou kunnen vereenvoudigen. Trif-interacties kunnen met het zoogdier 2-hybride systeem MAPPIT niet gedetecteerd worden, want Trif-expressie is beperkt tot het perinucleair compartiment, terwijl MAPPIT enkel interacties kan meten in de sub-plasmamembranaire ruimte. Er zal geprobeerd worden of deze interacties wel te detecteren zijn met MAPPIT door mutaties in het TIR-domein van Trif, controleerbare expressie en koppeling van Trif aan een cytoplasmatisch retentiesignaal (CRS). Als alternatieve strategieën wordt dit aangevuld met co-immunoprecipitatie- en AlphaScreen-experimenten. 1

11 1 Algemene inleiding Vertebraten hebben een evolutief sterk geconserveerd immuunsysteem, waarmee ze zich kunnen verdedigen tegen pathogenen. Dit is noodzakelijk voor hun overleving, daar zij continu bedreigd worden door infecties. Immuunreacties bij vertebraten kunnen worden onderverdeeld in een adaptieve respons, gemedieerd door clonale expansie van T en B lymfocyten en een aangeboren respons. Deze aangeboren of innate respons is een eerste barrière, die verdediging biedt tot de meer specifieke, adaptieve respons op gang gekomen is. Daarenboven zorgt de aangeboren respons voor de initiatie en oriëntatie van de adaptieve respons (bvb. Th1- of Th2 gemedieerd) door de productie van cytokines en maturatie van immuuncellen. [1] Efficiënte detectie van pathogenen door pattern recognition receptoren (PRRs) is noodzakelijk voor activatie van het innate immuunsysteem. Deze PRRs worden geproduceerd door cellen zoals polymorfonucleaire fagocyten, monocyten/macrofagen, dendritische cellen, natural killer cellen, mucosale epitheelcellen en endotheelcellen. Ze herkennen pathogen-associated molecular patterns (PAMPs). Dit zijn structuren zoals bacterieel lipopolysaccharide (LPS), dsrna of bacterieel DNA. PRRs kunnen worden gesecreteerd zoals Mannan-binding lectin (MBL), serum amyloid protein (SAP) en C-reactive protein (CRP), maar ook intracellulaire (RIG-1, DAI) of transmembranaire (TLRs, Dectin-1) PRRs zijn gekend (zie Tabel I). [2,3] Tabel I: Verschillende PRRs met hun expressiepatroon en PAMPs die ze herkennen [2] PRR Expressiepatroon PAMP MBL Gesecreteerd Koolhydraten van gram-positieve en gram-negatieve bacteriën, virale proteïnes CRP, SAP Gesecreteerd Phosphorylcholine, LPS, C1q Macrophage mannose receptor Macrophage scavenger receptor Celoppervlak Celoppervlak RIG-1 Cytoplasma dsrna DAI Cytoplasma DNA Mannose, fucose, N-acetyl glucosamine LPS, dsrna, lipoteichoinezuur (LTA) TLR Celoppervlak/endosomaal dsrna, ssrna, CpG,... (zie tabel II) 1.1 Toll-like receptoren De Toll-Like Receptoren (TLRs) vormen een belangrijke groep transmembranaire PRRs die zowel op het plasmamembraan als op endosomen kunnen geëxpresseerd zijn (zie Tabel II). TLRs danken hun naam aan hun homologie met het Drosophila melanogaster proteïne Toll. Dit 2

12 proteïne is betrokken in de vorming van de dorsoventrale as van de vlieg-embryo [4], maar is ook belangrijk in de verdediging van de volwassen vlieg tegen schimmels. [5] Tot op heden zijn er 11 humane TLRs beschreven. Deze herkennen moleculaire patronen van microbiële indringers zoals protozoa, bacteriën, fungi en virussen. [2] TLRs behoren tot de Toll/IL-1 receptor (TIR) superfamilie, samen met de IL-1R, IL-18R en IL- 33R, waarvan alle leden een cytoplasmatisch TIR-domein bevatten. De familie van de IL-1R zijn net als TLRs essentiële componenten van zowel het aangeboren als adaptief immuunsysteem. [6-11] Het ectodomein van TLRs verschilt van het IL-ectodomein, daar TLRs kopieën leucinerijke repeats (LRR) bevatten, waar IL-1R 3 Ig-like domeinen bevat (zie Figuur 1). [3] Tabel II: Expressie en liganden van de verschillende TLRs [2] TLR Expressie Liganden TLR1 Celoppervlak Triacyl lipopeptiden TLR2 Celoppervlak Peptidoglycaan, lipoteichoïnezuur en gerelateerde fosfolipiden TLR3 Endosomaal dsrna TLR4 Celoppervlak Lipopolysaccharide, mannan, HSP60 TLR5 Celoppervlak Flagelline TLR6 Celoppervlak Diacyl lipopeptide TLR7/TLR8 Endosomaal ssrna, guanosine-analogen, imidazoquinolone-like moleculen TLR9 Endosomaal CpG DNA, hemozoïne TLR11 * Celoppervlak Profiline-like moleculen * TLR 11 enkel functioneel bij de muis. Het humane TLR11 gen bevat verscheiden STOP codons. Wanneer TLRs hun respectievelijke ligand herkennen, dimeriseren deze via hun TIR-domein. Vervolgens wordt de signalisatie verdergezet door rekrutering van adaptoren, ook via hun TIRdomein. Vijf TIR-adaptoren zijn tot op heden beschreven, o.a. myeloïde differentiatiefactor 88 (MyD88), MyD88 adaptor-like proteïne (Mal), TIR-domein bevattend adaptor proteïne met inductie van IFN-β (Trif), Trif-gerelateerde adaptor molecule (Tram) en TIR-domein steriel alpha and HEAT/Armadillo motief (Sarm). [12] 3

13 Figuur 1: verschillen en gelijkenissen tussen endo- en ectodomein in IL-1R en TLR [3] 1.2 Het TIR-domein Het TIR-domein is een 160-tal AZ lang interactiemotief, bestaande uit vijf β-sheets omgeven door α-helices, verbonden door flexibele loops. Het TIR-domein bevat geconserveerde regio s, vooral box1, box2 en box3 springen hier in het oog (zie Figuur 1, 2). Box1 is een handtekeningsequentie van het TIR-domein. Box2 vormt een belangrijke loop in de structuur, wat zal zorgen voor de interactie met TLRs of adaptoren. De functie van box3 is nog niet volledig begrepen, hoewel het residu s bevat die belangrijk zijn voor signalisatie. Dit laatste werd gevonden door een mutagenese-studie op het TIR-domein van de IL-1 receptor. [3] Figuur 2: CLUSTALW alignering van de TIR-domeinen van humane TLR4, MyD88, Mal, Trif, Tram en Sarm. Box1, box2 en box3 zijn gelabeld.[3] Er kunnen drie TIR-TIR bindingen worden geïdentificeerd op basis van TLR-signalisatie: de receptor-receptor-, receptor-adaptor- en adaptor-adaptorbinding. Er bestaan verscheidene modellen om deze TIR-TIR-binding te beschrijven en hieromtrent bestaat nog veel onduidelijkheid. Hieronder worden twee modellen besproken: een model van Nuñez et al [13-16] 4

14 waarbij associatie tussen 2 BB-loops essentieel is voor TIR-TIR-interactie en een model van Gautam et al [17] waar een BB-loop van 1 TIR-domein interageert met de DD-loop van een ander. Nuñez et al modelleerden het TLR4 TIR-domein als een homodimeer aan de hand van de kristalstructuur van TLR1, TLR2 en TLR10. Er werd voorspeld dat 5 β-strengen en 6 α-helices in dit TIR-domein aanwezig zijn. De uiteindelijke conclusie was dat BB-loops interageerden met elkaar, waarbij Phe712-residu s van elke subunit een aromatische interactie met elkaar vormen. De geconserveerde proline in deze BB-loop (box2) zorgt voor een vaste conformatie van deze BB-loop en wanneer deze wordt vervangen door een ander aminozuur, zal sterke verstoring van deze geometrie optreden. (zie Figuur 3A) [13, 15] Figuur 3: Modellen van TIR-TIR-binding. A. Bovenaanzicht van het model van Nuñez et al met BB-BBbinding. De BB-loops van de twee TLR4 molecules zijn blauw en geel gekleurd. [13] B. Model van Gautam et al met BB-DD-binding. [17] Een ander model is dit van Gautam et al. (zie Figuur 3B) [17] Dit model onderscheidt zich van het model van Nuñez et al door BB-DD-loop-gemedieerde in plaats van BB-BB-loop gemedieerde TIR-TIR-interactie. Op basis van random mutagenese resultaten werd alanine scanning mutagenese uitgevoerd in de TLR2 DD-loop en een deel van de αd-loop. Dit resulteerde dan in de identificatie van vier residuen die cruciaal zouden zijn voor TLR2/1 signalisatie: Arg-748, Phe-749, Leu-752 en Arg-753. Na energie-minimalisatie en verscheidene docking-studies zouden drie regio's betrokken zijn bij TLR2/1-interactie, waarvan regio I verder werd bestudeerd. In regio I zijn Arg-748 en Phe-749 betrokken met de binding tussen Gly-676 in de TLR1 BB-loop. Omdat dit model suggereert dat sterische hindering de bindingsinteracties significant zal wijzigen tussen de DD-loop van TLR2 en de BB-loop van TLR1, werd Gly-676 in TLR1 gemuteerd naar 5

15 Ala en Leu. Zoals verwacht resulteerden deze in-vitro functionele studies met TLR-1 G676A en TLR-1 G676L in gereduceerde NF-κB activatie, wat de predicties ondersteunt. [17] Adaptoren Na ligand-geïnduceerde receptor-dimerisatie zullen homotypische TIR-TIR-interacties leiden tot de rekrutering van TIR-domein bevattende adaptorproteïnes. Deze proteïne-proteïne-interacties zullen downstream signalisatie toelaten, nodig voor activatie van transcriptiefactoren zoals Nuclear Factor κb (NF-κB), AP-1, Interferon regulatory factor (IRF)-3 en de MAP-kinase familie. Zo kan een pro-inflammatoire respons worden opgewekt, wat belangrijk is om de pathogene bedreiging te bestrijden. Tot op heden zijn 5 dergelijke cytosolische adaptorproteïnes beschreven, namelijk MyD88, Mal, Trif, Tram en Sarm, welke allen een TIR-domein bevatten (zie Figuur 4). Verschillende TLRs maken gebruik van verschillende adaptoren (zie Tabel III), wat voor een deel ligand-specifieke geninductie kan verklaren. [2] Tabel III: Adaptorgebruik van de verschillende TLRs Adaptor TLR MyD88 Alle behalve TLR3 Trif TLR3, TLR4 Sarm / Mal TLR2, TLR4 Tram TLR4 Figuur 4: Schematische voorstelling van de verschillende adaptor-proteïnes [16] MyD88 MyD88 is een sleuteladapter die betrokken is in alle TLR-pathways behalve deze van TLR3. Naast het TIR-domein bevat het ook een Death-Domein (DD), wat essentieel is voor de interactie met IL-1 Receptor-Associated Kinases (IRAKs), die downstream eiwitten zullen fosforyleren en 6

16 activeren. Het hoofddoel van MyD88 is de inductie van NF-κB, wat onder andere zal resulteren in de productie van pro-inflammatoire cytokines, zoals TNF-α en IL-1β. [3] De cruciale rol van MyD88 in TLR-signaalwegen blijkt uit de analyse van MyD88 -/- muizen, die geen respons meer vertonen op IL-1 en agonisten van alle TLRs, behalve TLR3. [2] Expressie van MyD88 short (MyD88 S ), een alternatieve gesplicete vorm van MyD88 die enkel het korte intermediaire domein mist tussen het Death Domain en TIR-domein (zie Figuur 4), leidt tot het stilleggen van IL-1/LPS-geïnduceerde NFκB-activatie. MyD88 S doet dit door te interageren met IRAK-4, een essentieel kinase voor IL-1R en TLR-signalisatie. In de aanwezigheid van MyD88 S zal IRAK-1 niet gefosforyleerd worden, waardoor NFκB uiteindelijk niet geubiquitinyleerd en geactiveerd wordt. [18] In bepaalde subtypes van dendritische cellen en macrofagen kan MyD88-activatie ook leiden tot IFN type-1 productie, door associatie met IRF-7 (zie 2.4.1) [3] Mal MAL is vergelijkbaar met MyD88, maar is N-terminaal 75 aminozuren korter en mist het Death Domain. Het is een brugadaptor die TLR2 of TLR4 verbindt met MyD88. [16] Mal knockouts zijn vergelijkbaar met MyD88 knockouts wat betreft TLR2- en TLR4-signalisatie. Mal bezit ook een phophatidylinositol 4,5-bisphosphate (PIP2)-bindend domein in zijn N-terminus. (zie Figuur 4). Dit domein zorgt voor Mal-recrutering naar PIP2-rijke gebieden in het plasmamembraan en is essentieel voor begeleiding van MyD88 naar een geactiveerde TLR4. [3] Trif Trif is tot op vandaag de enige adaptor die betrokken is in TLR3 signalisatie als antwoord op dubbelstrengig viraal RNA. Trif signaliseert ook bij TLR4 als antwoord op LPS. (zie Figuur 5) [12] 7

17 Figuur 5: situering van Trif in de TLR4 pathway.[4] Initieel dacht men dat Mal verantwoordelijk was voor controle van de TLR4-gemedieerde, MyD88-onafhankelijke pathway die zo leidt tot IFN-activatie. De ontdekking van de rol van Mal als brugadaptor in de MyD88-afhankelijke pathway liet een gat open: hoe kan TLR4 type I IFNinductie mediëren? Dit gat werd opgevuld door Trif, welke de TLR4-geïnduceerde MyD88- afhankelijke pathway controleert. Vergelijkbaar met Mal werd Trif geïdentificeerd door databasescreening voor TIR-domein-bevattende proteïnes, maar deze gegevens werden ook bekomen in een yeast two-hybrid screen met TLR3. Trif bindt direct met TLR3, terwijl Tram nodig is als linkende adaptor voor TLR4-interactie. (zie 2.3.5) In tegenstelling tot Mal of MyD88 zal overexpressie van Trif leiden tot de inductie van de IFNβ-promotor. [16] Trif-deficiënte muizen vertonen een verstoorde TLR3- en TLR4-geïnduceerde activatie van IRF3 en als gevolg hiervan een verminderde productie van IFNβ. Deze inflammatoire cytokineproductie is enkel verstoord bij TLR4 stimulatie, maar niet door activatie van TLR2, TLR7 en TLR9, wat het TLR-specifieke karakter van Trif aantoont. In cellen die zowel deficiënt zijn in Trif en MyD88 werd geen LPS-geïnduceerde NF-κB activatie meer gedetecteerd. Dit betekent dus dat Trif zorgt voor het MyD88-onafhankelijke aspect van TL4-signalisatie. [16] 8

18 Een belangrijk in vivo aspect van de MyD88-onafhankelijke LPS-TLR4-gemediëerde pathway is de opregulatie van co-stimulatire molecules en MHC klasse II molecules door dendritische cellen. Trif laat deze pathway toe door de inductie van type-i interferonen. [16] Tram Tram gedraagt zich als een linkende adaptor, wat activatie van de Trif-afhankelijke pathway toelaat, als antwoord op LPS. Tram wordt gemyristoyleerd in zijn N-terminus en hecht zich aan de membraan, geassocieerd met TLR4. Tijdens de infectie zal LPS van gram-negatieve bacteriën TLR4-dimeren binden, wat leidt tot rekrutering van Trif. Trif zal interageren met downstream Tank-binding kinase 2 (TBK-1), waardoor IRF-3 zal gefosforyleerd worden. Trif interageert ook met TRAF-6, leidend tot activatie van NF-κB. (zie 2.3.4) PKC wordt ook geactiveerd door LPS, waardoor Tram wordt gefosforyleerd op serine 16, wat vereist is voor verdere signalisatie. [20] TLR4 signalisatie omvat alle vier de adaptorproteïnes, waarbij MyD88/Mal betrokken zijn in de vroege LPS-antwoorden en Trif/Tram in een later stadium. Het moet nog uitgemaakt worden of Mal en Tram elkaar uitsluiten bij binding aan TLR4. [12] TRAM vormt de brug tussen TLR4 en Trif [3], net zoals Mal de brug vormt tussen MyD88 en TLR2 en TLR4. Recent is gebleken dat Tram, samen met TLR4 na LPS-binding endosomaal gelokaliseerd wordt door een soort endocytose. In deze endosomen wordt dan Tram-Trif gemedieerde signalisatie geïnitieerd, waarbij type I interferon wordt vrijgesteld. [10] Sarm De laatste TLR-adaptor die gekarakteriseerd werd, Sarm, zal de MyD88-onafhankelijke pathway negatief reguleren. De activatie van de MyD88-onafhankelijke pathway na TLR4-stimulatie, resulteert in verhoogde expressie van Sarm. Sarm interageert met Trif en zal zo downstream signalisatie verhinderen. [21] 1.3 Verdere signaalwegen MyD88-afhankelijke pathway Verdere TLR-signalisatie kan ingedeeld worden in twee pathways, de MyD88-afhankelijke en de MyD88-onafhankelijke. De MyD88-afhankelijke pathway wordt gebruikt door alle TLRs behalve TLR3. Na herkenning van hun ligand interageren TLR5, 7, 8 en 9 direct met MyD88, terwijl TLR4 en TLR2 (die een heterodimeer vormen met ofwel TLR1 ofwel TLR6) binden met de 9

19 adaptor Mal om MyD88 te rekruteren. Na MyD88-rekrutering naar de geactiveerde TLR, zullen IRAKs gerekruteerd worden, waarna deze TRAF6 fosforyleren. Dit laatste zal op zijn beurt het IκB kinase (IKK) complex, bestaande uit IKKα, IKKβ en IKKγ ubiquitinyleren. Dit leidt tot fosforylatie en daaruitvolgend degradatie van IκB, wat de nucleaire translocatie van NF-κB toelaat en zo de expressie van inflammatoire cytokines zoals TNFα. [22] TRAF6 kan ook IRF-5 activeren, wat leidt tot de productie van TNFα. IRF-5 is onmisbaar voor TLR3-, TLR4-, TLR5- en TLR9-afhankelijke inductie van TNFα in CD11c+ dendritische cellen. Bovendien is TLR9-gemediëerde inductie van type I IFN-transcriptie in deze cellen ook afhankelijk van IRF-5. [22] Een MyD88-afhankelijke, celspecifieke pathway komt voor in plasmacytoïde dendritische cellen. Hier kan de activatie van TLR7, 8 en 9 leiden tot de activatie en nucleaire translocatie van IRF-7, resulterend in de expressie van IFNα. (zie Figuur 6). [21] MyD88-onafhankelijke pathway De MyD88-onafhankelijke pathway echter, wordt enkel gebruikt door TLR3 en TLR4, waarbij de TIR-adaptor Trif wordt gebruikt. Trif activeert TBK1 wat samen met IKKi de activatie en nucleaire translocatie van IRF-3 zal mediëren. Dit resulteert uiteindelijk in IFNβ-productie. Zoals bij de MyD88-afhankelijke pathway zal TLR4-signalisatie via de MyD88-onafhankelijke pathway een tussenadaptor vereisen, in dit geval Tram. De MyD88-onafhankelijke pathway kan ook leiden tot NF-κB-activatie via Trif, dat ofwel RIP1 of TRAF6 zal activeren, resulterend in NFκB translocatie. (zie Figuur 6) [21] Figuur 6: MyD88-afhankelijke en onafhankelijke pathway [11] 10

20 1.4 TLR signalisatie in ziekte TLRs zijn cruciale componenten van de eerstelijnsdefensie tegen invaderende pathogenen. Het is dus niet verrassend dat afwijkende TLR-signalisatie zal leiden tot verscheidene ziektecondities. Ongecontroleerde TLR-activatie zal leiden tot een overmatige productie van pro-inflammatoire cytokines, terwijl gereduceerde signalisatie zal leiden tot een verhoogde vatbaarheid voor bacteriële of virale infecties. Door hun centrale rol in het innate en adaptief immuunsysteem zijn de TLRs eveneens betrokken in auto-immuunziekten. Verder onderzoek op deze TLRs is dus nuttig voor ontwikkeling van therapeutica die inwerken op het innate immuunsysteem, zowel TLR-antagonisten als TLR-agonisten. [2] Sommige leden van de TLR-familie zijn betrokken in de pathogenese van auto-immuun-, chronische inflammatoire- en infectieuze ziekten. [23-25] TLRs dragen bij tot gedilateerde cardiomyopathie, een voorname oorzaak voor hartfalen in jongere personen, waarbij TLR-stimulatie, samen met het triggeren van CD40 van DC, vereist is voor de inductie van deze ziekte. [26] Ook blijken muizen deficiënt in MyD88 minder gevoelig te zijn voor atherosclerose, in overeenstemming met de bevinding dat patiënten met een hypofunctioneel D299G polymorfisme van TLR4 ook een verminderd risico op atherosclerose vertonen. [23] TLRs kunnen bijdragen tot de ontwikkeling van diabetes en experimentele autoimmuun encephalomyelitis. [23] TLRs spelen tevens een cruciale rol in de inductie en progressie van chronische inflammatoire ziekten zoals asthma, een T H 2-cel gemedieerde luchtwegaandoening. Tevens spelen zij een rol in rheumatoïde artritis, een T H 1-like inflammatoire gewrichtsziekte. In het centraal zenuwstelsel zullen TLRs bijdragen aan de ontwikkeling van de ziekte van Alzheimer (AD), daar TLR2, -4 en -9 op de microglia de productie van inflammatoire mediatoren en de opname van AD-geassocieerde amyloïde B peptiden zullen bevorderen. [27-29] 1.5 Proteïne-proteïne interacties - Methoden MAPPIT Hoewel men steeds meer inzicht krijgt in de functie en regulatie van de adaptor-eiwitten in TLRsignalisatie, zijn artikels die deze adaptoren aan de TLRs linken vrij beperkt. Ook zijn de toegepaste methoden eerder gelimiteerd door gebruik van de yeast-two-hybrid methode en coimmunoprecipitatie, welke intrinsieke beperkingen vertonen. (zie 1.5.2) TLRs en TLR-adaptoren 11

21 zijn onderhevig aan post-translationele modificaties, welke niet mogelijk zijn in gistcellen, en coimmunoprecipitatie leidt tot verstoring van de cel-architectuur, wat kan leiden tot vals positieve interacties tussen proteïnes die normaal in gescheiden celcompartimenten zitten. [30] Om deze problemen te overkomen, werd mammalian protein-protein interaction trap (MAPPIT) ontwikkeld. Dit is een twee-hybride methode in zoogdiercellen gebaseerd op type-i cytokine signalisatie en activatie van receptor-geassocieerde Janus Kinases (JAKs). Geactiveerde JAKs fosforyleren geconserveerde tyrosine-residu's in de cytokine receptorstaarten, waardoor recruteringssites voor signal transducer and activator of transcription (STAT) molecules worden gecreëerd. Deze STAT-molecules worden vervolgens gefosforyleerd door de JAKs, waardoor deze als dimeren transloceren naar de nucleus en hier specifieke gentranscriptie induceren. (zie Figuur 7) [30] De MAPPIT-techniek buit de JAK/STAT-signaalpathway uit. Een "bait"-eiwit wordt C-terminaal gelinkt met een transmembranair en intracellulair deel van een klasse I cytokine-receptor die deficiënt is in STAT3-recrutering. Het extracellulaire domein van zowel de erythropoetinereceptor en de leptine-receptor kunnen hiervoor worden gebruikt. Een enkele Y1077F-mutatie zal de leptine-signalisatie niet beïnvloeden. Er werd aangetoond dat gefosforyleerde Y985 een deel is van een Shp-2 recruteringsmotief, en Y985 en Y1077 kunnen zich beiden gedragen als een SOCS3 (Suppressor Of Cytokine Signaling 3)-recruteringssite. Dit impliceert dat het gebruik van een drievoudige Y naar F mutante leptine-receptor het voordeel biedt dat negatieve feedbackmechanismen niet zullen werken, met verhoogde signalisatie als gevolg. [31] Het "prey" proteïne is gekoppeld aan 6 functionele STAT3-recruteringssites van de gp130-keten. Associatie van bait en prey samen met ligand-stimulatie zal dus leiden tot STAT3-activatie en inductie van een STAT"-responsieve luciferase-reporter. (zie Figuur 7) De stimulatie van het reporter-gen wordt gebruikt om de interactie tussen bait- en prey-proteïnes te meten. Een extra voordeel van de MAPPIT-techniek is de scheiding van interactie-zone (cytosol) en de effector-zone (nucleus), aangezien de signalisatie gebeurt door STAT-molecules. Op deze manier kunnen bait- en preyproteïnes niet interfereren met de transcriptie van de reporter, waardoor auto-activatoren en valspositieven gereduceerd worden. De standaard MAPPIT-assay maakt gebruik van humane embryonale HEK293T-cellen (zie 2.2.2), maar andere cellen kunnen ook worden gebruikt, zolang deze voldoende STAT3 expresseren. [30] 12

22 Figuur 7: A. Schematische weergave van de JAK-STAT pathway. Een cytokine bindt op zijn receptor, wat leidt tot clustering en herschikking van de receptorketens, resulterend in cross-activatie van receptorverankerd JAK. Deze JAKs fosforyleren op hun beurt specifieke tyrosines op de intracellulaire receptorstaarten. Deze fosfotyrosines zijn recruteringssites voor verschillende signaalmolecules, waaronder de STATs. STATs zijn latente transcriptiefactoren die na fosforylatie en dimerisatie naar de nucleus migreren, waar ze specifieke STAT-responsieve genen induceren. B. Principe van het MAPPIT systeem. Een bait polypeptide wordt gefuseerd aan een receptor die geen STAT3 recruteringssites bezit, aangezien deze tyrosines gemuteerd zijn naar naar fenylalanines. In de figuur hierboven bezit de receptorchimeer het extracellulaire domein van de homodimere EpoR gefuseerd met transmembranaire en cytosolische domeinen van de LR-F3. Een heteroloog prey-polypeptide wordt gefuseerd aan een receptorfragment dat gp130 STAT3recruteringssites bevat. Als bait en prey interageren, zal het gerekruteerde receptorfragment gefosforyleerd worden na ligand-geïnduceerde receptor-activatie. Zo wordt een STAT3 afhankelijk signaal verkregen, gemonitord door een STAT3-responsief reporter gen, LuciR.[30] Andere methoden Yeast-two hybrid Het yeast-two-hybrid of Y2H systeem, oorspronkelijk beschreven door Fields en Song [34], maakt gebruik van de eigenschappen van transcriptiefactoren. Deze bestaan uit een DNA bindend domein (DBD), dat een bepaalde promotor herkent en bindt, upstream van een gen en een activatie domein (AD), dat interageert met het RNA polymerase II complex. Het DBD zal de transcriptiefactor upstream van zijn target-gen positioneren, terwijl de AD dan het polymerase II complex zal rekruteren naar het begin van het gen, waardoor de transcriptie hiervan zal starten. (zie Figuur 8) [32] 13

23 Figuur 8: Principe van de Y2H-methode. Bovenaan: Gistcel die een transcriptiefactor expresseert bestaande uit een activatie-domein (AD) en een DNA-bindend domein (BD). Het BD bindt de upstream activerende sequentie (UAS) en de expressie van een nabijgelegen reportergen wordt geïnitieerd. Midden: Beide domeinen van de transcriptiefactor worden apart geëxpresseerd. De AD wordt niet gerekruteerd naar de promotor van het reporter-gen en transcriptie gaat niet door. Onderaan: Twee proteïnes, X en Y leiden tot rekrutering van de AD naar de promotor. De activatie van transcriptie van de reporter wordt geïnterpreteerd als een readout voor de interactie van X met Y. Het proteïne gefuseerd aan het BD is conventioneel het bait-proteïne, waarbij dit gefuseerd aan het AD de prey wordt genoemd.[32] In Y2H, waarbij de DBD en AD worden geëxpresseerd als aparte polypeptiden, zal de functie van de transcriptiefactor verloren gaan. cdna dat het proteïne van interesse codeert zal gecloneerd worden in een bait-vector, wat een fusie-eiwit genereert van de DBD en dit proteïne. Deze bait transloceert naar de nucleus van de gistcel en bindt met de promotor die zich upstream van een reporter-gen bevindt. Een tweede cdna dat een proteïne codeert dat mogelijk interageert met het proteïne van interesse in de bait-vector wordt gecloneerd in de prey-vector en codeert voor een fusie-eiwit van dit proteïne en het AD. Wanneer beide proteïnes nu reageren, worden de delen van de promotor bij elkaar gebracht, waardoor deze de transcriptie van het reporter-gen zullen initiëren. (zie Figuur 8) TAP-tag [32, 33] Tandem affiniteitspurificatie (TAP) is een tweestaps affiniteitspurificatie-protocol dat de isolatie van proteïne-complexen in bijna-fysiologische condities toelaat. Vervolgens kunnen deze worden 14

24 geanalyseerd met behulp van massa-spectrometrie Dit systeem wordt vaak gebruikt om te screenen naar ongekende interactors van een bepaald bait-eiwit. Deze methode had een groot succes bij het ophelderen van de cellulaire machinerie in gistcellen, maar in zoogdierencellen had deze methode een te lage opbrengst. De onderzoeksgroep van Superti-Furga kwam in 2006 met een TAP-tag systeem voor gebruik in zoogdiercellen. Een tag gebaseerd op proteïne G en het streptavidine-bindend peptide (GS-TAP) resulteerde in een tienvoudige stijging in proteïnecomplex-opbrengst en verbeterde de specificiteit van de procedure. (zie Figuur 9) Dit laat zuivering van proteïne-complexen toe die voordien nog niet gedetecteerd konden worden met TAP. [34] Figuur 9: Overzicht van het TAP-protocol. Tijdens de eerste stap zullen TAG-getagde proteïnes gesekwestreerd worden door IgG sepharose (1). Vervolgens worden deze losgemaakt door knippen met het TEV-protease (2). TEVgeknipte proteïnes worden dan gebonden aan streptavidine-sepharosebeads (3) en finaal geëlueerd met biotine (4). [34] Co-IP Om eiwitinteracties te detecteren wordt vaak ook co-immunoprecipitatie gebruikt. Deze methode heeft een aantal voordelen ten opzichte van MAPPIT, aangezien ook endogene interacties kunnen worden aangetoond. Nadelen zijn echter dat ook niet-specifieke interacties zullen aangetoond worden, wegens het verbreken van de celarchitectuur en het arbeidsintensieve karakter van een co-immunoprecipitatie. Als men de interactie tussen twee eiwitten wilt nagaan, kan eiwit A bijvoorbeeld getagged worden met een flag-tag en eiwit B met een E-tag. Het cellysaat wordt dan geïncubeerd met een α-flag antilichaam, waarna het immuuncomplex geprecipiteerd wordt door incubatie met proteïne G-sepharose beads. Deze interageren met het constante deel (Fc) van het anti-flag antilichaam. Wanneer er een interactie plaatsvindt tussen eiwit A en B, zal eiwit B dus mee gepelleteerd worden. Eiwitten worden van hun proteine G drager geëlueerd door ze te koken in reducerende SDS-PAGE sample-ladingsbuffer. Hierna wordt een Western Blot-analyse uitgevoerd met antilichamen tegen de E-tag (dus tegen eiwit B) waarbij dus kan gezien worden of er interactie met eiwit B is gebeurd. 15

25 AlphaScreen AlphaScreen is een reactie gebaseerd op beads om biomoleculaire interacties te gaan detecteren in microplaat-formaat. Het acroniem ALPHA staat voor Amplified Luminescent Proximity Homogeneous Assay. Zoals de naam impliceert is één van de voornaamste eigenschappen hiervan dat het een niet-radioactieve proximiteitsassay betreft. Het binden van de molecules die gecapteerd zijn door de beads leidt tot een energie-overdracht van de ene bead naar de andere, wat finaal zorgt voor een luminescent/fluorescent signaal. (zie Figuur 10) [35] Figuur 10:(A) Binding: De binding tussen biologische partners zal donor en acceptor beads in nabijheid brengen ( 200 nm) en zo een fluorescent signaal tussen nm produceren. (B)Geen binding: Wanneer een geen binding is tussen beide gekoppelde eiwitten, zullen donor en acceptor beads niet in nabijheid komen. Enkelvoudig zuurstof zal degraderen en er wordt geen signaal geproduceerd.[35] 16

26 2 Materialen en methoden 2.1 DNA-technieken PCR-gebaseerde technieken De PCR reactie PCR of polymerase chain-reaction is een cyclisch proces waarbij een specifiek stuk DNA kan geamplificeerd worden. Men maakt hierbij gebruik van twee primers of oligonucleotiden die complementair zijn aan de uiteinden van het stuk DNA dat men wilt amplificeren. De 3 -OH uiteinden van de primers vormen hier de beginpunten van de extensie. Een specifiek hitteresistent DNA-polymerase (in ons geval het PFU-polymerase) zal zorgen voor deze extensie. PCR is een driestapsproces. Het template-dna moet enkelstrengig worden gemaakt, waarna de primers hiermee kunnen hybridiseren en zo kunnen verlengd worden. Deze stappen gebeuren bij verschillende temperaturen: 1) Denaturatie van het dsdna bij 95 C. 2) Hybridisatie van de primers rond 55 C. 3) Extensie in 5 - naar 3 -richting bij 72 C (1 min/kb) Dit driestapsproces wordt een dertigtal keer doorlopen, waarbij men een exponentiële toename krijgt van het gekozen stuk DNA. Hierdoor beschikt men over voldoende DNA om verdere kloneringsstappen uit te voeren. Het PFU-polymerase heeft als nadeel dat het hot-start moet worden toegevoegd, daar het ook een geringe activiteit bezit op kamertemperatuur. Het polymerase wordt pas na 30s op 35 C toegevoegd, wanneer de temperatuur hoger is dan deze waarbij niet-specifieke annealing van de primers gebeurt. Op deze manier zal hot-start PCR de niet-specifieke amplificatie reduceren en de specifieke PCR-product opbrengst verhogen. Reactiemengsel (50 μl): - 10 μl DNA (10 ng = 1/1000) - 10 μl reverse oligo (100 ng = 1/100) - 10 μl forward oligo (100 ng = 1/100) - 5 μl PFU buffer (5x) - 1 μl dntp s - 13 μl H 2 O 17

27 PCR-gebaseerde mutagenese Via een PCR-reactie kan men ook een specifieke mutatie inbrengen in een DNA-plasmide. Hiervoor ontwerpt men een primerduo waarin de gewenste mutatie zit. Door een PCR-reactie uit te voeren met deze primers op de DNA-vector, zal een mutante variant geamplificeerd worden. De oorspronkelijke parentale vector is gemethyleerd en kan door deze eigenschap worden verknipt door digestie met DpnI (zie 3.1.2). Dit restrictie-enzyme zal enkel gemethyleerd DNA knippen. Na de PCR-reactie is het circulaire en gemuteerde DNA genicked tussen de eerste base van de primer en de eerste base die voor de primer komt omdat het polymerase geen ligase activiteit heeft. Na elektroporatie (zie 3.1.7) in XL1Blue-cellen wordt de fosfodiësterbinding opnieuw gevormd. Deze reactie verloopt ook volgens drie stappen, lichtjes verschillend van de gewone PCR-reactie: 1) Denaturatie van het dsdna bij 95 C 2) Hybridisatie van de primers bij 55 C 3) Extensie bij 68 C (= optimale temperatuur PFU-Turbo-enzyme; 2min/kb) Ook hier wordt het enzyme hot-start toegevoegd (zie hierboven) om aspecifieke extensie te vermijden. Deze drie stappen worden 18x herhaald. Uiteindelijk bekomt men de gemuteerde vector door 1h te incuberen met 1µl DpnI. Reactiemengsel (50 μl): - 10 μl DNA (5-50 ng = 1/200) - 10 μl reverse oligo (125 ng = 1/80) - 10 μl forward oligo (125 ng = 1/80) - 5 μl PFU buffer (5x) - 1 μl dntp s - 13 μl H 2 O Restrictiedigest Een restrictie-enzyme (of restrictie-endonuclease) is een enzyme dat dubbelstrengig of enkelstrengig DNA knipt op welbepaalde herkenningssequenties of restrictiesites. Deze enzymes worden gevonden in bacteriën en archaea en zijn hier een verdediging tegen invaderende virussen. Binnen de bacteriële gastheer verknippen deze enzymes namelijk enkel het vreemde DNA. Het gastheer-dna is namelijk gemethyleerd door een methylase om het te beschermen tegen de activiteit van deze restrictie-enzymes. 18

28 Restrictie-digesten worden gebruikt om DNA-fragmenten te genereren met compatibele eindjes om deze zo aan elkaar te kunnen ligeren (zie later). Deze eindjes kunnen even (blunt) of oneven (5 of 3 overhangende of sticky ) eindjes vormen. Ook kan een restrictie-digest gebruikt worden om te kijken of een bepaalde modificatie gebeurd is (door bijvoorbeeld een restrictie-site in te bouwen samen met deze modificatie). Reactiemengsel (30 μl): - 1 μl DNA - 3 μl buffer (10x) - 0,3 μl BSA (100x) - 1 μl restrictie-enzyme μl H 2 O Bovenstaand reactiemengsel wordt vervolgens 1h geïncubeerd op de aanbevolen incubatietemperatuur (meestal 37 C) en dit wordt dan geladen op een agarose-gel om de grootte van de geknipte fragmenten te bekijken door middel van gel-elektroforese Gelelektroforese Gelelektroforese is een scheidingstechniek die moleculen onder invloed van een elektrisch veld laat bewegen in een gel. Negatief geladen moleculen (DNA) bewegen naar de positieve pool (anode). Hoe groter de moleculen, hoe trager ze zullen bewegen. Het DNA-staal wordt op gel geladen samen met Orange G (om het elektroforeseproces te visualiseren en de DNA-suspensie denser te maken dan deze van de elektroforesebuffer, zodat DNA migreert door de gel). De gel loopt een 25-tal minuten, totdat de oranje banden naar de anode in de gel gemigreerd zijn. Hierna kunnen DNA-banden onder UV-licht direct gevisualiseerd worden, zonder kleuring in ethidiumbromide. Directe visualisatie is mogelijk doordat de agarosegel Gelred bevat, een fluorescente nucleïnezuur-kleurstof. De stalen worden geladen samen met een merker (Smartladder), zodat de grootte van de fragmenten kan worden bepaald. Merker: - 50 μl Smartladder - 20 μl Orange G μl EB (elektroforesebuffer) 19

29 2.1.4 DNA zuiveren uit agarosegel Wanneer geknipt DNA op een agarosegel werd gelopen om te kijken of het digest gelukt is, moet dit nadien terug gezuiverd worden uit deze gel om vervolgens te kunnen ligeren. Hiervoor wordt gebruik gemaakt van de NucleoSpin Extract II kit van Macherey-Nagel. Met deze methode zal DNA binden aan een silica-membraan in de aanwezigheid van een chaotroop zout (NT-buffer). Dit mengsel wordt direct op de silica-kolom geladen. Contaminaties zoals zouten en oplosbare macromoleculaire componenten worden verwijderd door wasstappen met wasbuffer, waarin ethanol zit (NT3). Finaal wordt puur DNA geëlueerd onder licht alkalische condities met elutiebuffer NE (5mM Tris/HCl, ph 8.5). (Protocol zie Addendum) DNA-ligatie Ligatie Om een complementair stuk DNA in een vector te brengen, moet dit geligeerd worden. Eerst wordt het volgende reactiemengsel samengesteld: - 1 μl T4 DNA ligase - 1:1 tot 1:3 molaire ratio insert vs vector - 4 μl T4-ligasebuffer (5x) - Eventueel aanvullen met H 2 O tot 20 μl Dit mengsel wordt overnacht geïncubeerd bij 16 C. (blunt eindjes bij 12 C) Dit DNA kan dan gebruikt worden om cellen te elektroporeren Cippen Soms hebben verknipte vectoren de neiging zelfsluiters te vormen in plaats van het gewenste insert-dna te incorporeren. Een oplossing hiervoor is de lineaire vectoren te CIPpen (Calf Intestine alkaline Phosphatase), wat de verwijdering van de 5 fosfaatgroep van DNA katalyseert. DNA dat deze fosfaatgroep niet heeft, zal geen zelfsluiters kunnen vormen. T 4 -DNA ligase heeft namelijk een 3 -OH en een 5 -fosfaat nodig om de eindjes aan elkaar te ligeren. Na het CIPpen van de lineaire vectoren kan deze situatie zich enkel voordoen wanneer het insert-dna associeert met het vector-dna. Reactiemengsel (50 μl): - 35 μl DNA - 5 μl 10x CIP buffer - 1 μl CIP-enzyme - 9 μl H 2 O 20

30 Het mengsel wordt 1h geïncubeerd bij 37 C. Hierna moet CIP terug verwijderd worden, anders zal bij ligatie het insert ook zijn fosfaatgroep verliezen. Het verwijderen van CIP gebeurt door de Nucleospin kit (Macherey-Nagel), waarna de vector kan geligeerd worden met het respectievelijke insert Ontzouten Aangezien ligaties, omwille van de buffers, teveel zouten bevatten om te kunnen elektroporeren (hoog voltage), dient deze suspensie ontzout te worden. Dit gebeurt door toevoegen van Naacetaat, glycogeen (visualiseren van DNA), 100% gekoelde ethanol en wordt aangelengd met H 2 O. Het DNA wordt 10 minuten op volle snelheid gecentrifugeerd, waarna het supernatans wordt afgenomen. De pellet wordt gedroogd aan de lucht, waarna deze opnieuw wordt opgelost in H 2 O. Reactiemengsel: μl 100% ethanol - 80 μl H 2 O - 50 μl NaAC 7,5M - 20 μl ligatiemengsel Elektroporeren Het ontzoute DNA kan worden geëlektroporeerd in elektrocompetente E. coli stammen zoals DH10Bs of XL1Blue s. We voegen 1 μl van het DNA toe aan de bacteriële cellen, waarna dit mengsel 1 minuut wordt geïncubeerd op ijs. Vervolgens brengen we de cellen in een cuvette. Deze cuvette wordt in het elektroporatie-toestel geplaatst, waar een korte schok van 1700V wordt toegediend. Deze spanning laat de bacteriële cellen toe het plasmide-dna op te nemen, doordat hun celwand kort geopend wordt. Hierna wordt de cellen 1h geïncubeerd op 37 C in rijk SOCmedium, waarna ze uitgeplaat worden op een LB-bodem, in de aanwezigheid van antibiotica. Hierdoor worden enkel kolonies geselecteerd van bacteriën die succesvol plasmide-dna met een antibiotica-resistentiegen hebben opgenomen Mini-prep De gevormde kolonies verkregen na vorige stappen worden vervolgens getest op de correctheid van hun geïnsereerde vector. De opzuivering van het DNA gebeurt met de NucleoSpin Multi-8 Plus Plasmid procedure. De kolonies worden daarvoor overnacht opgegroeid in LB-medium met het gepaste antibiotica, waarna de bacteriën worden geoogst door een initiële centrifugatie-stap. Daarna worden de hierdoor gepelleteerde bacteriën geresuspendeerd en vervolgens gelyseerd in alkalische lysebuffers (A1 en A2). Hierdoor gaat chromosomaal DNA, maar niet plasmide DNA 21

31 precipiteren. Vervolgens wordt een neutraliserende buffer toegevoegd (buffer A3) en geprecipiteerde celcomponenten worden verwijderd door centrifugatie. De bacteriële lysaten worden hierna over een vaccuüm-filter gebracht, waarbij de juiste zoutcondities zorgen voor een omkeerbare adsorptie van het plasmide-dna aan de NucleoSpin silica-membraan. Door het verwijderen van cellulaire componenten, zouten, detergenten en andere contaminanten in verscheidene wasstappen wordt een hoge zuiverheid van het finale plasmide-dna verkregen. Na toevoegen van elutiebuffer (AE) wordt finaal puur DNA geëlueerd, wat men met een restrictiedigest kan analyseren. (Protocol zie Addendum) Midi-prep Midi-preps worden uitgevoerd om DNA te bereiden uit kolonies die voorheen positief bevonden werden na een geslaagd restrictiedigest en hebben een grotere opbrengst dan mini-prep. De kit die wordt gebruikt voor midi-prep is de NucleoBond AX-kit van Macherey Nagel. Deze kit maakt gebruik van een aangepaste alkalische/sds lysestap, waarbij zowel chromosomaal als plasmide-dna gaan denatureren. Bij dit lysaat wordt een kalium-acetaat-buffer gevoegd, wat zorgt voor precipitatie van chromosomaal DNA en andere cellulaire componenten. Deze buffer zorgt ook voor neutralisatie van het lysaat en het plasmide-dna gaat terug naar zijn supercoiled vorm. Nadat de kolom geëquilibreerd werd met een welbepaalde buffer, wordt het plasmide- DNA mengsel over een filter in de kolom gebracht, welke bestaat uit hydrofiele, macro-poreuze silica-beads gekoppeld aan een methyl-ethylamine functionele groep. Deze groep heeft een positieve lading, die zo de negatief geladen fosfaat-backbone van DNA zal binden. Na precipitatie van het geëlueerde DNA wordt dit opgelost in TE-buffer voor verder gebruik. (Protocol zie Addendum) Sequenering De DNA-plasmides moeten worden getest op hun sequentie, zodat met zekerheid kan gezegd worden dat deze een bepaalde mutatie bevatten of goed geligeerd zijn. Dit gebeurt door miniprep- of midi-prep-dna te sequeneren. Sequenering verloopt volgens het PCR-principe, waarbij DNA enkelstrengig wordt gemaakt op hoge temperatuur, oligo s aanhechten op lagere temperatuur en vervolgens bij hogere temperatuur een elongatie optreedt. In tegenstelling tot een normale PCR-reactie, wordt bij de sequentiereactie een mengsel van dntp s en fluorescente ddntp s gebruikt (BigDye). Bij inbouw van deze ddntp s kan de PCR-reactie niet meer verder gaan. Dit resulteert in een mengsel van DNA-fragmenten van verschillende grootte met op de 3 22

32 positie een fluorescente groep (specifiek voor A, T, C of G). Na scheiding op grootte op een capillaire kolom kan zo de sequentie afgelezen worden. 1) 1min op 96 C 2) 10s op 96 C 3) 5s op 50 C 4) 4min op 60 C Stappen 2-4 worden 25-30x herhaald. Reactiemengsel (20 µl): - 4 μl sequencing buffer (5x) - 12 μl H 2 O - 2 μl BigDye terminator(polymerase, dntps en ddntp s) - 1 μl oligo (1/16) - 1 μl DNA (1/10 voor midi-prep-dna, puur voor mini-prep-dna) 2.2 Celbiologische methoden Celkweek Het is heel belangrijk dat er steriel gewerkt wordt tijdens het manipuleren van cellijnen, aangezien de kweekomstandigheden voor deze cellen identiek zijn aan de ideale omstandigheden voor groei van bacteriën en schimmels. Dit wordt bereikt door te werken in een steriele flow, waarbij een gefilterde laminaire luchtstroom de ruimte in de bench zo steriel mogelijk houdt. Tevens wordt gewerkt met steriel materiaal en worden de handen en materialen afgespoten met 70% ethanol. Bacteriële contaminatie en mycoplasma zullen ook worden teruggedrongen door de aanwezigheid van gentamycine in het kweekmedium HEK293-cellen In deze thesis werd enkel gewerkt met Human Embryonic Kidney 293T cellen of HEK293Tcellen. Dit is een cellijn afkomstig van humane embryonale niercellen. HEK293T-cellen groeien makkelijk en zijn makkelijk te transfecteren. Ze worden in de biotechnologie ook gebruikt om therapeutische proteïnes en virussen te produceren voor gentherapie. HEK293T-cellen werden gegenereerd door transformatie van culturen van normale embryonale niercellen met adenoviraal DNA. Zo werden deze cellen geïmmortaliseerd. Daarna werden deze HEK293T-cellen getransformeerd met het SV40 Large T-antigen, wat als voordeel heeft dat het episomale replicatie van plasmiden toelaat, op voorwaarde dat zij de de SV40 ori bevatten. 23

33 2.2.3 Kweekmedium Het medium voor HEK-cellen bevat: - DMEM ( Dulbecco s Minimal Essential Medium) van GibcoBRL - 10% FCS (Fetal Calf Serum) bevat groeifactoren - 1% gentamycine Trypsiniseren en splitsen van cellen Splitsen van cellen Na verloop van tijd worden de gekweekte cellen confluent, waardoor hun groei beperkt wordt. Ook geraken de groeifactoren in het medium na verloop van tijd uitgeput. De cellen moeten dus losgemaakt worden en nieuw medium met groeifactoren krijgen. Dit gebeurt in de praktijk met trypsine en EDTA. Trypsine is een protease afkomstig uit de maag en verknipt oppervlakteeiwitten zoals extracellulaire matrix proteïnen. EDTA zal de bivalente kationen cheleren, die noodzakelijk zijn voor celhechting. (Protocol zie Addendum) Cellen tellen Wanneer cellen moeten worden uitgezaaid in 6-well platen of petriplaten, moet dit aan een bepaalde hoeveelheid cellen per plaat gebeuren. Hiervoor moeten de cellen dus geteld worden. Dit gebeurt door een volume van de cellen te mengen met een even groot volume trypaanblauw. Wanneer dit in een Bürkerkamer wordt gebracht, kunnen levende cellen geteld worden, waarbij dode cellen blauwgekleurd zijn. Zo weet men de hoeveelheid cellen per ml, waarna de cellen aan de gepaste hoeveelheid kunnen worden uitgezaaid. (Protocol zie Addendum) Ca-fosfaat transfectie Wanneer een construct gemaakt is en dit succesvol werd bevonden na restrictiedigest en sequenering, kan dit vervolgens in cellen worden gebracht door transfectie. Transfectie van eukaryote cellen kan op verscheidene manieren gebeuren: elektroporatie, lipofectie en Ca-fosfaat transfectie. Enkel dit laatste werd in dit onderzoek uitgevoerd en wordt verder besproken. Het DNA in een CaCl 2 -oplossing gebracht en wordt toegedruppeld aan een HEBS-fosfaatbuffer ((2x Hepes-Buffered Saline (HeBS, 280 mm NaCl, 1.5 mm Na2HPO4, 50mM HEPES). Met NaOH ph naar 7.05 brengen). Daardoor slaan Ca 3 (PO 3 ) 4 -kristallen neer. Het DNA wordt in deze kristallen gecapteerd en precipiteert mee. Dit mengsel wordt 10min geïncubeerd op kamertemperatuur en daarna druppelsgewijs op de cellen gebracht. Daardoor zullen de cellen deze kristallen, en dus ook het DNA, door fagocytose opnemen. De volgende dag worden de cellen gewassen en kan een 24

34 MAPPIT-analyse of Western Blot analyse worden uitgevoerd. Dit laatste is om te kijken of de constructen (preys) wel degelijk tot expressie komen MAPPIT-assay Een MAPPIT-assay overspant meerdere dagen. De cellen moeten worden uitgezaaid over 6-well platen, deze moeten getransfecteerd en gewassen worden, uitverdeeld over een 96-well plaat en pas daarna kan men de cellen analyseren met de luminocount (Topcount). (Protocol zie Addendum) SDS-PAGE De prey-constructen hebben een flag-tag en kunnen met behulp van een Western Blot analyse worden gecontroleerd op expressie. Hiervoor worden de cellen van hun drager losgemaakt met RIPA (50 mm Tris ph 8, 200 mm NaCl, 0.5% DOC, 0.05% SDS, 1% NP40, 2 mm EDTA in H 2 O, 1 proteaseinhibitor pil per 50 ml), na deze enkele keren te wassen. Vervolgens wordt het cellysaat gebruikt om SDS-PAGE scheiding op uit te voeren. De acrylamide-gels bevatten SDS, wat de eiwitten hun gedenatureerde staat zal laten behouden, nadat deze gereduceerd werden door toevoegen van ladingsbuffer en opkoken. De proteïnes worden bedekt door het negatief geladen SDS en bewegen zo door de poriën van de acrylamide-gel naar de positieve pool. Kleinere proteïnes bewegen sneller door deze poriën en er treedt dus scheiding op op basis van grootte. De hoeveelheid acrylamide bepaalt de resolutie van de gel: hoe meer acrylamide, hoe beter kleinere proteïnes worden gescheiden. (Protocol zie Addendum) Western Blot De eiwitten gescheiden door SDS-page worden van de gel in een elektrisch veld overgebracht naar een of nitrocellulose- of polyvinylidene difluoride (PVDF)-membraan. Dit gebeurt door een sandwich te maken die er als volgt uitziet: - Mousse - 2 vellen Wattman-papier - Acrylamide-gel - Nitrocellulose-membraan (Hybond C) - 2 cellen Wattman-papier - Mousse Deze sandwich wordt met de acrylamide-gel naar de negatieve pool in een blotbakje met blotbuffer gebracht en overnacht geblot op 30V. 25

35 Blotbuffer (1 liter): - 14,4g glycine - 3g Tris ml H 2 O ml methanol Dit membraan wordt geïncubeerd met blokbuffer verdund in PBS om de vrije plaatsen op het membraan te bedekken met eiwit. Vervolgens wordt het membraan geïncubeerd met primair antilichaam gericht tegen de flag-tag. Op dit primair antilichaam bindt een secundair antilichaam met een fluorescerende entiteit die groen licht zal emitteren. De merker zal rood licht emitteren. Deze analyse gebeurt op de Odyssey infrared imager (Li-Cor). Op deze manier kan de expressie van preys worden bevestigd. (Protocol zie Addendum) Co-IP Ook een co-ip overspant meerdere dagen. Op dag 1 zal men cellen uitzaaien in petriplaten met diameter 9,6 cm 2. De volgende dag worden deze getransfecteerd, de dag erna gewassen en de dag daarna kan men de cellen lyseren voor een co-ip analyse. (Protocol zie Addendum) AlphaScreen Het voorbereiden van een AlphaScreen duurt ook enkele dagen, net zoals bij MAPPIT en co-ip. Cellen worden eerst uitgezaaid, de dag erna getransfecteerd, de volgende dag gewassen en de daaropvolgende dag kan de AlphaScreen-analyse worden uitgevoerd. (Protocol zie Addendum) Immunofluorescentie microscopie Immunofluorescentie microscopie wordt gebruikt om de subcellulaire distributie van eiwitten na te gaan. Hiervoor wordt gebruik gemaakt van een fluorescentiemicroscoop of een confocale microscoop. Er wordt een set van 2 antilichamen gebruikt: een primair antilichaam, gericht tegen het antigen van interesse en een secundair antilichaam, gericht tegen dit primair antilichaam, waaraan een fluorescente entiteit gekoppeld is. Op deze manier kunnen verschillende primaire antilichamen die verschillende antigenen herkennen gebruikt worden om bepaalde regio's te visualiseren in de cel. Wanneer gebruik wordt gemaakt van een aantal secundaire antilichamen die elk specifieke primaire antilichamen herkennen, kunnen verschillende celeiwitten in een andere kleur worden gevisualiseerd. (Protocol zie Addendum) 26

36 3 Resultaten 3.1 MAPPIT Algemene inleiding In deze thesis wordt met MAPPIT de interactie bekeken tussen Trif en zijn bindingspartners. Trif kan normaliter niet gedetecteerd worden met MAPPIT, daar dit eiwit zich perinucleair bevindt. [36] MAPPIT kan enkel eiwitinteracties detecteren die doorgaan aan de plasmamembraan van de cel. Vorig jaar werden al enkele prey-vectoren gemaakt en getest in een MAPPIT-experiment. Enerzijds werd Trif zonder C-terminaal domein als prey gecloneerd, omdat er een mutant Trif bestaat die dit C-terminaal domein (C term ) mist. Anderzijds werd ook Trif zonder RHIM-domein (welke instaat voor interactie met RIP1) in de prey vector gecloneerd om te zien of er geen apoptose effect gemedieerd werd door het RHIM-domein tijdens de MAPPIT-techniek. Interactie van deze mutanten kon echter niet gedetecteerd worden. Vooreerst werden een aantal constructen gemaakt die Trif mogelijks zouden lokaliseren naar het plasmamembraan zoals een P>H-mutatie in het TIR-domein en koppeling van Trif aan het CRS (cytoplasmatic retentiesignaal)-domein van humaan APOBEC3G (ha3g). Ook werd bekeken of Trif-interacties in MAPPIT in de cel konden worden gedetecteerd door middel van verkorten van de verblijftijd met het Tet-On systeem Constructiewerk Trif P>H-prey Deze mutatie zorgt voor verstoringen van TIR-TIR interacties van TIR-bevattende moleculen zoals Mal/MyD88 en IL1RacP en duidt er dus op dat de geconserveerde proline in de BB-loop van box2 één van de interactiesites is. De P>H-mutatie in Trif zorgt voor cytoplasmatische lokalisatie. [37] Echter, kan verwacht worden dat deze mutant ook een verstoring van TIR-TIRdomein gemediëerde interacties zal vertonen. Toch wilden we de mogelijkheid testen of we aan de hand van deze Trif-mutant de interactie tussen Trif en zijn bindingspartners kunnen detecteren met MAPPIT. Het construct wordt gemaakt door middel van een mutagenesereactie uit te voeren op de Trifvector. Hierbij wordt gebruik gemaakt van de volgende mutageneseprimers (zie Tabel IV): 27

37 Trif P>H FWD REV Tabel IV: Mutageneseprimers Trif P>H CCACCTTCTGCGAGGATTTCCAGGTACACGGGCGCGGGGAGCTGAG (-Xma) CTCAGCTCCCCGCGCCCGTGTACCTGGAAATCCTCGCAGAAGGTGG (-Xma) Wanneer deze mutatie succesvol is ingebouwd, zal een XmaI-restrictieplaats verdwijnen. De plasmides worden geëlektroporeerd in XL1Blue-cellen. Vervolgens wordt een restrictiedigest (XmaI) uitgevoerd op het mini-prep-dna. (zie Figuur 11 in Addendum) Op positieve kolonies wordt een midi-prep (MBU-I-4901) uitgevoerd, zodat een grotere DNA-opbrengst wordt bekomen. Dit DNA wordt, na sequenering, gebruikt voor het uitvoeren van een MAPPITexperiment Induceerbare expressie van de Trif-prey m.b.v. het Tet-On systeem Cellen kunnen een verminderde overleving vertonen als ze lang onderhevig zijn aan vreemde omstandigheden, in het geval van expressie van een vreemd, ingebracht eiwit. Normaal worden cellen, na transfectie, de volgende dag gewassen en de daaropvolgende dag naar 96-well platen gebracht. De dag later worden deze pas gemeten, en de getransfecteerde cellen zijn dus 3 dagen onderhevig aan veranderde interne omstandigheden. Het voordeel van het Tet-On systeem is dat de cellen getransfecteerd worden met een construct dat niets doet in afwezigheid van doxycycline. Pas wanneer op dag 3 de cellen overgebracht worden naar 96-well platen, worden deze met doxycycline gestimuleerd en kan het gen van interesse tot expressie komen. Er bestaan varianten van dit systeem, hieronder wordt op basis van het Tet-Off systeem het Tet-On systeem, dat gebruikt wordt in dit onderzoek, besproken. Een sleutelcomponent van het Tet-Off systeem is een 37 kda transcriptie-activerend fusieproteïne afgeleid van TetR, inclusief zijn binding domain (BD) en het activation domain (AD) van het herpes simplex virus VP16-proteïne. Het VP16 AD converteert TetR van een repressor naar een transcriptionele activator, en het resulterende proteïne is de tetracyclinecontrolled transactivator (tta). De tweede sleutelcomponent van het Tet-Off systeem is het tetracycline-response element (TRE). Deze sequentie bestaat uit zeven directe herhalingen van een 42bp sequentie die Tet operator sequenties (TetO) bevat, en is net upstream van een minimale CMV-promotor (PminCMV) gelocaliseerd. Deze promotor mist het sterke enhancerelement van het wild-type CMV. Zoals TetR is tta niet in staat om TetO te binden in aanwezigheid van tetracycline of doxycycline. Transcriptie van het gen van interesse, 28

38 gelokaliseerd downstream van TRE, wordt in het Tet-Off systeem geactiveerd door tetracycline te verwijderen uit het cultuurmedium. (zie Figuur 12) [38] Figuur 12: Tet-Off Advanced en Tet-On Advanced systeem. Het Tet-Off-systeem expresseert het gen van interesse na verwijderen van tetracycline. Het Tet-On Advanced systeem daarentegen heeft een reverse transactivator en zal zorgen voor transcriptie van het gen van interesse wanneer doxycycline wordt toegevoegd. Inductie van een gen van interesse gebeurt als volgt in het Tet-On systeem. De Tet-On regulatoire proteïnes zijn gebaseerd op mutante "reverse" Tet repressoren (rtetrs) die TetO binden in de aanwezigheid van doxycycline. Deze rtetrs zijn met hun BD gefuseerd aan het minimale VP16 ADs. De resulterende reverse transactivator (rtta-advanced) activeert transcriptie van TRE als een gevolg van behandeling met doxyxycline, en niet door dit weg te nemen, zoals het geval is met Tet-Off. (zie Figuur 12) [38] Trif (MBU-I-2426) en een in het labo beschikbare Tet-On prey-vector worden beiden geknipt met EcoRI/NotI. (zie Figuur 13) Hierdoor krijgen beide fragmenten complementaire eindjes, die aan elkaar kunnen worden geligeerd. (zie Figuur 14 in Addendum) 29

39 Figuur 13: Opbouw Trif Tet-On-vector. A. Tet-On-vector, B. Trif-vector, C. Trif Tet-On-vector. De hieruit resulterende ligatie wordt geëlektroporeerd in DH10B s. Het mini-prep-dna van de kolonies wordt gecontroleerd door middel van een restrictiedigest met PstI. (zie Figuur 15 in Addendum) Op basis van dit restrictiedigest wordt verdergewerkt met kolonie 2, daar deze (naast anderen) DNA bevat van succesvol geknipt en geligeerd materiaal. Er wordt een midi-prep van deze kolonie ingezet. (MBU-I-5137) Koppeling van de Trif-prey aan een cytoplasmatisch retentiesignaal Trif wordt opgenomen in vectoren met een cytoplasmatisch retentiesignaal (CRS), daar deze ook zouden kunnen zorgen voor redirectie van Trif naar het cytoplasma. Er werd gekozen voor het CRS van APOBEC3G (ha3g). Dit CRS zal de expressie van wild-type ha3g en chimere constructen beperken tot het cytoplasma. Wild-type ha3g is een factor die verdediging biedt tegen HIV-1 en andere exogene retrovirussen en endogene retro-elementen. [39] De gemaakte Trif- APOBEC-constructen zijn de volgende : A (pmg2-crs-a3g-i-194-trif), B (pmg2-crs-a3g Trif), C (pm-flag-a3g-i-194-g1-trif) en D (pm-flag-a3g g1-trif). Deze 30

40 bevatten allen het CRS van ha3g, in A en C van AZ en in het B en D van AZ De reden hiervoor is dat 194 AZ tamelijk groot is en mogelijks interacties zou kunnen beïnvloeden. Vandaar bevatten B en D AZ van ha3g, wat toch het volledige CRS zou bevatten. Het verschil in constructen A en B en constructen C en D zit hem in de positie van het CRS. In A en B zit het CRS tussen gp130 van de prey en Trif en bij C en D zit dit tussen de flag-tag en gp130 van de prey. (zie Figuur 16) Figuur 16: CRS-Trif-constructen. A: pmg2-crs-a3g-i-194-trif; B: pmg2-crs-a3g trif; C: pm-flag-a3g-i-194-g1-trif; D: pm-flag-a3g g1-trif. Vectoren (CRS-vector) en insert (Trif) worden geknipt met EcoRI/NotI om zo complementaire eindjes te genereren. (zie Figuur 17 in Addendum) 31

41 Ligaties worden geëlektroporeerd in DH10B s en mini-prep-dna van de hierdoor verkregen kolonies wordt onderworpen aan een restrictiedigest met BamHI. (zie Figuur 18 in Addendum) Dit zit er niet gelukt uit, mogelijk door zelfsluiting van de geknipte fragmenten en wordt onderzocht met behulp van de CIP-procedure. Hierdoor worden fosfaat-groepen van de geknipte eindjes verwijderd, zodat deze niet meer vanzelf kunnen sluiten. Het gecip te DNA wordt uitgeplaat in in XL1Blue s (voorkomen zelfsluiters). Op deze kolonies wordt mini-prep uitgevoerd, waarna de kolonies worden gecontroleerd met een restrictiedigest met BamHI. (zie Figuur 19 in Addendum) Finaal wordt midi-prep uitgevoerd, telkens van kolonie 4 (zie Figuur 19 in Addendum), daar deze patronen vertonen van een geslaagd restrictiedigest Resultaten Er werd een MAPPIT-assay uitgevoerd in HEK293T-cellen met het midi-prep DNA verkregen uit bovenstaand constructiewerk. Deze cellen werden overgebracht naar een 96-well plaat en al dan niet gestimuleerd met leptine. De resultaten worden uitgezet als foldinductie, wat de verhouding is van het absoluut luciferase-signaal van de gestimuleerde cellen op het absoluut luciferase-signaal van de niet-gestimuleerde cellen. Als positieve controle werd de pmg2- Ringfinger41-prey gebruikt, een prey die met JAK2-kinase interageert Trif P>H-prey Vooreerst werd getest of de Trif P>H-prey kan interageren met het TIR-domein van TLR3 of TLR4. Daarvoor werd een MAPPIT-assay uitgevoerd met het intracellulaire stuk van TLR3 of TLR4 als bait (pcll-tlr3ic/pcll-tlr4ic). Ook werd onderzocht of co-expressie van Tram met de Trif-prey en TLR4ic-bait deze interactie kan koppelen. Als negatieve controle werd ook de interactie van de Trif P>H-prey met een lege bait onderzocht. In de eerste grafiek overheerst duidelijk het effect van de positieve controle (zie Figuur 20A), dus werd deze in de tweede grafiek (zie Figuur 20B) weggelaten. Expressiecontroles werden uitgevoerd van de preyconstructen. (zie Figuur 20C) 32

42 Figuur 20: MAPPIT-resultaten van de P>H mutatie in het TIR-domein van Trif. A. De positieve controle RNF41 gaat de andere resultaten overheersen, dus werd deze in deel B van de figuur weggelaten. C. Expressiecontrole MAPPIT P>H-experiment. Uit bovenstaande MAPPIT-data kan besloten worden dat Trif P>H geen interactie vertoont met de bait-constructen, hoewel deze prey echter wel tot expressie komt. (zie Figuur 20C) Vervolgens werden van deze constructen opnames gemaakt met een fluorescentiemicroscoop (met behulp van antilichamen tegen hun flag-tag), om te kijken of Trif P>H zich al dan niet cytoplasmatisch bevindt. Er kan een duidelijk verschil in lokalisatie worden waargenomen tussen de Trif P>Hprey (zie Figuur 21D) en WT Trif-prey (zie Figuur 21A). Daar waar de Trif-prey een duidelijk perinucleaire expressie vertoont, heeft de P>H-prey een meer cytoplasmatische spreiding die overeenstemt met MyD88- en Mal-prey lokalisatie (zie Figuur 21B en 21C). Er kan dus besloten worden dat deze geconserveerde proline in de BB-loop van het TIR van Trif niet alleen essentieel is voor TIR-TIR interacties, maar ook betrokken is in Trif lokalisatie. 33

43 Figuur 21: Immuno-fluorescentie-opnames van A. wt Trif; B. MyD88-prey; C. Mal-prey en D. Trif P>Hprey Induceerbare expressie van de Trif-prey m.b.v. het Tet-On systeem Er werd getest of Trif-interacties detecteerbaar worden in MAPPIT door Trif gecontroleerd tot expressie te laten komen via het Tet-On-systeem. De interactie werd getest met de pcll-bait en de pcll-tlr3ic-bait. Getransfecteerde cellen werden hier ook overgebracht naar een 96-well plaat, maar deze werden gestimuleerd volgens 4 condities: geen stimulus, enkel doxycycline, enkel leptine en doxycycline en lepine samen. (zie Figuur 22) De wells zonder stimulus zijn een controle, en deze met doxycycline zijn om te kijken of een bait-afhankelijk signaal kan worden waargenomen wanneer enkel het construct tot expressie komt, maar dit nog niet gestimuleerd wordt met leptine. Enkel leptine is om te kijken of leptine op zich een effect heeft op het construct (en dat het Tet-On systeem dus niet goed zou werken) en leptine samen met doxycycline samen is de setup waarbij het MAPPIT-experiment zou moeten werken. Geen stimulus + doxycycline + leptine +doxycycline + leptine Figuur 22: Stimulatiecondities Tet-On-experiment. In een 96-well plaat werden de cellen van 1 transfectie als volgt gestimuleerd: de eerste 3 wells bleven ongestimuleerd, de volgende 3 enkel met doxycycline, de volgende 3 enkel met leptine en de laatste 3 met doxycycline en leptine samen. Het signaal van de conditie met doxycycline is dus achtergrond en kan worden gebruikt voor het berekenen van de foldinductie. Bij het uitzetten van de resultaten werd echter geopteerd om de 4 34

44 stimulatiecondities naast elkaar uit te zetten, waarbij kan worden vergeleken tussen condities onderling waar de beste interactie plaatsgrijpt. (zie Figuur 23) Figuur23: MAPPIT-resultaten van Trif-Tet-On systeem. A. Figuur betreffende de interactie met alle preys en de pcll-bait. B. Figuur betreffende de interactie met alle preys en de pcll-tlr4ic-bait. C. Figuur betreffende de interactie met alle preys en de pcll-tlr3ic-bait. D. Expressiecontrole Tet-On-systeem transfecties. Er is duidelijk geen effect te zien van dit Tet-On systeem. Zowel Tram-binding individueel, Trifbinding individueel en Tram en Trif-binding samen zijn negatief. Er wordt verwacht dat Tram een positief signaal zou geven met pcll-tlr4ic-bait, maar dit is hier niet te zien. Gecontroleerde Trif-expressie heeft dus geen effect in het detecteren van interacties met MAPPIT Koppeling van de Trif-prey aan een cytoplasmatisch retentiesignaal De MAPPIT-CRS-constructen werden getest op interacties met pcll- en pcll-tlr4-baits. Op de eerste figuur (zie Figuur 24A) wordt alweer een grote invloed gezien van de positieve controle, dus wordt ter vergelijking in de grafiek ernaast deze positieve controle weggelaten. (zie Figuur 24B) Een uitschieter wordt gezien bij Tram + pmg2-crs-a3g-i-194-trif -prey samen met pcll-tlr4ic -bait. Een fold-inductie van 2,5 kan echter als achtergrond beschouwd worden. 35

45 Figuur 24: MAPPIT-analyse van de ha3g-constructen. A. Verwerking resultaten inclusief de positieve controle (pmg2-rnf41). Aangezien deze de andere resultaten overschaduwt, wordt deze in het tweede luik (B) niet weergegeven. Prey A: pmg2-crs-a3g-i-194-trif; Prey B: pmg2-crs-a3g trif; Prey C: pm-flag-a3g-i-194-g1-trif; Prey D: pm-flag-a3g g1-trif. C. Expressie-controle Expressie-controles werden uitgevoerd (zie Figuur 24C) en er werden van deze constructen wederom microscopische opnames gemaakt (zie Figuur 25). Figuur 25. Immunofluorescentie-weergave van de verschillende h3ag-constructen. A. Wild-type Trif, B. MyD88 en Mal (kleine figuur in de hoek), C: pmg2-crs-a3g-i-194-trif; D: pmg2-crs-a3g Trif; E: pm-flag-a3g-i-194-g1-trif; F: pm-flag-a3g g1-trif. 36

46 De CRS-constructen C, D, E en F (respectievelijk pmg2-crs-a3g-i-194-trif, pmg2-crs- A3G Trif, pm-flag-a3g-i-194-g1-trif en pm-flag-a3g g1-trif) vertonen hetzelfde expressiepatroon als WT Trif (zie Figuur 25C, 25D, 25E en 25F versus Figuur 25A, terwijl MyD88 en Mal (zie Figuur 25B, Mal rechterbovenhoek) een cytoplasmatisch expressiepatroon vertonen. Hieruit kan besloten worden dat Trif niet naar het cytoplasma wordt gelokaliseerd door fusie met het APOBEC3G CRS, wat verklaart waarom interacties met deze preys niet kunnen gedetecteerd worden met de MAPPIT-techniek. 3.2 Co-IP en AlphaScreen analyse van Tram en Trif TIR mutanten Momenteel wordt in het labo een mutagenesestudie op de TIR domeinen van MyD88, Mal en TLR4 uitgevoerd, om na te gaan welke residu s betrokken zijn bij TIR-TIR interacties. In analogie met dit werk, wordt in deze thesis het effect van enkele mutaties in het TIR domein van Trif en Tram onderzocht. Van Trif worden twee mutanten gemaakt, namelijk de P>H-mutant (zie MAPPIT-experimenten) en een C>S-mutant. De analoge mutatie in TLR2 (TLR2C713S) verstoort TLR2 signaaltransductie [40], wat er op zou kunnen wijzen dat deze cysteïne betrokken is bij TIR-TIR interacties. Bovendien wordt TLR-signaaltransductie beïnvloed door de redox in de cel en reactive oxygen species [41], wat er op zou kunnen wijzen dat deze cysteïne het doelwit vormt van zwavelbrugvorming of een andere modificatie. Deze C>S-mutant van Tram wordt ook gemaakt. In het TIR-domein van Tram aligneert de geconserveerde proline uit de BB-loop van het Trif TIR-domein met een cysteïne. Daarom werd de overeenkomstige Tram C>H-mutant gemaakt. In de aminozuursequentie van Tram wordt deze cysteïne voorafgegaan door een proline, welke ook werd gemuteerd naar een histidine (Tram P>H). (zie Figuur 2) Initieel was het de bedoeling om het effect van deze mutaties na te gaan in MAPPIT. Echter, aangezien we geen functionele Trif-interacties hebben kunnen waarnemen in MAPPIT, hebben we deze analyse uitgevoerd door middel van co-immunoprecipitatie- en AlphaScreen-experimenten. Het voordeel van AlphaScreen en co-ip is dat interacties kunnen worden gedetecteerd, ongeacht hun cellulaire locatie, in tegenstelling tot MAPPIT Constructiewerk De pmet7-flag-trif en pmet7-flag-tram vectoren waren reeds voorhanden op het labo. Deze vectoren coderen voor flag-tagged Trif en Tram. In deze vectoren werden de mutaties aangebracht door middel van PCR-gebaseerde mutagenese. (Verschillende primers: zie Tabel V) Trif en Tram werden ook in de pcaggse-vector gecloneerd, wat na transfectie leidt tot expressie van E-getagged Trif en Tram. 37

47 Tabel V: Verschillende primers voor constructie van Tram-Tir-mutanten en Trif-Tir-mutanten. pcaggse-trif pcaggse-tram pcaggse-trif P>H Trif P>H-flag Trif C>S-flag Tram C>S-flag Tram P>H-flag Tram C>H-flag FWD REV FWD REV FWD REV FWD REV FWD REV FWD REV FWD REV FWD REV GACTGCGGCCGCGATGGCCTGCACAGGCCC (+NotI) GCTCCTCGAGTCATTCTGCCTCCTGCGTC (+XhoI) GACTGCGGCCGCGATGGGTATCGGGAAGTC (+NotI) GCTCCTCGAGTCAGGCAATAAATTGTC (+XhoI) CCACCTTCTGCGAGGATTTCCAGGTACACGGGCGCGGGGAGCTGAG (- XmaI) CTCAGCTCCCCGCGCCCGTGTACCTGGAAATCCTCGCAGAAGGTGG (- XmaI) CCACCTTCTGCGAGGATTTCCAGGTACACGGGCGCGGGGAGCTGAG (- XmaI) CTCAGCTCCCCGCGCCCGTGTACCTGGAAATCCTCGCAGAAGGTGG (- XmaI) CCTCCAACTTCGACTCGCGACTGAGCCTGCACC (+NruI) GGTGCAGGCTCAGTCGCGAGTCGAAGTTGGAGG (+NruI) CTTTTTAAGAGATACTTGGTCCAATTTCCAGTTCTATACG CGTATAGAACTGGAAATTGGACCAAGTATCTCTTAAAAAG GGAATAATCTTTGCTGAGATGCATTGTGGCAGACAGCATTTACAG (+NsiI) CTGTAAATGCTGTCTGCCACAATGCATCTCAGCAAAGATTATTCC (+NsiI) CTTTGCTGAGATGCCACACGGCCGACAGCATTTACAG (+EagI) CTGTAAATGCTGTCGGCCGTGTGGCATCTCAGCAAAG (+EagI) Er werd getracht om de Trif P>H-constructen te maken, maar deze zijn niet gelukt binnen het vooropgestelde tijdskader. De PCR-reacties pcaggse-trif en pcaggse-tram (zie Figuur 26 in Addendum) en de E-tag-vector (MBU-I-2662) werden geknipt met NotI en XhoI, om complementaire eindjes te genereren (zie Figuur 27 in Addendum). Ligaties werden geëlektroporeerd in DH10Bs. Na een mini-prep kan door een restrictiedigest (Tram-E met BglII Trif-E met BamHII) worden bepaald welke kolonies geschikt zijn voor een midi-prep (zie Figuur 28 in Addendum). PCR-mutagenese-producten (alle flag-constructen) worden na een digest met DpnI geëlektroporeerd in XL1Blue s. Na mini-prep kan op het DNA een restrictiedigest worden uitgevoerd, door verdwijnen of additie van restrictieplaatsen door de mutagenesereactie en kan van succesvolle kolonies ook een midi-prep ingezet worden. (zie Tabel V, zie Figuur 29 en 30 in Addendum) Resultaten Trif homodimerisatie Co-IP en AlphaScreen-experimenten werden uitgevoerd voor het detecteren van Trifhomodimerisatie. Combinaties van Trif-flag, de Trif mutant C>S-flag en Trif-E werden voor de 38

48 co-ip-analyse getransfecteerd in HEK293T-cellen. In het totaallysaat (TL) is amper expressie van anti-flag-constructen waar te nemen (zie Figuur 31, bovenste paneel, sterk verhelderd). Ook zijn beide co-ips vergelijkbaar, doordat strippen hier geen afdoende effect had. Hierdoor kunnen geen conclusies worden getrokken uit dit co-ip experiment. Figuur 31: Co-IP Trif-homodimerisatie. Op analoge wijze werd Trif-homodimerisatie onderzocht via een AlphaScreen-experiment, wat leidde tot eenduidigere resultaten. Hieruit bleek dat WT Trif-WT Trif-binding significant grotere waarden gaf dan Trif C>S-WT Trif-binding. Door deze mutatie zal de binding ongeveer 1/3 aan sterkte verliezen. Er kan dus aangenomen worden dat de C>S-mutatie een duidelijke invloed heeft op de Trif-homodimerisatie. (zie Figuur 32) 39

49 Figuur 32: AlphaScreen-resultaten Trif-homodimerisatie Trif-Tram heterodimerisatie Co-IP en AlphaScreen-experimenten werden ook uitgevoerd voor het detecteren van de Trif- Tram heterodimerisatie. (zie Figuur 33) Voor de Co-IP analyse werden verschillende combinaties van pcaggse-tram, pcaggse-trif, pmet7-flag-trif en pmet7-flag-trif C>S getransfecteerd in HEK293T cellen. Er kan een verminderde precipitatie van Tram worden waargenomen wanneer het geëxpresseerd wordt samen met Trif C>S in plaats van WT Trif (zie Figuur 33, middelste paneel). Echter, expressiecontroles tonen aan dat de Trif C>S-mutant minder tot expressie gekomen is (zie Figuur 33, bovenste paneel), wat interpretatie van dit fenomeen onmogelijk maakt. 40

50 Figuur 33: Co-IP Trif-Tram interactie Op analoge wijze werden AlphaScreen-experimenten uitgevoerd. (zie Figuur 34). Hieruit blijkt duidelijk dat de C>S-mutatie in Trif geen abrogerend effect heeft op de Trif-Tram-interactie. Expressie-controles geven ook aan dat Trif en de Trif C>S-mutant een vergelijkbaar expressiepatroon hebben, wat deze stelling bekrachtigt. (zie Figuur 34) 41

51 Figuur 34: AlphaScreen-resultaten Tram-Trif-binding Tram-homodimerisatie Tenslotte werd Tram-homodimerisatie bekeken met zowel co-ip-experimenten als AlphaScreenexperimenten. De experimentele setup was gelijkaardig aan bovenstaande assays. Uit het co-ipexperiment werd opgemerkt dat de Tram-Tram binding (positieve controle) minder positief is dan de Tram-Tram-mutant binding. Dit is te verklaren doordat tijdens het co-ip-experiment een deel van het cellysaat is verloren gegaan. De drie hieropvolgende bindingen tussen Tram en Trammutant zijn vergelijkbaar in bandintensiteit, maar wegens verlies van de positieve controle kan hier weinig over besloten worden. (zie Figuur 35) 42

52 Figuur 35: Co-IP Tram-Tram-homodimerisatie In analogie met vorige AlphaScreen-experimenten, werd de Tram-homodimerisatie meerdere malen onderzocht. In tegenstelling tot Trif-homodimerisatie en Trif-Tram heterodimerisatie, bleken de onderlinge resultaten niet volledig complementair. Daarom worden 2 experimenten weergegeven en besproken, wegens een duidelijker effect van de Tram C>S-mutant in het tweede experiment (zie Figuur 36 en 37). Uit het eerste AlphaScreen-experiment, wordt duidelijk het verschil opgemerkt tussen WT Tram-WT Tram-interactie en binding tussen Tram en zijn mutanten. Homodimerisatie tussen WT Tram en Tram C>H of Tram P>H is volledig geabrogeerd, wat wederom het belang van de BB-loop in TIR-TIR interacties onderstreept. Analyse van de homodimerisatie-eigenschappen van de Tram C>S-mutant is iets complexer. In een eerste experiment kon een substantiële daling van de interactie worden waargenomen. In tegenstelling tot de Tram P>H- en Tram C>H-mutanten, was er nog een residuele interactie waarneembaar. Dit zou kunnen wijzen op het feit dat de regio in het Tram TIR-domein rond deze cysteïne minder betrokken is bij Tram homodimerisatie dan de BB-loop regio. Uit het tweede AlphaScreen-experiment konden we waarnemen dat deze Tram C>S-mutant leidt tot een volledig verlies van interactie. Dit zou kunnen verklaard worden doordat de expressiecontroles een duidelijk lagere expressie aantonen van deze Tram-mutant in vergelijking met het WT Tram. (zie Figuur 37) Verder onderzoek is hier dus noodzakelijk. 43

53 Figuur 36: AlphaScreen-resultaten Tram-homodimerisatie Figuur 37: AlphaScreen-resultaten Tram C>S-homodimerisatie 44

54 4 Bespreking Toll-Like receptoren (TLRs) zijn type-i transmembranaire receptoren die geconserveerde patronen van pathogenen herkennen, zoals bacterieel lipopolysaccharide (LPS), dsrna of bacterieel DNA. Ze zijn belangrijke componenten van het aangeboren (innate) immuunsysteem. Ze vormen een eerstelijnsverdedigingssysteem tegen pathogenen door de productie van inflammatoire cytokines en maturatie van immuuncellen. Bovendien leidt TLR-stimulatie tot de activatie en oriëntatie van de adaptieve immuunrespons. Door hun centrale rol in het immuunsysteem is het dus niet verrassend dat afwijkende TLR-signalisatie leidt tot ziektecondities. Ongecontroleerde TLR-activatie leidt tot een overmatige productie van proinflammatoire cytokines, met schadelijke gevolgen voor de gastheer. Gereduceerde signalisatie door afwijkingen in de TLR-pathway zal leiden tot een verhoogde vatbaarheid voor bacteriële en virale infecties. De omvang hiervan hangt af van de hiërarchie van de afwijkende component van de pathway. Overmatige of ongeoorloofde TLR-activatie wordt bovendien waargenomen bij verscheidene auto-immuunziekten zoals multipele sclerose, type-i diabetes mellitus en reumatoïde artritis. Verder onderzoek op deze TLRs is dus nuttig voor de ontwikkeling van therapeutica die inwerken op het innate immuunsysteem, waarbij het ontwerpen van zowel TLRantagonisten als TLR-agonisten nuttig zou kunnen zijn. Na ligandbinding worden TLRs gedimeriseerd en worden adaptor moleculen gerekruteerd. Al deze stappen worden gemedieerd door homotypische Toll-IL-1 receptor (TIR) domein interacties. Dit TIR-domein vormt dus een ideale target voor de ontwikkeling van TLR-antagonisten. Echter, de modaliteiten van dergelijke TIR-TIR interacties zijn verre van gekend. Daarom loopt in het laboratorium een mutagenesestudie om de regio s belangrijk bij TIR interacties van TLR4, en de TLR-adaptoren Mal en MyD88 te identificeren. In deze thesis werd deze studie uitgebreid naar de andere TLR-adaptoren Trif en Tram. Initieel was het de bedoeling deze karakterisatie uit te voeren door middel van MAPPITexperimenten, een zoogdier 2-hybride systeem ontwikkeld op het labo. Echter, Trif-interacties konden tot op heden met het MAPPIT systeem niet gedetecteerd worden, want Trif-expressie is beperkt tot het perinucleair compartiment, terwijl MAPPIT enkel interacties kan meten in het cytoplasma. Verscheidene strategieën werden bedacht om dit probleem te overkomen. Eerst werd het effect van een P>H-mutatie in het Trif TIR-domein uitgetest. Aangetoond werd dat mutatie van deze geconserveerde proline uit de BB-loop van het Trif TIR-domein tot een drastische 45

55 verandering van Trif-lokalisatie leidt. MAPPIT analyse met de Trif P>H prey bleef echter onmogelijk, hoewel opnames met de fluorescentiemicroscoop aantonen dat de Trif P>H-prey zich weldegelijk cytoplasmatisch bevindt. Hoewel het niet kan worden uitgesloten dat detectie van Trif TIR-interacties in MAPPIT technisch onmogelijk is, kan dit feit erop wijzen dat deze geconserveerde proline essentieel is voor Trif TIR-interacties. Bovendien werd ook induceerbare expressie van Trif en koppeling van Trif aan een cytoplasmatisch retentiesignaal van APOBEC3G onderzocht. Allen gaven deze geen interactiesignaal in MAPPIT, wat verklaard kan worden door een onveranderd expressiepatroon van Trif. Door het falen van de MAPPIT-setup, werd overgegaan tot co-immunoprecipitaties en AlphaScreen experimenten. Verscheidene mutanten van Trif en Tram werden gemaakt. De geconserveerde proline in de BB-loop van Trif aligneert bij Tram met een cysteïne. Daarom werd deze cysteïne gemuteerd naar een histidine. In de aminozuursequentie van Tram wordt deze cysteïne voorafgegaan door een proline, welke ook gemuteerd werd naar een histidine. Bovendien werd bij zowel Trif als Tram een TIR-mutant gemaakt waarbij een geconserveerde cysteïne in de αc-helix gemuteerd werd naar een serine. Analyse van deze mutanten door co-ip bleek insufficiënt om tot gefundeerde conclusies te kunnen komen. Daarom worden hieronder enkel de AlphaScreen-data besproken. De AlphaScreen-data worden samengevat in onderstaande tabel. (zie Tabel VI) Tabel VI: Overzicht van het effect van verschillende TIR mutanten op Trif en Tram interacties. Trif Tram / C>S / P>H C>H C>S Tram Trif / / De resultaten worden weergegeven in kleurschakeringen, waarbij het effect van de mutaties wordt weergegeven met een kleurcode (groen: geen effect, rood: drastisch, oranje: intermediair). 46

56 AlphaScreen experimenten betreffende Tram-homodimerisatie werden uitgevoerd uitgaande van de 3 beschreven Tram-mutanten. Er kon besloten worden dat mutaties van de geconserveerde proline en cysteïne in de box2-regio (BB-loop) van Tram TIR het grootste effect teweeg brachten, met een volledige abrogatie van de Tram-homodimerisatie tot gevolg. Wanneer de geconserveerde cysteïne uit de αc-helix werd gemuteerd, trad er eveneens een verlies van interactie op, doch kleiner dan de voorgaande mutaties. Dit kan wijzen op het feit dat de omgeving rond deze cysteïne in het Tram TIR-domein minder betrokken is bij Tramhomodimerisatie dan de BB-loop regio. Drastischere mutaties in deze regio kunnen hierover uitsluitsel brengen. De Tram-Trif-interactie werd enkel geëvalueerd bij de Trif C>S-mutant. In tegenstelling tot de Tram-homodimerisatie heeft deze mutatie geen effect op heterodimerisatie. Deze cysteïne blijkt echter wel betrokken te zijn in Trif-homodimerisatie, waar deze mutant leidt tot 1/3 e verlies in bindingssterkte. Geconcludeerd kan worden dat mutaties in de BB-loop van Tram het grootste effect vertonen, waarbij de Tram-homodimerisatie niet meer kan doorgaan. Evaluatie van de C>S-mutatie geeft verschillende resultaten bij Trif-Trif, Trif-Tram en Tram-Tram interacties. Bij Tram-Trif heterodimerisatie leidt deze mutatie niet tot reductie van interactie, terwijl deze zowel bij Trifhomodimerisatie als Tram-homodimerisatie wel een duidelijk effect heeft. Deze gegevens wijzen erop dat verschillende regio s van het TIR-domein betrokken zijn bij hetero- en homodimerisatie en vormen de basis voor een uitgebreidere mutagenesestudie, wat uiteindelijk zou kunnen leiden tot een volledige karakterisatie van TIR-TIR interacties. 47

57 5 Referenties 1. Janeway CA, Murphy K, Travers P, Walport M Janeway s Immunobiology. 7 th edition. 2. Ulrichts P MAPPIT analysis of the early events in Toll-Like receptor signalling. Rommelaere institute, UGent: Krishnan J, Selvarajoo K, Tsuchiya M, Lee G, Choi S Toll-like receptor signal transduction. Exp Mol Med 39: Hashimoto C, Hudson KL, Anderson KV The Toll gene of Drosophila, required for dorsal-ventral embryonic polarity, appears to encode a transmembrane protein. Cell 52: Lemaitre B, Nicolas E,Michaut L, Reichhart JM, Hoffmann JA The dorsoventral regulatory gene cassette Spätzle/Toll/Cactus controls the potent antifungal response in Drosophila adults. Cell 86: Dower SK, Kronheim SR, March CJ, Conlon PJ, Hopp TP, Gillis S, Urdal DL Detection and characterization of high affinity plasma membrane receptors for human interleukin 1. J Exp Med 162: Bird TA, Gearing AJ, Saklatvala J Murine interleukin 1 receptor. Direct identification by ligand blotting and purification to homogeneity of an interleukin 1-binding glycoprotein. J Biol Chem 263: Urdal DL, Call SM, Jackson JL, Dower SK Affinity purification and chemical analysis of the interleukin-1 receptor. J Biol Chem 263: Gay NJ, Keith FJ Drosophila Toll and IL-1 receptor. Nature 351: Dinarello CA The interleukin-1 family: 10 years of discovery. Faseb J 8: Dinarello CA Biologic basis for interleukin-1 in disease. Blood 87: Kenny EF, O Neill LA Signalling adaptors used by Toll-like receptors: An update. Cytokine 43: Núñez Miguel R, Wong J, Westoll JF, Brooks HJ, O'Neill LA, Gay NJ, Bryant CE, Monie TP A dimer of the Toll-like receptor 4 cytoplasmic domain provides a specific scaffold for the recruitment of signalling adaptor proteins. PLoS ONE 2(8): e O'Neill LA, Fitzgerald KA, Bowie AG The Toll IL-1 receptor adaptor family grows to five members. Trends in Immunology 24: Watters TM, Kenny EF, O'Neill LA Structure, function and regulation of the Toll/IL-1 receptor adaptor proteins. Immunol Cell Biol. 85: O'Neill LA, Bowie AG The family of five: TIR-domain containing adaptors in Toll-like receptor signalling. Nat Rev Immunol 7: Gautam JK, Ashish, Comeau LD, Krueger JK, Smith MF Jr Structural and functional evidence for the role of the TLR2 DD loop in TLR1/TLR2 heterodimerization and signaling. J Biol Chem. 281(40): Burns K, Janssens S, Brissoni B, Olivos N, Beyaert R, Tschopp J Inhibition of interleukin 1 receptor/toll-like receptor signaling through the alternatively spliced, short form of MyD88 is due to its failure to recruit IRAK-4. J Exp Med.197(2):

58 19. Kato H, Takeuchi O, Sato S, Yoneyama M, Yamamoto M, Matsui K, Uematsu S, Jung A, Kawai T, Ishii KJ, Yamaguchi O, Otsu K, Tsujimura T, Koh CS, Reis e Sousa C, Matsuura Y, Fujita T, Akira S Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 441(7089): Sheedy FJ, O'Neill LA The Troll in Toll: Mal and Tram as bridges for TLR2 and TLR4 signaling. J Leukoc Biol. 82(2): Sheedy FJ, O'Neill LA The Troll in Toll: Mal and Tram as bridges for TLR2 and TLR4 signaling. J Leukoc Biol. 82(2): Jenkins KA, Mansell A TIR-containing adaptors in Toll-like receptor signalling. Article in press. 22. Paun A, Reinert JT, Jiang Z, Medin C, Balkhi MY, Fitzgerald KA, Pitha PM Functional characterization of murine interferon regulatory factor 5 (IRF-5) and its role in the innate antiviral response. J Biol Chem. 283(21): Liew FY, Xu D, Brint EK, O'Neill LA Negative regulation of toll-like receptor-mediated immune responses. Nat Rev Immunol 5: Cook DN, Pisetsky DS, Schwartz DA Toll-like receptors in the pathogenesis of human disease. Nat Immunol 5: Chaudhuri N, Dower SK, Whyte MK, Sabroe I Toll-like receptors and chronic lung disease. Clin Sci (Lond) 109: Eriksson U, Ricci R, Hunziker L, Kurrer MO, Oudit GY, Watts TH, et al Dendritic cell-induced autoimmune heart failure requires cooperation between adaptive and innate immunity. Nat Med 9: Chen K, Iribarren P, Hu J, Chen J, Gong W, Cho EH, et al Activation of Toll-like receptor 2 on microglia promotes cell uptake of Alzheimer disease-associated amyloid beta peptide. J Biol Chem 281: Cui YH, Le Y, Gong W, Proost P, Van Damme J, Murphy WJ, et al Bacterial lipopolysaccharide selectively up-regulates the function of the chemotactic peptide receptor formyl peptide receptor 2 in murine microglial cells. J Immunol 168: Iribarren P, Chen K, Hu J, GongW, Cho EH, Lockett S, et al CpG-containing oligodeoxynucleotide promotes microglial cell uptake of amyloid beta 1-42 peptide by up-regulating the expression of the G-proteincoupled receptor mfpr2. FASEB J 19: Ulrichts P, Tavernier J MAPPIT analysis of early Toll-like receptor signalling events. Immunol Lett. 116(2): Tavernier J, Eyckerman S, Lemmens I, Van der Heyden J, Vandekerckhove J, Van Ostade X MAPPIT: a cytokine receptor-based two-hybrid method in mammalian cells. Clin Exp Allergy 32(10): Koegl M, Uetz P Improving yeast two-hybrid screening systems. Brief Funct Genomic Proteomic 6(4): Fields S, Song O A novel genetic system to detect protein-protein interactions. Nature 340: Bürckstümmer T, Bennett KL, Preradovic A, Schütze G, Hantschel O, Superti-Furga G, Bauch A. An efficient tandem affinity purification procedure for interaction proteomics in mammalian cells Nat Methods 3(12):

59 35. Ullman EF, Kirakossian H, Singh S, Wu ZP, Irvin BR, Pease JS, Switchenko AC, Irvine JD, Dafforn A, Skold CN, et al Luminescent oxygen channeling immunoassay: Measurement of particle binding kinetics by chemi-luminescence. Proc. Natl. Acad. Sci. USA 9: Ulrichts P, Peelman F, Beyaert R, Tavernier J MAPPIT analysis of TLR adaptor complexes. FEBS Lett. 581(4): Funami K, Sasai M, Oshiumi H, Seya T, Matsumoto M Homo-oligomerization is essential for Toll/interleukin-1 receptor domain-containing adaptor molecule-1-mediated NF-kappaB and interferon regulatory factor-3 activation. J Biol Chem. 283(26): Urlinger S, Baron U, Thellmann M, Hasan MT, Bujard H, Hillen W Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity.urlinger S, Baron U, Thellmann M, Hasan MT, Bujard H, Hillen W. Proc Natl Acad Sci U S A. 97(14): Bennett RP, Presnyak V, Wedekind JE, Smith HC Nuclear Exclusion of the HIV-1 host defense factor APOBEC3G requires a novel cytoplasmic retention signal and is not dependent on RNA binding. J Biol Chem. 283(12): Tao X, Xu Y, Zheng Y, Beg AA, Tong L An extensively associated dimer in the structure of the C713S mutant of the TIR domain of human TLR2. Biochem Biophys Res Commun. 299(2): Kohchi C, Inagawa H, Nishizawa T, Soma G ROS and Innate Immunity. Anticancer Res. 29(3):

60 Addendum 1. Protocols DNA-zuiveren uit agarosegel DNA-band uitsnijden onder UV-licht en in een epje bewaren 600 μl binding buffer (NT-buffer) toevoegen 5-10 minuten incuberen op 50 C, zachtjes schuddend om zo de agarose op te lossen mengsel over een silica-kolom laden. om het DNA te binden op de kolom 1 minuut centrifugeren op x g wassen met 600 μl washing buffer (NT3) en nogmaals 1 minuut centrifugeren op x g de kolom drogen om alle ethanol van de kolom te verwijderen door 2 minuten te centrifugeren op x g μl elution-buffer (NE-buffer) toevoegen en 1 minuut op kamertemperatuur incuberen DNA elueren door 1 minuut te centrifugeren op x g Mini-prep bacteriële cellen overnacht, in antibiotica-bevattend medium, waar de succesvol getransfecteerde cellen een resistentiegen tegen hebben, in cultuur brengen door aanstippen van kolonies en deze over te brengen in een 24-well plaat in 2 ml LBmedium 24-well plaat 10 minuten centrifugeren aan 1000 x g het supernatans (medium) weggieten de bacteriële cellen resuspenderen in 250 μl A1-buffer de cellen lyseren door toevoegen van 250 μl A2-buffer (2-5 minuten incubatietijd) door toevoegen van 350 μl A3 de oplossing neutraliseren 10 minuten afdraaien op volle snelheid supernatans overbrengen op silica-kolom wassen met 600 μl AW-buffer 2x wassen met 900 μl A4-buffer

61 silica-kolom laten drogen in vaccuüm DNA elueren met μl NE-buffer Midi-prep bacteriële cellen overnacht in een erlenmeyer in cultuur brengen in 50 ml antibioticabevattend medium cellen precipiteren door 15 min centrifugeren in bluecaps aan 4500 à 6000 x g 4 ml buffer S1 toevoegen en de cellen worden hierin resuspenderen 4 ml buffer S2 toevoegen en dit mixen door de bluecaps een aantal maal om te keren 2-3 min incubatie (max 5min) 4 ml buffer S3 toevoegen en de bluecaps een aantal maal omkeren vooraleer het lysaat over de kolom te brengen, deze equilibreren met 2,5 ml buffer N2 het lysaat over een filter in de kolom brengen de kolom wassen met 10 ml buffer N3 DNA elueren met 5 ml buffer N5 3,5 ml isopropanol bij het eluaat voegen, dit voorzichtig mengen en vervolgens 30 min centrifugeren aan 9000 x g het supernatans voorzichtig van de gevormde pellet halen 2 ml 70% ethanol op de pellet brengen en 10 min centrifugeren aan 9000 x g de pellet 5-10 min drogen aan de lucht en vervolgens oplossen in TE-buffer Splitsen van cellen 4 ml trypsine/edta op de cellen brengen cellen losmaken door tegen de falcon te tikken losgemaakte cellen samen met een hoeveelheid medium opnemen 3 min centrifugeren bij 1500 rpm supernatans verwijderen en de pellet oplossen in nieuw medium een deel van de opgeloste cellen naar een nieuwe falcon overbrengen met nieuw <medium

62 Cellen tellen de cellen trypsiniseren en centrifugeren supernatans afnemen en de cellen terug oplossen in een gekende hoeveelheid medium de pellet goed resuspenderen zodat er bij telling geen celclusters meer te zien zijn 25 µl celsuspensie bij 25 µl trypaanblauw voegen en goed mengen 25 µl in een Bürkerteller brengen en 2 grote vierkanten (waarvan 1 inclusief de afgrenzende lijnen en 1 zonder) tellen het aantal cellen vermenigvuldigd met 10 4 geeft het aantal cellen per ml MAPPIT Dag 1: cellen uitzaaien aan cellen/ml Dag 2: cellen transfecteren Dag 3 Dag 4 Reactiemengsel: 12.5 μl CaPO 4 (2,5M) 0.5 μl prey-dna (0.5 μg) 0.5 μl bait-dna (0.5 μg) 0.2 μl luciferase Aanlengen met H 2 O tot 125 μl medium van de cellen halen en cellen losmaken met trypsine 2 ml nieuw medium opbrengen en goed op- en neer-pipetteren om celclusters los te maken 6 x 100 µl van deze cellen (controles) in de 96-well plaat brengen 3 wells stimuleren met leptine en 3 wells niet stimuleren groeimedium van de wells verwijderen en de cellen 15 minuten incuberen in 50 µl lysebuffer (CCLR): 25 mm Tris-phosphate (ph=7,8), 2 mm DTT 2 mm 2,2 diaminocyclohexane-n,n,n,n -tetra-acetate (DCTA), 10% glycerol

63 1% Triton X µl luciferase-substraat op de cellen brengen: 20 mm Tricine 1.07 mm (MgCO 3 ) 4 Mg(OH) 2.5H 2 O 2.67 mm MgSO mm DTT 0,1 mm EDTA 270 µm CoA 530 µm ATP 470 µm D-Luciferin plaat analyseren met de luminocount (TopCount) SDS-Page cellen 2x wassen met PBS cellen losmaken met 150 μl RIPA per well o 500 ml RIPA 50 mm Tris ph mm NaCl 0.5% DOC 0.05% SDS 1% NP40 2 mm EDTA in H 2 O 1 protease-inhibitor pil per 50 ml cellen opnemen in een epje en 10 min afdraaien op 4 C supernatans bijhouden (=cellysaat) ladingsbuffer toevoegen eiwitten denatureren door 10 min op 95 C te brengen gedenatureerde eiwitten op een SDS-PAGE gel brengen gel op 80V laten lopen tot de eiwitten door de stacking-gel zijn wanneer cellen in de separating-gel zijn, verder laten lopen op 200V

64 Western Blot Protocol (in de koude kamer): sandwich maken met SDS-page-gel overnacht blotten op 30V met ponceau-red kijken waar DNA-banden zich bevinden en membraan knippen membraan 30 min-1h blokkeren met 10 ml blocking-buffer (50% blocking-buffer in 50% PBS) primair antilichaam gericht tegen flag toevoegen en 1h tot overnacht laten incuberen 4x wassen met TBS-T secundair antilichaam gericht tegen primair antilichaam toevoegen en 1h laten incuberen 4x wassen met TBS-T blotje scannen met Odyssey Co-IP Dag 1: cellen uitzaaien aan cellen/ml Dag 2: cellen transfecteren Reactiemengsel: 50 μl CaPO 4 (2,5M) 7.5 μl E-getagged DNA (0.5 μg) 7.5 μl flag-getagged DNA (0.5 μg) Aanlengen met H 2 O tot 500 μl Dag 3: medium afnemen cellen 2x wassen met PBS lyse met 1 ml modified RIPA 10 ml Modified RIPA (op basis van RIPA) 1 mm Na 3 VO 4 1 mm NaF 20 mm β-glycerofosfaat

65 10 minuten afdraaien bij 4 C aan rpm 40 µl supernatans bijhouden ( totaal lysaat en invriezen) 40 µl proteïne G beads per staal 3x wassen met modified RIPA (2 min. koud afdraaien bij max rpm) pellet (= beads) resuspenderen in modified RIPA tot ongeveer 1 ml ongeveer 120 µl beads per staal toevoegen (met P1000 met afgeknipte tip) 2h roteren bij 4 C (op een molentje ) = preclearen (verhindert aspecifiek plakken aan de beads) daarna stalen 2 minuten afdraaien bij 3000 rpm en supernatans in nieuw epje overbrengen overnacht roteren bij 4 C Dag 4: 50 µl proteïne G beads per staal nemen en 3x wassen met modified RIPA (2 minuten koud afdraaien bij max rpm) pellet (=beads) resuspenderen in modified RIPA tot ongeveer 1 ml ongeveer 120 µl per staal (met P1000 met afgeknipte tip) 2h roteren bij 4 C (op een molentje ) 4x wassen met modified RIPA (2 minuten aan 3000 rpm) zoveel mogelijk supernatans afnemen 50 µl 2xLB + beta-mercapto-ethanol bijdoen en invriezen opkoken en op eiwitgel laden (zie SDS-PAGE en Western Blot) AlphaScreen Dag 1: HekT cellen uitzaaien in 6-well platen Dag 2: transfectie Dag 3: wassen getransfecteerde cellen met PBS Dag 4: AlphaScreen-analyse o cellen wassen met koude PBS o losmaken met 200 µl koude TAP-lysebuffer 100 ml TAP-lysebuffer:

66 50 mm Tris-Hcl (ph 7.5) 125 mm NaCl 5% glycerol 0.2% NP mm MgCl 2 25 mm NaF 1 mm Na 3 VO 4 2 tabletten Complete Protease inhibitor cocktail o 30 minuten incuberen op ijs en loskloppen o lysaten afdraaien gedurende 30 minuten o supernatans bijhouden en hiermee verder werken o streptavidine-donor en anti-flag-acceptor-beads (5µg/µl) toevoegen zodat de eindconcentratie 0.02 µg/µl beads is o gebiotinyleerde anti-e-tag (in PBS (en Rnase in Trisbuffer)) toevoegen o incubeer gedurende 2h op de schudder o doe van elke reactie 20 µl in een 384 proxiplaat in 3-voud o positieve controle alphascreen: maak verdunningsreeks zoals aangegeven op de handleiding. Maak ook met de eigen TAP-lysebuffer een verdunningsreeks evenals in HekT-lysaten (enkel beads oplossen in HekT-lysaat, rest met TAPlysebuffer). Incubeer voor minstens 1h. o meting op de EnVision Immunofluorescentie - Coverslips 1h bij 37 C coaten met poly-l-lysine - Coverslips wassen met PBS - Cellen uitzaaien aan per well (6-well plaat) - Volgende dag cellen transfecteren (zie transfectie MAPPIT) - Fixeren/permeabiliseren/AB-staining o 2x wassen met 1ml PBS + Ca 2+ /Mg 2+ o 15 min fixeren in 750 μl 3% para-formaldehyde o 3x wassen met 1 ml PBS + Ca 2+ /Mg 2+ o 3 min permeabiliseren met 0.4% Triton in PBS + Ca 2+ /Mg 2+

67 - Monteren o 2x 3 min wassen met PBS + Ca 2+ /Mg 2+ o 10 min wassen met glycine in PBS + Ca 2+ /Mg 2 (0.75g/100 ml) o 1x wassen met PBS + Ca 2+ /Mg 2+ o 10 min blokkeren in 1 ml 1% BSA + Ca 2+ /Mg 2+ bij 20 C o Primair antilichaam aan 1/5000 toevoegen en 45 min incuberen bij 37 C o 4x wassen in BSA-PBS + Ca 2+ /Mg 2+ o Secundair antilichaam + DAPI aan respectievelijk 1/4000 en 1/5000 toevoegen en 20min incuberen bij 20 C o 3x wassen met BSA in PBS + Ca 2+ /Mg 2+ o 1x wassen met PBS + Ca 2+ /Mg 2+ o Draagglaasjes uit de alcoholoplossing halen o Drupje mounting solution op draagglaasje brengen o Coverslip met cellen naar beneden op deze druppel leggen o Met nagellak coverslip sealen aan de randen o In donker bewaren!

68 2. Figuren: Figuur 11: Figuur 11: Restrictiedigest van kolonies 1-8 van Trif P>H met XmaI. Hoewel het wild-type construct (C) niet geknipt is, is er wel duidelijk te zien dat mutante kolonies 1 grote band vertonen van 5773 bp en dit enkel kan voorkomen indien deze gemuteerd zijn. Figuur 14: Figuur 14: Gelelektroforese van geknipte Trif-plasmide (1) en geknipte Tet-On prey vector (2) met EcoRI/NotI. De Trif-band is deze in laan 1 van 2198 bp (onderste), de vector-band deze in laan 2 van 3131 bp (bovenste). Figuur 15: Figuur 15: Restrictiedigest Trif-Tet-On-construct met PstI. De banden die men verwacht te zien zijn 161 bp, 401 bp, 1203 bp en 3564 bp. Kolonie 2 wordt gebruikt voor mini-prep.

69 Figuur 16: Figuur 17: Gelelektroforese van pmg2-crs-a3g-i-194 (1), pmg2-crs-a3g (2), pm-flag-a3g-i-194-g1 (3), pm-flag-a3g g1 (4) en pmg2-trif (5). De gewenste banden zijn 4160 bp (1, bovenste), 3986 bp (2, bovenste), 4088 bp (3, bovenste), 3914 bp (4, bovenste) en 2198 bp (5, onderste). Figuur 18: Figuur 18: Restrictiedigest met BamHI van pmg2-crs-a3g-i-194-trif (1-7), pmg2-crs- A3G Trif (8-10), pm-flag-a3g-i-194-g1-trif (11-17) en pm-flag-a3g g1- Trif (18-24). Verwachte banden zijn : pmg2-crs-a3g-i-194-trif 478 bp, 2267 bp en 4173 bp; pmg2-crs-a3g trif 478 bp, 2093 bp en 3999 bp; pm-flag-a3g-i-194-g1-trif 1636 bp, 3542 bp en 6205 bp; pm-flag-a3g g1-trif 1462 bp, 3368 bp en 6031 bp. Dit digest ziet er niet geslaagd uit, wat kan komen door zelfsluiters.

70 Figuur 19: Figuur 19: Restrictiedigest met BamHI van pmg2-crs-a3g-i-194-trif (1-6), pmg2-crs- A3G Trif (7-12), pm-flag-a3g-i-194-g1-trif (13-18) en pm-flag-a3g g1- Trif (19-24). Verwachte banden zijn : pmg2-crs-a3g-i-194-trif 478 bp, 2267 bp en 4173 bp; pmg2-crs-a3g trif 478 bp, 2093 bp en 3999 bp; pm-flag-a3g-i-194-g1-trif 1636 bp, 3542 bp en 6205 bp; pm-flag-a3g g1-trif 1462 bp, 3368 bp en 6031 bp. De 4e kolonie werd telkens gebruikt voor midipreps. Figuur 26: Figuur 26: PCR-reacties van Tram (1, 2) en Trif (3, 4, 5). Laan 2 en laan 5 worden geëlueerd. Figuur 27: Figuur 27:PCR-producten geknipt met XhoI/NotI om complementaire eindjes te genereren. 1. Trif (3762 bp en 11 bp) waarvan het bovenste bandje werd geëlueerd, 2. Tram (750 bp), 3. E- tag vector (764 bp, 4823 bp), waarvan het bovenste bandje werd geëlueerd.

71 Figuur 28: Figuur 28: Restrictiedigesten Trif-E met BamHI (A) en Tram-E met BglII (B). Te verwachten banden voor Trif-E zijn 341 bp, 2391 bp en 4238 bp, en voor Tram-E zijn deze 634 bp en 4905 bp. Kolonie 2 van Trif-E en kolonie 3 van Tram-E werden ingezet als midiprep. Figuur 29: Figuur 29: Restrictiedigesten van de verschillende co-ip constructen. A. Restrictiedigest van Tram P>H-flag met NsiI. Te verwachten banden: 72 bp, 1074 bp en 2615 bp. B. Restrictiedigest van Tram C>H-flag (EAGI/EcoRI) en Tram C>S-flag (BamHI). Te verwachten banden bij Tram C>H-flag: 438 bp en 3323 bp. Te verwachten banden bij Tram C>S-flag: 1098 bp en 2663 bp. Van alle constructen werd kolonie 1 ingezet voor midiprep.

72 Figuur 30: Figuur 30. Restrictiedigest van Trif C>S-flag (EcoRI/NruI). Te verwachten banden bij Trif C>S-flag 1473 bp en 3719 bp. Kolonie 2 werd ingezet als midiprep.